├── .github
    └── workflows
    │   └── build.yml
├── .gitignore
├── README.md
├── SUMMARY.md
├── bake-index.js
├── book
    └── gitbook
    │   ├── fonts
    │       └── fontawesome
    │       │   └── fontawesome-webfont.woff
    │   ├── gitbook-plugin-fontsettings
    │       └── fontsettings.js
    │   ├── gitbook-plugin-lunr
    │       ├── lunr.js
    │       ├── lunr.min.js
    │       └── search-lunr.js
    │   ├── gitbook-plugin-search
    │       ├── search-engine.js
    │       └── search.js
    │   ├── gitbook-plugin-sharing
    │       └── buttons.js
    │   ├── gitbook.js
    │   ├── style.css
    │   ├── theme.js
    │   └── website.css
├── build.sh
├── manifest.scm
├── package-lock.json
├── package.json
├── pages
    ├── README.md
    ├── downloading_files_with_wget,_curl_and_ftp
    │   └── README.md
    ├── sun_grid_engine_for_beginners
    │   ├── README.md
    │   ├── faq.md
    │   ├── how_to_run_array_jobs.md
    │   ├── how_to_submit_a_job_using_qsub.md
    │   ├── how_to_use_interactive_sessions_with_qrsh.md
    │   ├── monitoring_cluster_usage_and_troubleshooting.md
    │   ├── parallel_environments.md
    │   ├── quickstart_and_basics.md
    │   └── resources_and_queues.md
    └── unix_for_beginners
    │   ├── README.md
    │   ├── basics.md
    │   ├── compressing_and_decompressing_files.md
    │   ├── connecting_to_a_remote_server.md
    │   ├── editing_and_manipulating_files.md
    │   ├── file_management_and_directories.md
    │   ├── more_on_unix.md
    │   └── shell_scripting_bash.md
├── template.html
└── template.json


/.github/workflows/build.yml:
--------------------------------------------------------------------------------
 1 | name: publish
 2 | on:
 3 |   push:
 4 | jobs:
 5 |   build:
 6 |     name: compile book from markdown
 7 |     runs-on: ubuntu-latest
 8 |     steps:
 9 |       - name: Checkout
10 |         uses: actions/checkout@v3
11 |       - name: Setup node
12 |         uses: actions/setup-node@v3
13 |         with:
14 |           node-version: 16.13.x
15 |           cache: npm
16 |       - name: Install pandoc
17 |         run: |
18 |           curl -fLo /tmp/pandoc-2.10.1-1-amd64.deb https://github.com/jgm/pandoc/releases/download/2.10.1/pandoc-2.10.1-1-amd64.deb
19 |           sudo dpkg -i /tmp/pandoc-2.10.1-1-amd64.deb
20 |       - name: Install npm packages
21 |         run: npm ci
22 |       - name: Build website
23 |         run: bash build.sh
24 |       - name: Upload artifact
25 |         uses: actions/upload-pages-artifact@v1
26 |         with:
27 |           name: 'github-pages'
28 |           path: 'book'
29 |   deploy:
30 |     needs: build
31 | 
32 |     # Grant GITHUB_TOKEN the permissions required to make a Pages deployment
33 |     permissions:
34 |       pages: write      # to deploy to Pages
35 |       id-token: write   # to verify the deployment originates from an appropriate source
36 | 
37 |     # Deploy to the github-pages environment
38 |     environment:
39 |       name: github-pages
40 |       url: ${{ steps.deployment.outputs.page_url }}
41 | 
42 |     # Specify runner + deployment step
43 |     runs-on: ubuntu-latest
44 |     steps:
45 |       - name: Deploy to GitHub Pages
46 |         id: deployment
47 |         uses: actions/deploy-pages@v1
48 | 


--------------------------------------------------------------------------------
/.gitignore:
--------------------------------------------------------------------------------
1 | book/search_index.json
2 | book/**.html
3 | book/downloading_files_with_wget,_curl_and_ftp/
4 | book/sun_grid_engine_for_beginners/
5 | book/unix_for_beginners/
6 | tmp/
7 | node_modules/


--------------------------------------------------------------------------------
/README.md:
--------------------------------------------------------------------------------
 1 | ![Group Logo](http://bioinformatics.mdc-berlin.de/img/GroupLogo.png)
 2 | 
 3 | ## Introduction to Unix and Grid Engine for beginners
 4 | 
 5 | This is a guide on using Unix-like systems and the Grid Engine cluster
 6 | environment.
 7 | 
 8 | The first chapter will introduce basic usage for Unix-like
 9 | systems. The second chapter will explore the Grid Engine environment
10 | and show how to use the queuing system from users perspective.
11 | 
12 | ###  What will you get out of this ?
13 | 
14 | After reading, you will:
15 | 
16 | * be able to use the command line interface to navigate the file system
17 | * use the command line to interrogate files
18 | * understand and write basic shell scripts
19 | * understand Grid Engine and queueing system
20 | * be able to submit jobs to a Grid Engine cluster and troubleshoot
21 | 
22 | ### Contribute to the development
23 | 
24 | You can contribute to the development of this guide using GitHub
25 | features such as pull-requests and issue creation.
26 | 
27 | 
28 | ### Build the book
29 | 
30 | This book is compiled with pandoc.
31 | 
32 | Run `guix environment -m manifest.scm` to enter a suitable environment
33 | to hack on this book.  Then run `npm ci` to install the lunr
34 | JavaScript library for the search index.
35 | 
36 | 
37 | ### How to update the book website
38 | 
39 | The book and its website are automatically updated on a successful
40 | push to the `master` branch.
41 | 
42 | 
43 | ### Acknowledgements
44 | 
45 | Initially created by Altuna Akalin. Some of the material is based on
46 | Martin Siegert's documentation of the Grid Engine cluster.
47 | 


--------------------------------------------------------------------------------
/SUMMARY.md:
--------------------------------------------------------------------------------
 1 | # Summary
 2 | 
 3 | * [Unix for beginners ](unix_for_beginners/README.md)
 4 |    * [Basics](unix_for_beginners/basics.md)
 5 |    * [File management and directories](unix_for_beginners/file_management_and_directories.md)
 6 |    * [Editing, viewing and concatenating text files](unix_for_beginners/editing_and_manipulating_files.md)
 7 |    * [Compressing and decompressing files](unix_for_beginners/compressing_and_decompressing_files.md)
 8 |    * [Connecting to a remote server with SSH](unix_for_beginners/connecting_to_a_remote_server.md)
 9 |    * [Downloading files with wget, curl and ftp](downloading_files_with_wget,_curl_and_ftp/README.md)
10 |    * [Simple shell scripting (bash)](unix_for_beginners/shell_scripting_bash.md)
11 |    * [More on Unix...](unix_for_beginners/more_on_unix.md)
12 | * [Grid Engine for beginners](sun_grid_engine_for_beginners/README.md)
13 |    * [Quickstart and basics](sun_grid_engine_for_beginners/quickstart_and_basics.md)
14 |    * [Resources and queues ](sun_grid_engine_for_beginners/resources_and_queues.md)
15 |    * [How to submit a job using qsub](sun_grid_engine_for_beginners/how_to_submit_a_job_using_qsub.md)
16 |    * [How to use interactive sessions with qrsh](sun_grid_engine_for_beginners/how_to_use_interactive_sessions_with_qrsh.md)
17 |    * [How to run array jobs](sun_grid_engine_for_beginners/how_to_run_array_jobs.md)
18 |    * [Parallel environments](sun_grid_engine_for_beginners/parallel_environments.md)
19 |    * [Monitoring cluster usage and troubleshooting](sun_grid_engine_for_beginners/monitoring_cluster_usage_and_troubleshooting.md)
20 |    * [FAQ](sun_grid_engine_for_beginners/faq.md)
21 | 
22 | 


--------------------------------------------------------------------------------
/bake-index.js:
--------------------------------------------------------------------------------
 1 | var lunr = require('lunr'),
 2 |     stdin = process.stdin,
 3 |     stdout = process.stdout,
 4 |     buffer = [];
 5 | 
 6 | stdin.resume();
 7 | stdin.setEncoding('utf8');
 8 | 
 9 | stdin.on('data', function (data) {
10 |   buffer.push(data);
11 | });
12 | 
13 | stdin.on('end', function () {
14 |   var documents = JSON.parse(buffer.join(''));
15 | 
16 |   var idx = lunr(function () {
17 |     this.ref('url');
18 |     this.field('title');
19 |     this.field('keywords');
20 |     this.field('body');
21 | 
22 |     documents.forEach(function (doc) {
23 |       this.add(doc);
24 |     }, this);
25 |   });
26 | 
27 |   var index = {
28 |     "index": idx,
29 |     "store": {}
30 |   };
31 | 
32 |   documents.forEach(function (doc) {
33 |     index.store[doc.url] = doc;
34 |   });
35 |   stdout.write(JSON.stringify(index));
36 | });
37 | 


--------------------------------------------------------------------------------
/book/gitbook/fonts/fontawesome/fontawesome-webfont.woff:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/BIMSBbioinfo/intro2UnixandSGE/b9fd237b7ebda0b8e678e72fe441708d8fca305a/book/gitbook/fonts/fontawesome/fontawesome-webfont.woff


--------------------------------------------------------------------------------
/book/gitbook/gitbook-plugin-fontsettings/fontsettings.js:
--------------------------------------------------------------------------------
  1 | require(['gitbook', 'jquery'], function(gitbook, $) {
  2 |     // Configuration
  3 |     var MAX_SIZE       = 4,
  4 |         MIN_SIZE       = 0,
  5 |         BUTTON_ID;
  6 | 
  7 |     // Current fontsettings state
  8 |     var fontState;
  9 | 
 10 |     // Default themes
 11 |     var THEMES = [
 12 |         {
 13 |             config: 'white',
 14 |             text: 'White',
 15 |             id: 0
 16 |         },
 17 |         {
 18 |             config: 'sepia',
 19 |             text: 'Sepia',
 20 |             id: 1
 21 |         },
 22 |         {
 23 |             config: 'night',
 24 |             text: 'Night',
 25 |             id: 2
 26 |         }
 27 |     ];
 28 | 
 29 |     // Default font families
 30 |     var FAMILIES = [
 31 |         {
 32 |             config: 'serif',
 33 |             text: 'Serif',
 34 |             id: 0
 35 |         },
 36 |         {
 37 |             config: 'sans',
 38 |             text: 'Sans',
 39 |             id: 1
 40 |         }
 41 |     ];
 42 | 
 43 |     // Return configured themes
 44 |     function getThemes() {
 45 |         return THEMES;
 46 |     }
 47 | 
 48 |     // Modify configured themes
 49 |     function setThemes(themes) {
 50 |         THEMES = themes;
 51 |         updateButtons();
 52 |     }
 53 | 
 54 |     // Return configured font families
 55 |     function getFamilies() {
 56 |         return FAMILIES;
 57 |     }
 58 | 
 59 |     // Modify configured font families
 60 |     function setFamilies(families) {
 61 |         FAMILIES = families;
 62 |         updateButtons();
 63 |     }
 64 | 
 65 |     // Save current font settings
 66 |     function saveFontSettings() {
 67 |         gitbook.storage.set('fontState', fontState);
 68 |         update();
 69 |     }
 70 | 
 71 |     // Increase font size
 72 |     function enlargeFontSize(e) {
 73 |         e.preventDefault();
 74 |         if (fontState.size >= MAX_SIZE) return;
 75 | 
 76 |         fontState.size++;
 77 |         saveFontSettings();
 78 |     }
 79 | 
 80 |     // Decrease font size
 81 |     function reduceFontSize(e) {
 82 |         e.preventDefault();
 83 |         if (fontState.size <= MIN_SIZE) return;
 84 | 
 85 |         fontState.size--;
 86 |         saveFontSettings();
 87 |     }
 88 | 
 89 |     // Change font family
 90 |     function changeFontFamily(configName, e) {
 91 |         if (e && e instanceof Event) {
 92 |             e.preventDefault();
 93 |         }
 94 | 
 95 |         var familyId = getFontFamilyId(configName);
 96 |         fontState.family = familyId;
 97 |         saveFontSettings();
 98 |     }
 99 | 
100 |     // Change type of color theme
101 |     function changeColorTheme(configName, e) {
102 |         if (e && e instanceof Event) {
103 |             e.preventDefault();
104 |         }
105 | 
106 |         var $book = gitbook.state.$book;
107 | 
108 |         // Remove currently applied color theme
109 |         if (fontState.theme !== 0)
110 |             $book.removeClass('color-theme-'+fontState.theme);
111 | 
112 |         // Set new color theme
113 |         var themeId = getThemeId(configName);
114 |         fontState.theme = themeId;
115 |         if (fontState.theme !== 0)
116 |             $book.addClass('color-theme-'+fontState.theme);
117 | 
118 |         saveFontSettings();
119 |     }
120 | 
121 |     // Return the correct id for a font-family config key
122 |     // Default to first font-family
123 |     function getFontFamilyId(configName) {
124 |         // Search for plugin configured font family
125 |         var configFamily = $.grep(FAMILIES, function(family) {
126 |             return family.config == configName;
127 |         })[0];
128 |         // Fallback to default font family
129 |         return (!!configFamily)? configFamily.id : 0;
130 |     }
131 | 
132 |     // Return the correct id for a theme config key
133 |     // Default to first theme
134 |     function getThemeId(configName) {
135 |         // Search for plugin configured theme
136 |         var configTheme = $.grep(THEMES, function(theme) {
137 |             return theme.config == configName;
138 |         })[0];
139 |         // Fallback to default theme
140 |         return (!!configTheme)? configTheme.id : 0;
141 |     }
142 | 
143 |     function update() {
144 |         var $book = gitbook.state.$book;
145 | 
146 |         $('.font-settings .font-family-list li').removeClass('active');
147 |         $('.font-settings .font-family-list li:nth-child('+(fontState.family+1)+')').addClass('active');
148 | 
149 |         $book[0].className = $book[0].className.replace(/\bfont-\S+/g, '');
150 |         $book.addClass('font-size-'+fontState.size);
151 |         $book.addClass('font-family-'+fontState.family);
152 | 
153 |         if(fontState.theme !== 0) {
154 |             $book[0].className = $book[0].className.replace(/\bcolor-theme-\S+/g, '');
155 |             $book.addClass('color-theme-'+fontState.theme);
156 |         }
157 |     }
158 | 
159 |     function init(config) {
160 |         // Search for plugin configured font family
161 |         var configFamily = getFontFamilyId(config.family),
162 |             configTheme = getThemeId(config.theme);
163 | 
164 |         // Instantiate font state object
165 |         fontState = gitbook.storage.get('fontState', {
166 |             size:   config.size || 2,
167 |             family: configFamily,
168 |             theme:  configTheme
169 |         });
170 | 
171 |         update();
172 |     }
173 | 
174 |     function updateButtons() {
175 |         // Remove existing fontsettings buttons
176 |         if (!!BUTTON_ID) {
177 |             gitbook.toolbar.removeButton(BUTTON_ID);
178 |         }
179 | 
180 |         // Create buttons in toolbar
181 |         BUTTON_ID = gitbook.toolbar.createButton({
182 |             icon: 'fa fa-font',
183 |             label: 'Font Settings',
184 |             className: 'font-settings',
185 |             dropdown: [
186 |                 [
187 |                     {
188 |                         text: 'A',
189 |                         className: 'font-reduce',
190 |                         onClick: reduceFontSize
191 |                     },
192 |                     {
193 |                         text: 'A',
194 |                         className: 'font-enlarge',
195 |                         onClick: enlargeFontSize
196 |                     }
197 |                 ],
198 |                 $.map(FAMILIES, function(family) {
199 |                     family.onClick = function(e) {
200 |                         return changeFontFamily(family.config, e);
201 |                     };
202 | 
203 |                     return family;
204 |                 }),
205 |                 $.map(THEMES, function(theme) {
206 |                     theme.onClick = function(e) {
207 |                         return changeColorTheme(theme.config, e);
208 |                     };
209 | 
210 |                     return theme;
211 |                 })
212 |             ]
213 |         });
214 |     }
215 | 
216 |     // Init configuration at start
217 |     gitbook.events.bind('start', function(e, config) {
218 |         var opts = config.fontsettings;
219 | 
220 |         // Generate buttons at start
221 |         updateButtons();
222 | 
223 |         // Init current settings
224 |         init(opts);
225 |     });
226 | 
227 |     // Expose API
228 |     gitbook.fontsettings = {
229 |         enlargeFontSize: enlargeFontSize,
230 |         reduceFontSize:  reduceFontSize,
231 |         setTheme:        changeColorTheme,
232 |         setFamily:       changeFontFamily,
233 |         getThemes:       getThemes,
234 |         setThemes:       setThemes,
235 |         getFamilies:     getFamilies,
236 |         setFamilies:     setFamilies
237 |     };
238 | });
239 | 
240 | 
241 | 


--------------------------------------------------------------------------------
/book/gitbook/gitbook-plugin-lunr/lunr.js:
--------------------------------------------------------------------------------
   1 | /**
   2 |  * lunr - http://lunrjs.com - A bit like Solr, but much smaller and not as bright - 0.5.12
   3 |  * Copyright (C) 2015 Oliver Nightingale
   4 |  * MIT Licensed
   5 |  * @license
   6 |  */
   7 | 
   8 | ;(function(){
   9 | 
  10 | /**
  11 |  * Convenience function for instantiating a new lunr index and configuring it
  12 |  * with the default pipeline functions and the passed config function.
  13 |  *
  14 |  * When using this convenience function a new index will be created with the
  15 |  * following functions already in the pipeline:
  16 |  *
  17 |  * lunr.StopWordFilter - filters out any stop words before they enter the
  18 |  * index
  19 |  *
  20 |  * lunr.stemmer - stems the tokens before entering the index.
  21 |  *
  22 |  * Example:
  23 |  *
  24 |  *     var idx = lunr(function () {
  25 |  *       this.field('title', 10)
  26 |  *       this.field('tags', 100)
  27 |  *       this.field('body')
  28 |  *       
  29 |  *       this.ref('cid')
  30 |  *       
  31 |  *       this.pipeline.add(function () {
  32 |  *         // some custom pipeline function
  33 |  *       })
  34 |  *       
  35 |  *     })
  36 |  *
  37 |  * @param {Function} config A function that will be called with the new instance
  38 |  * of the lunr.Index as both its context and first parameter. It can be used to
  39 |  * customize the instance of new lunr.Index.
  40 |  * @namespace
  41 |  * @module
  42 |  * @returns {lunr.Index}
  43 |  *
  44 |  */
  45 | var lunr = function (config) {
  46 |   var idx = new lunr.Index
  47 | 
  48 |   idx.pipeline.add(
  49 |     lunr.trimmer,
  50 |     lunr.stopWordFilter,
  51 |     lunr.stemmer
  52 |   )
  53 | 
  54 |   if (config) config.call(idx, idx)
  55 | 
  56 |   return idx
  57 | }
  58 | 
  59 | lunr.version = "0.5.12"
  60 | /*!
  61 |  * lunr.utils
  62 |  * Copyright (C) 2015 Oliver Nightingale
  63 |  */
  64 | 
  65 | /**
  66 |  * A namespace containing utils for the rest of the lunr library
  67 |  */
  68 | lunr.utils = {}
  69 | 
  70 | /**
  71 |  * Print a warning message to the console.
  72 |  *
  73 |  * @param {String} message The message to be printed.
  74 |  * @memberOf Utils
  75 |  */
  76 | lunr.utils.warn = (function (global) {
  77 |   return function (message) {
  78 |     if (global.console && console.warn) {
  79 |       console.warn(message)
  80 |     }
  81 |   }
  82 | })(this)
  83 | 
  84 | /*!
  85 |  * lunr.EventEmitter
  86 |  * Copyright (C) 2015 Oliver Nightingale
  87 |  */
  88 | 
  89 | /**
  90 |  * lunr.EventEmitter is an event emitter for lunr. It manages adding and removing event handlers and triggering events and their handlers.
  91 |  *
  92 |  * @constructor
  93 |  */
  94 | lunr.EventEmitter = function () {
  95 |   this.events = {}
  96 | }
  97 | 
  98 | /**
  99 |  * Binds a handler function to a specific event(s).
 100 |  *
 101 |  * Can bind a single function to many different events in one call.
 102 |  *
 103 |  * @param {String} [eventName] The name(s) of events to bind this function to.
 104 |  * @param {Function} fn The function to call when an event is fired.
 105 |  * @memberOf EventEmitter
 106 |  */
 107 | lunr.EventEmitter.prototype.addListener = function () {
 108 |   var args = Array.prototype.slice.call(arguments),
 109 |       fn = args.pop(),
 110 |       names = args
 111 | 
 112 |   if (typeof fn !== "function") throw new TypeError ("last argument must be a function")
 113 | 
 114 |   names.forEach(function (name) {
 115 |     if (!this.hasHandler(name)) this.events[name] = []
 116 |     this.events[name].push(fn)
 117 |   }, this)
 118 | }
 119 | 
 120 | /**
 121 |  * Removes a handler function from a specific event.
 122 |  *
 123 |  * @param {String} eventName The name of the event to remove this function from.
 124 |  * @param {Function} fn The function to remove from an event.
 125 |  * @memberOf EventEmitter
 126 |  */
 127 | lunr.EventEmitter.prototype.removeListener = function (name, fn) {
 128 |   if (!this.hasHandler(name)) return
 129 | 
 130 |   var fnIndex = this.events[name].indexOf(fn)
 131 |   this.events[name].splice(fnIndex, 1)
 132 | 
 133 |   if (!this.events[name].length) delete this.events[name]
 134 | }
 135 | 
 136 | /**
 137 |  * Calls all functions bound to the given event.
 138 |  *
 139 |  * Additional data can be passed to the event handler as arguments to `emit`
 140 |  * after the event name.
 141 |  *
 142 |  * @param {String} eventName The name of the event to emit.
 143 |  * @memberOf EventEmitter
 144 |  */
 145 | lunr.EventEmitter.prototype.emit = function (name) {
 146 |   if (!this.hasHandler(name)) return
 147 | 
 148 |   var args = Array.prototype.slice.call(arguments, 1)
 149 | 
 150 |   this.events[name].forEach(function (fn) {
 151 |     fn.apply(undefined, args)
 152 |   })
 153 | }
 154 | 
 155 | /**
 156 |  * Checks whether a handler has ever been stored against an event.
 157 |  *
 158 |  * @param {String} eventName The name of the event to check.
 159 |  * @private
 160 |  * @memberOf EventEmitter
 161 |  */
 162 | lunr.EventEmitter.prototype.hasHandler = function (name) {
 163 |   return name in this.events
 164 | }
 165 | 
 166 | /*!
 167 |  * lunr.tokenizer
 168 |  * Copyright (C) 2015 Oliver Nightingale
 169 |  */
 170 | 
 171 | /**
 172 |  * A function for splitting a string into tokens ready to be inserted into
 173 |  * the search index.
 174 |  *
 175 |  * @module
 176 |  * @param {String} obj The string to convert into tokens
 177 |  * @returns {Array}
 178 |  */
 179 | lunr.tokenizer = function (obj) {
 180 |   if (!arguments.length || obj == null || obj == undefined) return []
 181 |   if (Array.isArray(obj)) return obj.map(function (t) { return t.toLowerCase() })
 182 | 
 183 |   return obj.toString().trim().toLowerCase().split(/[\s\-]+/)
 184 | }
 185 | 
 186 | /*!
 187 |  * lunr.Pipeline
 188 |  * Copyright (C) 2015 Oliver Nightingale
 189 |  */
 190 | 
 191 | /**
 192 |  * lunr.Pipelines maintain an ordered list of functions to be applied to all
 193 |  * tokens in documents entering the search index and queries being ran against
 194 |  * the index.
 195 |  *
 196 |  * An instance of lunr.Index created with the lunr shortcut will contain a
 197 |  * pipeline with a stop word filter and an English language stemmer. Extra
 198 |  * functions can be added before or after either of these functions or these
 199 |  * default functions can be removed.
 200 |  *
 201 |  * When run the pipeline will call each function in turn, passing a token, the
 202 |  * index of that token in the original list of all tokens and finally a list of
 203 |  * all the original tokens.
 204 |  *
 205 |  * The output of functions in the pipeline will be passed to the next function
 206 |  * in the pipeline. To exclude a token from entering the index the function
 207 |  * should return undefined, the rest of the pipeline will not be called with
 208 |  * this token.
 209 |  *
 210 |  * For serialisation of pipelines to work, all functions used in an instance of
 211 |  * a pipeline should be registered with lunr.Pipeline. Registered functions can
 212 |  * then be loaded. If trying to load a serialised pipeline that uses functions
 213 |  * that are not registered an error will be thrown.
 214 |  *
 215 |  * If not planning on serialising the pipeline then registering pipeline functions
 216 |  * is not necessary.
 217 |  *
 218 |  * @constructor
 219 |  */
 220 | lunr.Pipeline = function () {
 221 |   this._stack = []
 222 | }
 223 | 
 224 | lunr.Pipeline.registeredFunctions = {}
 225 | 
 226 | /**
 227 |  * Register a function with the pipeline.
 228 |  *
 229 |  * Functions that are used in the pipeline should be registered if the pipeline
 230 |  * needs to be serialised, or a serialised pipeline needs to be loaded.
 231 |  *
 232 |  * Registering a function does not add it to a pipeline, functions must still be
 233 |  * added to instances of the pipeline for them to be used when running a pipeline.
 234 |  *
 235 |  * @param {Function} fn The function to check for.
 236 |  * @param {String} label The label to register this function with
 237 |  * @memberOf Pipeline
 238 |  */
 239 | lunr.Pipeline.registerFunction = function (fn, label) {
 240 |   if (label in this.registeredFunctions) {
 241 |     lunr.utils.warn('Overwriting existing registered function: ' + label)
 242 |   }
 243 | 
 244 |   fn.label = label
 245 |   lunr.Pipeline.registeredFunctions[fn.label] = fn
 246 | }
 247 | 
 248 | /**
 249 |  * Warns if the function is not registered as a Pipeline function.
 250 |  *
 251 |  * @param {Function} fn The function to check for.
 252 |  * @private
 253 |  * @memberOf Pipeline
 254 |  */
 255 | lunr.Pipeline.warnIfFunctionNotRegistered = function (fn) {
 256 |   var isRegistered = fn.label && (fn.label in this.registeredFunctions)
 257 | 
 258 |   if (!isRegistered) {
 259 |     lunr.utils.warn('Function is not registered with pipeline. This may cause problems when serialising the index.\n', fn)
 260 |   }
 261 | }
 262 | 
 263 | /**
 264 |  * Loads a previously serialised pipeline.
 265 |  *
 266 |  * All functions to be loaded must already be registered with lunr.Pipeline.
 267 |  * If any function from the serialised data has not been registered then an
 268 |  * error will be thrown.
 269 |  *
 270 |  * @param {Object} serialised The serialised pipeline to load.
 271 |  * @returns {lunr.Pipeline}
 272 |  * @memberOf Pipeline
 273 |  */
 274 | lunr.Pipeline.load = function (serialised) {
 275 |   var pipeline = new lunr.Pipeline
 276 | 
 277 |   serialised.forEach(function (fnName) {
 278 |     var fn = lunr.Pipeline.registeredFunctions[fnName]
 279 | 
 280 |     if (fn) {
 281 |       pipeline.add(fn)
 282 |     } else {
 283 |       throw new Error('Cannot load un-registered function: ' + fnName)
 284 |     }
 285 |   })
 286 | 
 287 |   return pipeline
 288 | }
 289 | 
 290 | /**
 291 |  * Adds new functions to the end of the pipeline.
 292 |  *
 293 |  * Logs a warning if the function has not been registered.
 294 |  *
 295 |  * @param {Function} functions Any number of functions to add to the pipeline.
 296 |  * @memberOf Pipeline
 297 |  */
 298 | lunr.Pipeline.prototype.add = function () {
 299 |   var fns = Array.prototype.slice.call(arguments)
 300 | 
 301 |   fns.forEach(function (fn) {
 302 |     lunr.Pipeline.warnIfFunctionNotRegistered(fn)
 303 |     this._stack.push(fn)
 304 |   }, this)
 305 | }
 306 | 
 307 | /**
 308 |  * Adds a single function after a function that already exists in the
 309 |  * pipeline.
 310 |  *
 311 |  * Logs a warning if the function has not been registered.
 312 |  *
 313 |  * @param {Function} existingFn A function that already exists in the pipeline.
 314 |  * @param {Function} newFn The new function to add to the pipeline.
 315 |  * @memberOf Pipeline
 316 |  */
 317 | lunr.Pipeline.prototype.after = function (existingFn, newFn) {
 318 |   lunr.Pipeline.warnIfFunctionNotRegistered(newFn)
 319 | 
 320 |   var pos = this._stack.indexOf(existingFn)
 321 |   if (pos == -1) {
 322 |     throw new Error('Cannot find existingFn')
 323 |   }
 324 | 
 325 |   pos = pos + 1
 326 |   this._stack.splice(pos, 0, newFn)
 327 | }
 328 | 
 329 | /**
 330 |  * Adds a single function before a function that already exists in the
 331 |  * pipeline.
 332 |  *
 333 |  * Logs a warning if the function has not been registered.
 334 |  *
 335 |  * @param {Function} existingFn A function that already exists in the pipeline.
 336 |  * @param {Function} newFn The new function to add to the pipeline.
 337 |  * @memberOf Pipeline
 338 |  */
 339 | lunr.Pipeline.prototype.before = function (existingFn, newFn) {
 340 |   lunr.Pipeline.warnIfFunctionNotRegistered(newFn)
 341 | 
 342 |   var pos = this._stack.indexOf(existingFn)
 343 |   if (pos == -1) {
 344 |     throw new Error('Cannot find existingFn')
 345 |   }
 346 | 
 347 |   this._stack.splice(pos, 0, newFn)
 348 | }
 349 | 
 350 | /**
 351 |  * Removes a function from the pipeline.
 352 |  *
 353 |  * @param {Function} fn The function to remove from the pipeline.
 354 |  * @memberOf Pipeline
 355 |  */
 356 | lunr.Pipeline.prototype.remove = function (fn) {
 357 |   var pos = this._stack.indexOf(fn)
 358 |   if (pos == -1) {
 359 |     return
 360 |   }
 361 | 
 362 |   this._stack.splice(pos, 1)
 363 | }
 364 | 
 365 | /**
 366 |  * Runs the current list of functions that make up the pipeline against the
 367 |  * passed tokens.
 368 |  *
 369 |  * @param {Array} tokens The tokens to run through the pipeline.
 370 |  * @returns {Array}
 371 |  * @memberOf Pipeline
 372 |  */
 373 | lunr.Pipeline.prototype.run = function (tokens) {
 374 |   var out = [],
 375 |       tokenLength = tokens.length,
 376 |       stackLength = this._stack.length
 377 | 
 378 |   for (var i = 0; i < tokenLength; i++) {
 379 |     var token = tokens[i]
 380 | 
 381 |     for (var j = 0; j < stackLength; j++) {
 382 |       token = this._stack[j](token, i, tokens)
 383 |       if (token === void 0) break
 384 |     };
 385 | 
 386 |     if (token !== void 0) out.push(token)
 387 |   };
 388 | 
 389 |   return out
 390 | }
 391 | 
 392 | /**
 393 |  * Resets the pipeline by removing any existing processors.
 394 |  *
 395 |  * @memberOf Pipeline
 396 |  */
 397 | lunr.Pipeline.prototype.reset = function () {
 398 |   this._stack = []
 399 | }
 400 | 
 401 | /**
 402 |  * Returns a representation of the pipeline ready for serialisation.
 403 |  *
 404 |  * Logs a warning if the function has not been registered.
 405 |  *
 406 |  * @returns {Array}
 407 |  * @memberOf Pipeline
 408 |  */
 409 | lunr.Pipeline.prototype.toJSON = function () {
 410 |   return this._stack.map(function (fn) {
 411 |     lunr.Pipeline.warnIfFunctionNotRegistered(fn)
 412 | 
 413 |     return fn.label
 414 |   })
 415 | }
 416 | /*!
 417 |  * lunr.Vector
 418 |  * Copyright (C) 2015 Oliver Nightingale
 419 |  */
 420 | 
 421 | /**
 422 |  * lunr.Vectors implement vector related operations for
 423 |  * a series of elements.
 424 |  *
 425 |  * @constructor
 426 |  */
 427 | lunr.Vector = function () {
 428 |   this._magnitude = null
 429 |   this.list = undefined
 430 |   this.length = 0
 431 | }
 432 | 
 433 | /**
 434 |  * lunr.Vector.Node is a simple struct for each node
 435 |  * in a lunr.Vector.
 436 |  *
 437 |  * @private
 438 |  * @param {Number} The index of the node in the vector.
 439 |  * @param {Object} The data at this node in the vector.
 440 |  * @param {lunr.Vector.Node} The node directly after this node in the vector.
 441 |  * @constructor
 442 |  * @memberOf Vector
 443 |  */
 444 | lunr.Vector.Node = function (idx, val, next) {
 445 |   this.idx = idx
 446 |   this.val = val
 447 |   this.next = next
 448 | }
 449 | 
 450 | /**
 451 |  * Inserts a new value at a position in a vector.
 452 |  *
 453 |  * @param {Number} The index at which to insert a value.
 454 |  * @param {Object} The object to insert in the vector.
 455 |  * @memberOf Vector.
 456 |  */
 457 | lunr.Vector.prototype.insert = function (idx, val) {
 458 |   this._magnitude = undefined;
 459 |   var list = this.list
 460 | 
 461 |   if (!list) {
 462 |     this.list = new lunr.Vector.Node (idx, val, list)
 463 |     return this.length++
 464 |   }
 465 | 
 466 |   if (idx < list.idx) {
 467 |     this.list = new lunr.Vector.Node (idx, val, list)
 468 |     return this.length++
 469 |   }
 470 | 
 471 |   var prev = list,
 472 |       next = list.next
 473 | 
 474 |   while (next != undefined) {
 475 |     if (idx < next.idx) {
 476 |       prev.next = new lunr.Vector.Node (idx, val, next)
 477 |       return this.length++
 478 |     }
 479 | 
 480 |     prev = next, next = next.next
 481 |   }
 482 | 
 483 |   prev.next = new lunr.Vector.Node (idx, val, next)
 484 |   return this.length++
 485 | }
 486 | 
 487 | /**
 488 |  * Calculates the magnitude of this vector.
 489 |  *
 490 |  * @returns {Number}
 491 |  * @memberOf Vector
 492 |  */
 493 | lunr.Vector.prototype.magnitude = function () {
 494 |   if (this._magnitude) return this._magnitude
 495 |   var node = this.list,
 496 |       sumOfSquares = 0,
 497 |       val
 498 | 
 499 |   while (node) {
 500 |     val = node.val
 501 |     sumOfSquares += val * val
 502 |     node = node.next
 503 |   }
 504 | 
 505 |   return this._magnitude = Math.sqrt(sumOfSquares)
 506 | }
 507 | 
 508 | /**
 509 |  * Calculates the dot product of this vector and another vector.
 510 |  *
 511 |  * @param {lunr.Vector} otherVector The vector to compute the dot product with.
 512 |  * @returns {Number}
 513 |  * @memberOf Vector
 514 |  */
 515 | lunr.Vector.prototype.dot = function (otherVector) {
 516 |   var node = this.list,
 517 |       otherNode = otherVector.list,
 518 |       dotProduct = 0
 519 | 
 520 |   while (node && otherNode) {
 521 |     if (node.idx < otherNode.idx) {
 522 |       node = node.next
 523 |     } else if (node.idx > otherNode.idx) {
 524 |       otherNode = otherNode.next
 525 |     } else {
 526 |       dotProduct += node.val * otherNode.val
 527 |       node = node.next
 528 |       otherNode = otherNode.next
 529 |     }
 530 |   }
 531 | 
 532 |   return dotProduct
 533 | }
 534 | 
 535 | /**
 536 |  * Calculates the cosine similarity between this vector and another
 537 |  * vector.
 538 |  *
 539 |  * @param {lunr.Vector} otherVector The other vector to calculate the
 540 |  * similarity with.
 541 |  * @returns {Number}
 542 |  * @memberOf Vector
 543 |  */
 544 | lunr.Vector.prototype.similarity = function (otherVector) {
 545 |   return this.dot(otherVector) / (this.magnitude() * otherVector.magnitude())
 546 | }
 547 | /*!
 548 |  * lunr.SortedSet
 549 |  * Copyright (C) 2015 Oliver Nightingale
 550 |  */
 551 | 
 552 | /**
 553 |  * lunr.SortedSets are used to maintain an array of uniq values in a sorted
 554 |  * order.
 555 |  *
 556 |  * @constructor
 557 |  */
 558 | lunr.SortedSet = function () {
 559 |   this.length = 0
 560 |   this.elements = []
 561 | }
 562 | 
 563 | /**
 564 |  * Loads a previously serialised sorted set.
 565 |  *
 566 |  * @param {Array} serialisedData The serialised set to load.
 567 |  * @returns {lunr.SortedSet}
 568 |  * @memberOf SortedSet
 569 |  */
 570 | lunr.SortedSet.load = function (serialisedData) {
 571 |   var set = new this
 572 | 
 573 |   set.elements = serialisedData
 574 |   set.length = serialisedData.length
 575 | 
 576 |   return set
 577 | }
 578 | 
 579 | /**
 580 |  * Inserts new items into the set in the correct position to maintain the
 581 |  * order.
 582 |  *
 583 |  * @param {Object} The objects to add to this set.
 584 |  * @memberOf SortedSet
 585 |  */
 586 | lunr.SortedSet.prototype.add = function () {
 587 |   var i, element
 588 | 
 589 |   for (i = 0; i < arguments.length; i++) {
 590 |     element = arguments[i]
 591 |     if (~this.indexOf(element)) continue
 592 |     this.elements.splice(this.locationFor(element), 0, element)
 593 |   }
 594 | 
 595 |   this.length = this.elements.length
 596 | }
 597 | 
 598 | /**
 599 |  * Converts this sorted set into an array.
 600 |  *
 601 |  * @returns {Array}
 602 |  * @memberOf SortedSet
 603 |  */
 604 | lunr.SortedSet.prototype.toArray = function () {
 605 |   return this.elements.slice()
 606 | }
 607 | 
 608 | /**
 609 |  * Creates a new array with the results of calling a provided function on every
 610 |  * element in this sorted set.
 611 |  *
 612 |  * Delegates to Array.prototype.map and has the same signature.
 613 |  *
 614 |  * @param {Function} fn The function that is called on each element of the
 615 |  * set.
 616 |  * @param {Object} ctx An optional object that can be used as the context
 617 |  * for the function fn.
 618 |  * @returns {Array}
 619 |  * @memberOf SortedSet
 620 |  */
 621 | lunr.SortedSet.prototype.map = function (fn, ctx) {
 622 |   return this.elements.map(fn, ctx)
 623 | }
 624 | 
 625 | /**
 626 |  * Executes a provided function once per sorted set element.
 627 |  *
 628 |  * Delegates to Array.prototype.forEach and has the same signature.
 629 |  *
 630 |  * @param {Function} fn The function that is called on each element of the
 631 |  * set.
 632 |  * @param {Object} ctx An optional object that can be used as the context
 633 |  * @memberOf SortedSet
 634 |  * for the function fn.
 635 |  */
 636 | lunr.SortedSet.prototype.forEach = function (fn, ctx) {
 637 |   return this.elements.forEach(fn, ctx)
 638 | }
 639 | 
 640 | /**
 641 |  * Returns the index at which a given element can be found in the
 642 |  * sorted set, or -1 if it is not present.
 643 |  *
 644 |  * @param {Object} elem The object to locate in the sorted set.
 645 |  * @returns {Number}
 646 |  * @memberOf SortedSet
 647 |  */
 648 | lunr.SortedSet.prototype.indexOf = function (elem) {
 649 |   var start = 0,
 650 |       end = this.elements.length,
 651 |       sectionLength = end - start,
 652 |       pivot = start + Math.floor(sectionLength / 2),
 653 |       pivotElem = this.elements[pivot]
 654 | 
 655 |   while (sectionLength > 1) {
 656 |     if (pivotElem === elem) return pivot
 657 | 
 658 |     if (pivotElem < elem) start = pivot
 659 |     if (pivotElem > elem) end = pivot
 660 | 
 661 |     sectionLength = end - start
 662 |     pivot = start + Math.floor(sectionLength / 2)
 663 |     pivotElem = this.elements[pivot]
 664 |   }
 665 | 
 666 |   if (pivotElem === elem) return pivot
 667 | 
 668 |   return -1
 669 | }
 670 | 
 671 | /**
 672 |  * Returns the position within the sorted set that an element should be
 673 |  * inserted at to maintain the current order of the set.
 674 |  *
 675 |  * This function assumes that the element to search for does not already exist
 676 |  * in the sorted set.
 677 |  *
 678 |  * @param {Object} elem The elem to find the position for in the set
 679 |  * @returns {Number}
 680 |  * @memberOf SortedSet
 681 |  */
 682 | lunr.SortedSet.prototype.locationFor = function (elem) {
 683 |   var start = 0,
 684 |       end = this.elements.length,
 685 |       sectionLength = end - start,
 686 |       pivot = start + Math.floor(sectionLength / 2),
 687 |       pivotElem = this.elements[pivot]
 688 | 
 689 |   while (sectionLength > 1) {
 690 |     if (pivotElem < elem) start = pivot
 691 |     if (pivotElem > elem) end = pivot
 692 | 
 693 |     sectionLength = end - start
 694 |     pivot = start + Math.floor(sectionLength / 2)
 695 |     pivotElem = this.elements[pivot]
 696 |   }
 697 | 
 698 |   if (pivotElem > elem) return pivot
 699 |   if (pivotElem < elem) return pivot + 1
 700 | }
 701 | 
 702 | /**
 703 |  * Creates a new lunr.SortedSet that contains the elements in the intersection
 704 |  * of this set and the passed set.
 705 |  *
 706 |  * @param {lunr.SortedSet} otherSet The set to intersect with this set.
 707 |  * @returns {lunr.SortedSet}
 708 |  * @memberOf SortedSet
 709 |  */
 710 | lunr.SortedSet.prototype.intersect = function (otherSet) {
 711 |   var intersectSet = new lunr.SortedSet,
 712 |       i = 0, j = 0,
 713 |       a_len = this.length, b_len = otherSet.length,
 714 |       a = this.elements, b = otherSet.elements
 715 | 
 716 |   while (true) {
 717 |     if (i > a_len - 1 || j > b_len - 1) break
 718 | 
 719 |     if (a[i] === b[j]) {
 720 |       intersectSet.add(a[i])
 721 |       i++, j++
 722 |       continue
 723 |     }
 724 | 
 725 |     if (a[i] < b[j]) {
 726 |       i++
 727 |       continue
 728 |     }
 729 | 
 730 |     if (a[i] > b[j]) {
 731 |       j++
 732 |       continue
 733 |     }
 734 |   };
 735 | 
 736 |   return intersectSet
 737 | }
 738 | 
 739 | /**
 740 |  * Makes a copy of this set
 741 |  *
 742 |  * @returns {lunr.SortedSet}
 743 |  * @memberOf SortedSet
 744 |  */
 745 | lunr.SortedSet.prototype.clone = function () {
 746 |   var clone = new lunr.SortedSet
 747 | 
 748 |   clone.elements = this.toArray()
 749 |   clone.length = clone.elements.length
 750 | 
 751 |   return clone
 752 | }
 753 | 
 754 | /**
 755 |  * Creates a new lunr.SortedSet that contains the elements in the union
 756 |  * of this set and the passed set.
 757 |  *
 758 |  * @param {lunr.SortedSet} otherSet The set to union with this set.
 759 |  * @returns {lunr.SortedSet}
 760 |  * @memberOf SortedSet
 761 |  */
 762 | lunr.SortedSet.prototype.union = function (otherSet) {
 763 |   var longSet, shortSet, unionSet
 764 | 
 765 |   if (this.length >= otherSet.length) {
 766 |     longSet = this, shortSet = otherSet
 767 |   } else {
 768 |     longSet = otherSet, shortSet = this
 769 |   }
 770 | 
 771 |   unionSet = longSet.clone()
 772 | 
 773 |   unionSet.add.apply(unionSet, shortSet.toArray())
 774 | 
 775 |   return unionSet
 776 | }
 777 | 
 778 | /**
 779 |  * Returns a representation of the sorted set ready for serialisation.
 780 |  *
 781 |  * @returns {Array}
 782 |  * @memberOf SortedSet
 783 |  */
 784 | lunr.SortedSet.prototype.toJSON = function () {
 785 |   return this.toArray()
 786 | }
 787 | /*!
 788 |  * lunr.Index
 789 |  * Copyright (C) 2015 Oliver Nightingale
 790 |  */
 791 | 
 792 | /**
 793 |  * lunr.Index is object that manages a search index.  It contains the indexes
 794 |  * and stores all the tokens and document lookups.  It also provides the main
 795 |  * user facing API for the library.
 796 |  *
 797 |  * @constructor
 798 |  */
 799 | lunr.Index = function () {
 800 |   this._fields = []
 801 |   this._ref = 'id'
 802 |   this.pipeline = new lunr.Pipeline
 803 |   this.documentStore = new lunr.Store
 804 |   this.tokenStore = new lunr.TokenStore
 805 |   this.corpusTokens = new lunr.SortedSet
 806 |   this.eventEmitter =  new lunr.EventEmitter
 807 | 
 808 |   this._idfCache = {}
 809 | 
 810 |   this.on('add', 'remove', 'update', (function () {
 811 |     this._idfCache = {}
 812 |   }).bind(this))
 813 | }
 814 | 
 815 | /**
 816 |  * Bind a handler to events being emitted by the index.
 817 |  *
 818 |  * The handler can be bound to many events at the same time.
 819 |  *
 820 |  * @param {String} [eventName] The name(s) of events to bind the function to.
 821 |  * @param {Function} fn The serialised set to load.
 822 |  * @memberOf Index
 823 |  */
 824 | lunr.Index.prototype.on = function () {
 825 |   var args = Array.prototype.slice.call(arguments)
 826 |   return this.eventEmitter.addListener.apply(this.eventEmitter, args)
 827 | }
 828 | 
 829 | /**
 830 |  * Removes a handler from an event being emitted by the index.
 831 |  *
 832 |  * @param {String} eventName The name of events to remove the function from.
 833 |  * @param {Function} fn The serialised set to load.
 834 |  * @memberOf Index
 835 |  */
 836 | lunr.Index.prototype.off = function (name, fn) {
 837 |   return this.eventEmitter.removeListener(name, fn)
 838 | }
 839 | 
 840 | /**
 841 |  * Loads a previously serialised index.
 842 |  *
 843 |  * Issues a warning if the index being imported was serialised
 844 |  * by a different version of lunr.
 845 |  *
 846 |  * @param {Object} serialisedData The serialised set to load.
 847 |  * @returns {lunr.Index}
 848 |  * @memberOf Index
 849 |  */
 850 | lunr.Index.load = function (serialisedData) {
 851 |   if (serialisedData.version !== lunr.version) {
 852 |     lunr.utils.warn('version mismatch: current ' + lunr.version + ' importing ' + serialisedData.version)
 853 |   }
 854 | 
 855 |   var idx = new this
 856 | 
 857 |   idx._fields = serialisedData.fields
 858 |   idx._ref = serialisedData.ref
 859 | 
 860 |   idx.documentStore = lunr.Store.load(serialisedData.documentStore)
 861 |   idx.tokenStore = lunr.TokenStore.load(serialisedData.tokenStore)
 862 |   idx.corpusTokens = lunr.SortedSet.load(serialisedData.corpusTokens)
 863 |   idx.pipeline = lunr.Pipeline.load(serialisedData.pipeline)
 864 | 
 865 |   return idx
 866 | }
 867 | 
 868 | /**
 869 |  * Adds a field to the list of fields that will be searchable within documents
 870 |  * in the index.
 871 |  *
 872 |  * An optional boost param can be passed to affect how much tokens in this field
 873 |  * rank in search results, by default the boost value is 1.
 874 |  *
 875 |  * Fields should be added before any documents are added to the index, fields
 876 |  * that are added after documents are added to the index will only apply to new
 877 |  * documents added to the index.
 878 |  *
 879 |  * @param {String} fieldName The name of the field within the document that
 880 |  * should be indexed
 881 |  * @param {Number} boost An optional boost that can be applied to terms in this
 882 |  * field.
 883 |  * @returns {lunr.Index}
 884 |  * @memberOf Index
 885 |  */
 886 | lunr.Index.prototype.field = function (fieldName, opts) {
 887 |   var opts = opts || {},
 888 |       field = { name: fieldName, boost: opts.boost || 1 }
 889 | 
 890 |   this._fields.push(field)
 891 |   return this
 892 | }
 893 | 
 894 | /**
 895 |  * Sets the property used to uniquely identify documents added to the index,
 896 |  * by default this property is 'id'.
 897 |  *
 898 |  * This should only be changed before adding documents to the index, changing
 899 |  * the ref property without resetting the index can lead to unexpected results.
 900 |  *
 901 |  * @param {String} refName The property to use to uniquely identify the
 902 |  * documents in the index.
 903 |  * @param {Boolean} emitEvent Whether to emit add events, defaults to true
 904 |  * @returns {lunr.Index}
 905 |  * @memberOf Index
 906 |  */
 907 | lunr.Index.prototype.ref = function (refName) {
 908 |   this._ref = refName
 909 |   return this
 910 | }
 911 | 
 912 | /**
 913 |  * Add a document to the index.
 914 |  *
 915 |  * This is the way new documents enter the index, this function will run the
 916 |  * fields from the document through the index's pipeline and then add it to
 917 |  * the index, it will then show up in search results.
 918 |  *
 919 |  * An 'add' event is emitted with the document that has been added and the index
 920 |  * the document has been added to. This event can be silenced by passing false
 921 |  * as the second argument to add.
 922 |  *
 923 |  * @param {Object} doc The document to add to the index.
 924 |  * @param {Boolean} emitEvent Whether or not to emit events, default true.
 925 |  * @memberOf Index
 926 |  */
 927 | lunr.Index.prototype.add = function (doc, emitEvent) {
 928 |   var docTokens = {},
 929 |       allDocumentTokens = new lunr.SortedSet,
 930 |       docRef = doc[this._ref],
 931 |       emitEvent = emitEvent === undefined ? true : emitEvent
 932 | 
 933 |   this._fields.forEach(function (field) {
 934 |     var fieldTokens = this.pipeline.run(lunr.tokenizer(doc[field.name]))
 935 | 
 936 |     docTokens[field.name] = fieldTokens
 937 |     lunr.SortedSet.prototype.add.apply(allDocumentTokens, fieldTokens)
 938 |   }, this)
 939 | 
 940 |   this.documentStore.set(docRef, allDocumentTokens)
 941 |   lunr.SortedSet.prototype.add.apply(this.corpusTokens, allDocumentTokens.toArray())
 942 | 
 943 |   for (var i = 0; i < allDocumentTokens.length; i++) {
 944 |     var token = allDocumentTokens.elements[i]
 945 |     var tf = this._fields.reduce(function (memo, field) {
 946 |       var fieldLength = docTokens[field.name].length
 947 | 
 948 |       if (!fieldLength) return memo
 949 | 
 950 |       var tokenCount = docTokens[field.name].filter(function (t) { return t === token }).length
 951 | 
 952 |       return memo + (tokenCount / fieldLength * field.boost)
 953 |     }, 0)
 954 | 
 955 |     this.tokenStore.add(token, { ref: docRef, tf: tf })
 956 |   };
 957 | 
 958 |   if (emitEvent) this.eventEmitter.emit('add', doc, this)
 959 | }
 960 | 
 961 | /**
 962 |  * Removes a document from the index.
 963 |  *
 964 |  * To make sure documents no longer show up in search results they can be
 965 |  * removed from the index using this method.
 966 |  *
 967 |  * The document passed only needs to have the same ref property value as the
 968 |  * document that was added to the index, they could be completely different
 969 |  * objects.
 970 |  *
 971 |  * A 'remove' event is emitted with the document that has been removed and the index
 972 |  * the document has been removed from. This event can be silenced by passing false
 973 |  * as the second argument to remove.
 974 |  *
 975 |  * @param {Object} doc The document to remove from the index.
 976 |  * @param {Boolean} emitEvent Whether to emit remove events, defaults to true
 977 |  * @memberOf Index
 978 |  */
 979 | lunr.Index.prototype.remove = function (doc, emitEvent) {
 980 |   var docRef = doc[this._ref],
 981 |       emitEvent = emitEvent === undefined ? true : emitEvent
 982 | 
 983 |   if (!this.documentStore.has(docRef)) return
 984 | 
 985 |   var docTokens = this.documentStore.get(docRef)
 986 | 
 987 |   this.documentStore.remove(docRef)
 988 | 
 989 |   docTokens.forEach(function (token) {
 990 |     this.tokenStore.remove(token, docRef)
 991 |   }, this)
 992 | 
 993 |   if (emitEvent) this.eventEmitter.emit('remove', doc, this)
 994 | }
 995 | 
 996 | /**
 997 |  * Updates a document in the index.
 998 |  *
 999 |  * When a document contained within the index gets updated, fields changed,
1000 |  * added or removed, to make sure it correctly matched against search queries,
1001 |  * it should be updated in the index.
1002 |  *
1003 |  * This method is just a wrapper around `remove` and `add`
1004 |  *
1005 |  * An 'update' event is emitted with the document that has been updated and the index.
1006 |  * This event can be silenced by passing false as the second argument to update. Only
1007 |  * an update event will be fired, the 'add' and 'remove' events of the underlying calls
1008 |  * are silenced.
1009 |  *
1010 |  * @param {Object} doc The document to update in the index.
1011 |  * @param {Boolean} emitEvent Whether to emit update events, defaults to true
1012 |  * @see Index.prototype.remove
1013 |  * @see Index.prototype.add
1014 |  * @memberOf Index
1015 |  */
1016 | lunr.Index.prototype.update = function (doc, emitEvent) {
1017 |   var emitEvent = emitEvent === undefined ? true : emitEvent
1018 | 
1019 |   this.remove(doc, false)
1020 |   this.add(doc, false)
1021 | 
1022 |   if (emitEvent) this.eventEmitter.emit('update', doc, this)
1023 | }
1024 | 
1025 | /**
1026 |  * Calculates the inverse document frequency for a token within the index.
1027 |  *
1028 |  * @param {String} token The token to calculate the idf of.
1029 |  * @see Index.prototype.idf
1030 |  * @private
1031 |  * @memberOf Index
1032 |  */
1033 | lunr.Index.prototype.idf = function (term) {
1034 |   var cacheKey = "@" + term
1035 |   if (Object.prototype.hasOwnProperty.call(this._idfCache, cacheKey)) return this._idfCache[cacheKey]
1036 | 
1037 |   var documentFrequency = this.tokenStore.count(term),
1038 |       idf = 1
1039 | 
1040 |   if (documentFrequency > 0) {
1041 |     idf = 1 + Math.log(this.documentStore.length / documentFrequency)
1042 |   }
1043 | 
1044 |   return this._idfCache[cacheKey] = idf
1045 | }
1046 | 
1047 | /**
1048 |  * Searches the index using the passed query.
1049 |  *
1050 |  * Queries should be a string, multiple words are allowed and will lead to an
1051 |  * AND based query, e.g. `idx.search('foo bar')` will run a search for
1052 |  * documents containing both 'foo' and 'bar'.
1053 |  *
1054 |  * All query tokens are passed through the same pipeline that document tokens
1055 |  * are passed through, so any language processing involved will be run on every
1056 |  * query term.
1057 |  *
1058 |  * Each query term is expanded, so that the term 'he' might be expanded to
1059 |  * 'hello' and 'help' if those terms were already included in the index.
1060 |  *
1061 |  * Matching documents are returned as an array of objects, each object contains
1062 |  * the matching document ref, as set for this index, and the similarity score
1063 |  * for this document against the query.
1064 |  *
1065 |  * @param {String} query The query to search the index with.
1066 |  * @returns {Object}
1067 |  * @see Index.prototype.idf
1068 |  * @see Index.prototype.documentVector
1069 |  * @memberOf Index
1070 |  */
1071 | lunr.Index.prototype.search = function (query) {
1072 |   var queryTokens = this.pipeline.run(lunr.tokenizer(query)),
1073 |       queryVector = new lunr.Vector,
1074 |       documentSets = [],
1075 |       fieldBoosts = this._fields.reduce(function (memo, f) { return memo + f.boost }, 0)
1076 | 
1077 |   var hasSomeToken = queryTokens.some(function (token) {
1078 |     return this.tokenStore.has(token)
1079 |   }, this)
1080 | 
1081 |   if (!hasSomeToken) return []
1082 | 
1083 |   queryTokens
1084 |     .forEach(function (token, i, tokens) {
1085 |       var tf = 1 / tokens.length * this._fields.length * fieldBoosts,
1086 |           self = this
1087 | 
1088 |       var set = this.tokenStore.expand(token).reduce(function (memo, key) {
1089 |         var pos = self.corpusTokens.indexOf(key),
1090 |             idf = self.idf(key),
1091 |             similarityBoost = 1,
1092 |             set = new lunr.SortedSet
1093 | 
1094 |         // if the expanded key is not an exact match to the token then
1095 |         // penalise the score for this key by how different the key is
1096 |         // to the token.
1097 |         if (key !== token) {
1098 |           var diff = Math.max(3, key.length - token.length)
1099 |           similarityBoost = 1 / Math.log(diff)
1100 |         }
1101 | 
1102 |         // calculate the query tf-idf score for this token
1103 |         // applying an similarityBoost to ensure exact matches
1104 |         // these rank higher than expanded terms
1105 |         if (pos > -1) queryVector.insert(pos, tf * idf * similarityBoost)
1106 | 
1107 |         // add all the documents that have this key into a set
1108 |         Object.keys(self.tokenStore.get(key)).forEach(function (ref) { set.add(ref) })
1109 | 
1110 |         return memo.union(set)
1111 |       }, new lunr.SortedSet)
1112 | 
1113 |       documentSets.push(set)
1114 |     }, this)
1115 | 
1116 |   var documentSet = documentSets.reduce(function (memo, set) {
1117 |     return memo.intersect(set)
1118 |   })
1119 | 
1120 |   return documentSet
1121 |     .map(function (ref) {
1122 |       return { ref: ref, score: queryVector.similarity(this.documentVector(ref)) }
1123 |     }, this)
1124 |     .sort(function (a, b) {
1125 |       return b.score - a.score
1126 |     })
1127 | }
1128 | 
1129 | /**
1130 |  * Generates a vector containing all the tokens in the document matching the
1131 |  * passed documentRef.
1132 |  *
1133 |  * The vector contains the tf-idf score for each token contained in the
1134 |  * document with the passed documentRef.  The vector will contain an element
1135 |  * for every token in the indexes corpus, if the document does not contain that
1136 |  * token the element will be 0.
1137 |  *
1138 |  * @param {Object} documentRef The ref to find the document with.
1139 |  * @returns {lunr.Vector}
1140 |  * @private
1141 |  * @memberOf Index
1142 |  */
1143 | lunr.Index.prototype.documentVector = function (documentRef) {
1144 |   var documentTokens = this.documentStore.get(documentRef),
1145 |       documentTokensLength = documentTokens.length,
1146 |       documentVector = new lunr.Vector
1147 | 
1148 |   for (var i = 0; i < documentTokensLength; i++) {
1149 |     var token = documentTokens.elements[i],
1150 |         tf = this.tokenStore.get(token)[documentRef].tf,
1151 |         idf = this.idf(token)
1152 | 
1153 |     documentVector.insert(this.corpusTokens.indexOf(token), tf * idf)
1154 |   };
1155 | 
1156 |   return documentVector
1157 | }
1158 | 
1159 | /**
1160 |  * Returns a representation of the index ready for serialisation.
1161 |  *
1162 |  * @returns {Object}
1163 |  * @memberOf Index
1164 |  */
1165 | lunr.Index.prototype.toJSON = function () {
1166 |   return {
1167 |     version: lunr.version,
1168 |     fields: this._fields,
1169 |     ref: this._ref,
1170 |     documentStore: this.documentStore.toJSON(),
1171 |     tokenStore: this.tokenStore.toJSON(),
1172 |     corpusTokens: this.corpusTokens.toJSON(),
1173 |     pipeline: this.pipeline.toJSON()
1174 |   }
1175 | }
1176 | 
1177 | /**
1178 |  * Applies a plugin to the current index.
1179 |  *
1180 |  * A plugin is a function that is called with the index as its context.
1181 |  * Plugins can be used to customise or extend the behaviour the index
1182 |  * in some way. A plugin is just a function, that encapsulated the custom
1183 |  * behaviour that should be applied to the index.
1184 |  *
1185 |  * The plugin function will be called with the index as its argument, additional
1186 |  * arguments can also be passed when calling use. The function will be called
1187 |  * with the index as its context.
1188 |  *
1189 |  * Example:
1190 |  *
1191 |  *     var myPlugin = function (idx, arg1, arg2) {
1192 |  *       // `this` is the index to be extended
1193 |  *       // apply any extensions etc here.
1194 |  *     }
1195 |  *
1196 |  *     var idx = lunr(function () {
1197 |  *       this.use(myPlugin, 'arg1', 'arg2')
1198 |  *     })
1199 |  *
1200 |  * @param {Function} plugin The plugin to apply.
1201 |  * @memberOf Index
1202 |  */
1203 | lunr.Index.prototype.use = function (plugin) {
1204 |   var args = Array.prototype.slice.call(arguments, 1)
1205 |   args.unshift(this)
1206 |   plugin.apply(this, args)
1207 | }
1208 | /*!
1209 |  * lunr.Store
1210 |  * Copyright (C) 2015 Oliver Nightingale
1211 |  */
1212 | 
1213 | /**
1214 |  * lunr.Store is a simple key-value store used for storing sets of tokens for
1215 |  * documents stored in index.
1216 |  *
1217 |  * @constructor
1218 |  * @module
1219 |  */
1220 | lunr.Store = function () {
1221 |   this.store = {}
1222 |   this.length = 0
1223 | }
1224 | 
1225 | /**
1226 |  * Loads a previously serialised store
1227 |  *
1228 |  * @param {Object} serialisedData The serialised store to load.
1229 |  * @returns {lunr.Store}
1230 |  * @memberOf Store
1231 |  */
1232 | lunr.Store.load = function (serialisedData) {
1233 |   var store = new this
1234 | 
1235 |   store.length = serialisedData.length
1236 |   store.store = Object.keys(serialisedData.store).reduce(function (memo, key) {
1237 |     memo[key] = lunr.SortedSet.load(serialisedData.store[key])
1238 |     return memo
1239 |   }, {})
1240 | 
1241 |   return store
1242 | }
1243 | 
1244 | /**
1245 |  * Stores the given tokens in the store against the given id.
1246 |  *
1247 |  * @param {Object} id The key used to store the tokens against.
1248 |  * @param {Object} tokens The tokens to store against the key.
1249 |  * @memberOf Store
1250 |  */
1251 | lunr.Store.prototype.set = function (id, tokens) {
1252 |   if (!this.has(id)) this.length++
1253 |   this.store[id] = tokens
1254 | }
1255 | 
1256 | /**
1257 |  * Retrieves the tokens from the store for a given key.
1258 |  *
1259 |  * @param {Object} id The key to lookup and retrieve from the store.
1260 |  * @returns {Object}
1261 |  * @memberOf Store
1262 |  */
1263 | lunr.Store.prototype.get = function (id) {
1264 |   return this.store[id]
1265 | }
1266 | 
1267 | /**
1268 |  * Checks whether the store contains a key.
1269 |  *
1270 |  * @param {Object} id The id to look up in the store.
1271 |  * @returns {Boolean}
1272 |  * @memberOf Store
1273 |  */
1274 | lunr.Store.prototype.has = function (id) {
1275 |   return id in this.store
1276 | }
1277 | 
1278 | /**
1279 |  * Removes the value for a key in the store.
1280 |  *
1281 |  * @param {Object} id The id to remove from the store.
1282 |  * @memberOf Store
1283 |  */
1284 | lunr.Store.prototype.remove = function (id) {
1285 |   if (!this.has(id)) return
1286 | 
1287 |   delete this.store[id]
1288 |   this.length--
1289 | }
1290 | 
1291 | /**
1292 |  * Returns a representation of the store ready for serialisation.
1293 |  *
1294 |  * @returns {Object}
1295 |  * @memberOf Store
1296 |  */
1297 | lunr.Store.prototype.toJSON = function () {
1298 |   return {
1299 |     store: this.store,
1300 |     length: this.length
1301 |   }
1302 | }
1303 | 
1304 | /*!
1305 |  * lunr.stemmer
1306 |  * Copyright (C) 2015 Oliver Nightingale
1307 |  * Includes code from - http://tartarus.org/~martin/PorterStemmer/js.txt
1308 |  */
1309 | 
1310 | /**
1311 |  * lunr.stemmer is an english language stemmer, this is a JavaScript
1312 |  * implementation of the PorterStemmer taken from http://tartarus.org/~martin
1313 |  *
1314 |  * @module
1315 |  * @param {String} str The string to stem
1316 |  * @returns {String}
1317 |  * @see lunr.Pipeline
1318 |  */
1319 | lunr.stemmer = (function(){
1320 |   var step2list = {
1321 |       "ational" : "ate",
1322 |       "tional" : "tion",
1323 |       "enci" : "ence",
1324 |       "anci" : "ance",
1325 |       "izer" : "ize",
1326 |       "bli" : "ble",
1327 |       "alli" : "al",
1328 |       "entli" : "ent",
1329 |       "eli" : "e",
1330 |       "ousli" : "ous",
1331 |       "ization" : "ize",
1332 |       "ation" : "ate",
1333 |       "ator" : "ate",
1334 |       "alism" : "al",
1335 |       "iveness" : "ive",
1336 |       "fulness" : "ful",
1337 |       "ousness" : "ous",
1338 |       "aliti" : "al",
1339 |       "iviti" : "ive",
1340 |       "biliti" : "ble",
1341 |       "logi" : "log"
1342 |     },
1343 | 
1344 |     step3list = {
1345 |       "icate" : "ic",
1346 |       "ative" : "",
1347 |       "alize" : "al",
1348 |       "iciti" : "ic",
1349 |       "ical" : "ic",
1350 |       "ful" : "",
1351 |       "ness" : ""
1352 |     },
1353 | 
1354 |     c = "[^aeiou]",          // consonant
1355 |     v = "[aeiouy]",          // vowel
1356 |     C = c + "[^aeiouy]*",    // consonant sequence
1357 |     V = v + "[aeiou]*",      // vowel sequence
1358 | 
1359 |     mgr0 = "^(" + C + ")?" + V + C,               // [C]VC... is m>0
1360 |     meq1 = "^(" + C + ")?" + V + C + "(" + V + ")?$",  // [C]VC[V] is m=1
1361 |     mgr1 = "^(" + C + ")?" + V + C + V + C,       // [C]VCVC... is m>1
1362 |     s_v = "^(" + C + ")?" + v;                   // vowel in stem
1363 | 
1364 |   var re_mgr0 = new RegExp(mgr0);
1365 |   var re_mgr1 = new RegExp(mgr1);
1366 |   var re_meq1 = new RegExp(meq1);
1367 |   var re_s_v = new RegExp(s_v);
1368 | 
1369 |   var re_1a = /^(.+?)(ss|i)es$/;
1370 |   var re2_1a = /^(.+?)([^s])s$/;
1371 |   var re_1b = /^(.+?)eed$/;
1372 |   var re2_1b = /^(.+?)(ed|ing)$/;
1373 |   var re_1b_2 = /.$/;
1374 |   var re2_1b_2 = /(at|bl|iz)$/;
1375 |   var re3_1b_2 = new RegExp("([^aeiouylsz])\\1$");
1376 |   var re4_1b_2 = new RegExp("^" + C + v + "[^aeiouwxy]$");
1377 | 
1378 |   var re_1c = /^(.+?[^aeiou])y$/;
1379 |   var re_2 = /^(.+?)(ational|tional|enci|anci|izer|bli|alli|entli|eli|ousli|ization|ation|ator|alism|iveness|fulness|ousness|aliti|iviti|biliti|logi)$/;
1380 | 
1381 |   var re_3 = /^(.+?)(icate|ative|alize|iciti|ical|ful|ness)$/;
1382 | 
1383 |   var re_4 = /^(.+?)(al|ance|ence|er|ic|able|ible|ant|ement|ment|ent|ou|ism|ate|iti|ous|ive|ize)$/;
1384 |   var re2_4 = /^(.+?)(s|t)(ion)$/;
1385 | 
1386 |   var re_5 = /^(.+?)e$/;
1387 |   var re_5_1 = /ll$/;
1388 |   var re3_5 = new RegExp("^" + C + v + "[^aeiouwxy]$");
1389 | 
1390 |   var porterStemmer = function porterStemmer(w) {
1391 |     var   stem,
1392 |       suffix,
1393 |       firstch,
1394 |       re,
1395 |       re2,
1396 |       re3,
1397 |       re4;
1398 | 
1399 |     if (w.length < 3) { return w; }
1400 | 
1401 |     firstch = w.substr(0,1);
1402 |     if (firstch == "y") {
1403 |       w = firstch.toUpperCase() + w.substr(1);
1404 |     }
1405 | 
1406 |     // Step 1a
1407 |     re = re_1a
1408 |     re2 = re2_1a;
1409 | 
1410 |     if (re.test(w)) { w = w.replace(re,"$1$2"); }
1411 |     else if (re2.test(w)) { w = w.replace(re2,"$1$2"); }
1412 | 
1413 |     // Step 1b
1414 |     re = re_1b;
1415 |     re2 = re2_1b;
1416 |     if (re.test(w)) {
1417 |       var fp = re.exec(w);
1418 |       re = re_mgr0;
1419 |       if (re.test(fp[1])) {
1420 |         re = re_1b_2;
1421 |         w = w.replace(re,"");
1422 |       }
1423 |     } else if (re2.test(w)) {
1424 |       var fp = re2.exec(w);
1425 |       stem = fp[1];
1426 |       re2 = re_s_v;
1427 |       if (re2.test(stem)) {
1428 |         w = stem;
1429 |         re2 = re2_1b_2;
1430 |         re3 = re3_1b_2;
1431 |         re4 = re4_1b_2;
1432 |         if (re2.test(w)) {  w = w + "e"; }
1433 |         else if (re3.test(w)) { re = re_1b_2; w = w.replace(re,""); }
1434 |         else if (re4.test(w)) { w = w + "e"; }
1435 |       }
1436 |     }
1437 | 
1438 |     // Step 1c - replace suffix y or Y by i if preceded by a non-vowel which is not the first letter of the word (so cry -> cri, by -> by, say -> say)
1439 |     re = re_1c;
1440 |     if (re.test(w)) {
1441 |       var fp = re.exec(w);
1442 |       stem = fp[1];
1443 |       w = stem + "i";
1444 |     }
1445 | 
1446 |     // Step 2
1447 |     re = re_2;
1448 |     if (re.test(w)) {
1449 |       var fp = re.exec(w);
1450 |       stem = fp[1];
1451 |       suffix = fp[2];
1452 |       re = re_mgr0;
1453 |       if (re.test(stem)) {
1454 |         w = stem + step2list[suffix];
1455 |       }
1456 |     }
1457 | 
1458 |     // Step 3
1459 |     re = re_3;
1460 |     if (re.test(w)) {
1461 |       var fp = re.exec(w);
1462 |       stem = fp[1];
1463 |       suffix = fp[2];
1464 |       re = re_mgr0;
1465 |       if (re.test(stem)) {
1466 |         w = stem + step3list[suffix];
1467 |       }
1468 |     }
1469 | 
1470 |     // Step 4
1471 |     re = re_4;
1472 |     re2 = re2_4;
1473 |     if (re.test(w)) {
1474 |       var fp = re.exec(w);
1475 |       stem = fp[1];
1476 |       re = re_mgr1;
1477 |       if (re.test(stem)) {
1478 |         w = stem;
1479 |       }
1480 |     } else if (re2.test(w)) {
1481 |       var fp = re2.exec(w);
1482 |       stem = fp[1] + fp[2];
1483 |       re2 = re_mgr1;
1484 |       if (re2.test(stem)) {
1485 |         w = stem;
1486 |       }
1487 |     }
1488 | 
1489 |     // Step 5
1490 |     re = re_5;
1491 |     if (re.test(w)) {
1492 |       var fp = re.exec(w);
1493 |       stem = fp[1];
1494 |       re = re_mgr1;
1495 |       re2 = re_meq1;
1496 |       re3 = re3_5;
1497 |       if (re.test(stem) || (re2.test(stem) && !(re3.test(stem)))) {
1498 |         w = stem;
1499 |       }
1500 |     }
1501 | 
1502 |     re = re_5_1;
1503 |     re2 = re_mgr1;
1504 |     if (re.test(w) && re2.test(w)) {
1505 |       re = re_1b_2;
1506 |       w = w.replace(re,"");
1507 |     }
1508 | 
1509 |     // and turn initial Y back to y
1510 | 
1511 |     if (firstch == "y") {
1512 |       w = firstch.toLowerCase() + w.substr(1);
1513 |     }
1514 | 
1515 |     return w;
1516 |   };
1517 | 
1518 |   return porterStemmer;
1519 | })();
1520 | 
1521 | lunr.Pipeline.registerFunction(lunr.stemmer, 'stemmer')
1522 | /*!
1523 |  * lunr.stopWordFilter
1524 |  * Copyright (C) 2015 Oliver Nightingale
1525 |  */
1526 | 
1527 | /**
1528 |  * lunr.stopWordFilter is an English language stop word list filter, any words
1529 |  * contained in the list will not be passed through the filter.
1530 |  *
1531 |  * This is intended to be used in the Pipeline. If the token does not pass the
1532 |  * filter then undefined will be returned.
1533 |  *
1534 |  * @module
1535 |  * @param {String} token The token to pass through the filter
1536 |  * @returns {String}
1537 |  * @see lunr.Pipeline
1538 |  */
1539 | lunr.stopWordFilter = function (token) {
1540 |   if (token && lunr.stopWordFilter.stopWords[token] !== token) return token;
1541 | }
1542 | 
1543 | lunr.stopWordFilter.stopWords = {
1544 |   'a': 'a',
1545 |   'able': 'able',
1546 |   'about': 'about',
1547 |   'across': 'across',
1548 |   'after': 'after',
1549 |   'all': 'all',
1550 |   'almost': 'almost',
1551 |   'also': 'also',
1552 |   'am': 'am',
1553 |   'among': 'among',
1554 |   'an': 'an',
1555 |   'and': 'and',
1556 |   'any': 'any',
1557 |   'are': 'are',
1558 |   'as': 'as',
1559 |   'at': 'at',
1560 |   'be': 'be',
1561 |   'because': 'because',
1562 |   'been': 'been',
1563 |   'but': 'but',
1564 |   'by': 'by',
1565 |   'can': 'can',
1566 |   'cannot': 'cannot',
1567 |   'could': 'could',
1568 |   'dear': 'dear',
1569 |   'did': 'did',
1570 |   'do': 'do',
1571 |   'does': 'does',
1572 |   'either': 'either',
1573 |   'else': 'else',
1574 |   'ever': 'ever',
1575 |   'every': 'every',
1576 |   'for': 'for',
1577 |   'from': 'from',
1578 |   'get': 'get',
1579 |   'got': 'got',
1580 |   'had': 'had',
1581 |   'has': 'has',
1582 |   'have': 'have',
1583 |   'he': 'he',
1584 |   'her': 'her',
1585 |   'hers': 'hers',
1586 |   'him': 'him',
1587 |   'his': 'his',
1588 |   'how': 'how',
1589 |   'however': 'however',
1590 |   'i': 'i',
1591 |   'if': 'if',
1592 |   'in': 'in',
1593 |   'into': 'into',
1594 |   'is': 'is',
1595 |   'it': 'it',
1596 |   'its': 'its',
1597 |   'just': 'just',
1598 |   'least': 'least',
1599 |   'let': 'let',
1600 |   'like': 'like',
1601 |   'likely': 'likely',
1602 |   'may': 'may',
1603 |   'me': 'me',
1604 |   'might': 'might',
1605 |   'most': 'most',
1606 |   'must': 'must',
1607 |   'my': 'my',
1608 |   'neither': 'neither',
1609 |   'no': 'no',
1610 |   'nor': 'nor',
1611 |   'not': 'not',
1612 |   'of': 'of',
1613 |   'off': 'off',
1614 |   'often': 'often',
1615 |   'on': 'on',
1616 |   'only': 'only',
1617 |   'or': 'or',
1618 |   'other': 'other',
1619 |   'our': 'our',
1620 |   'own': 'own',
1621 |   'rather': 'rather',
1622 |   'said': 'said',
1623 |   'say': 'say',
1624 |   'says': 'says',
1625 |   'she': 'she',
1626 |   'should': 'should',
1627 |   'since': 'since',
1628 |   'so': 'so',
1629 |   'some': 'some',
1630 |   'than': 'than',
1631 |   'that': 'that',
1632 |   'the': 'the',
1633 |   'their': 'their',
1634 |   'them': 'them',
1635 |   'then': 'then',
1636 |   'there': 'there',
1637 |   'these': 'these',
1638 |   'they': 'they',
1639 |   'this': 'this',
1640 |   'tis': 'tis',
1641 |   'to': 'to',
1642 |   'too': 'too',
1643 |   'twas': 'twas',
1644 |   'us': 'us',
1645 |   'wants': 'wants',
1646 |   'was': 'was',
1647 |   'we': 'we',
1648 |   'were': 'were',
1649 |   'what': 'what',
1650 |   'when': 'when',
1651 |   'where': 'where',
1652 |   'which': 'which',
1653 |   'while': 'while',
1654 |   'who': 'who',
1655 |   'whom': 'whom',
1656 |   'why': 'why',
1657 |   'will': 'will',
1658 |   'with': 'with',
1659 |   'would': 'would',
1660 |   'yet': 'yet',
1661 |   'you': 'you',
1662 |   'your': 'your'
1663 | }
1664 | 
1665 | lunr.Pipeline.registerFunction(lunr.stopWordFilter, 'stopWordFilter')
1666 | /*!
1667 |  * lunr.trimmer
1668 |  * Copyright (C) 2015 Oliver Nightingale
1669 |  */
1670 | 
1671 | /**
1672 |  * lunr.trimmer is a pipeline function for trimming non word
1673 |  * characters from the begining and end of tokens before they
1674 |  * enter the index.
1675 |  *
1676 |  * This implementation may not work correctly for non latin
1677 |  * characters and should either be removed or adapted for use
1678 |  * with languages with non-latin characters.
1679 |  *
1680 |  * @module
1681 |  * @param {String} token The token to pass through the filter
1682 |  * @returns {String}
1683 |  * @see lunr.Pipeline
1684 |  */
1685 | lunr.trimmer = function (token) {
1686 |   var result = token.replace(/^\W+/, '')
1687 |                     .replace(/\W+$/, '')
1688 |   return result === '' ? undefined : result
1689 | }
1690 | 
1691 | lunr.Pipeline.registerFunction(lunr.trimmer, 'trimmer')
1692 | /*!
1693 |  * lunr.stemmer
1694 |  * Copyright (C) 2015 Oliver Nightingale
1695 |  * Includes code from - http://tartarus.org/~martin/PorterStemmer/js.txt
1696 |  */
1697 | 
1698 | /**
1699 |  * lunr.TokenStore is used for efficient storing and lookup of the reverse
1700 |  * index of token to document ref.
1701 |  *
1702 |  * @constructor
1703 |  */
1704 | lunr.TokenStore = function () {
1705 |   this.root = { docs: {} }
1706 |   this.length = 0
1707 | }
1708 | 
1709 | /**
1710 |  * Loads a previously serialised token store
1711 |  *
1712 |  * @param {Object} serialisedData The serialised token store to load.
1713 |  * @returns {lunr.TokenStore}
1714 |  * @memberOf TokenStore
1715 |  */
1716 | lunr.TokenStore.load = function (serialisedData) {
1717 |   var store = new this
1718 | 
1719 |   store.root = serialisedData.root
1720 |   store.length = serialisedData.length
1721 | 
1722 |   return store
1723 | }
1724 | 
1725 | /**
1726 |  * Adds a new token doc pair to the store.
1727 |  *
1728 |  * By default this function starts at the root of the current store, however
1729 |  * it can start at any node of any token store if required.
1730 |  *
1731 |  * @param {String} token The token to store the doc under
1732 |  * @param {Object} doc The doc to store against the token
1733 |  * @param {Object} root An optional node at which to start looking for the
1734 |  * correct place to enter the doc, by default the root of this lunr.TokenStore
1735 |  * is used.
1736 |  * @memberOf TokenStore
1737 |  */
1738 | lunr.TokenStore.prototype.add = function (token, doc, root) {
1739 |   var root = root || this.root,
1740 |       key = token[0],
1741 |       rest = token.slice(1)
1742 | 
1743 |   if (!(key in root)) root[key] = {docs: {}}
1744 | 
1745 |   if (rest.length === 0) {
1746 |     root[key].docs[doc.ref] = doc
1747 |     this.length += 1
1748 |     return
1749 |   } else {
1750 |     return this.add(rest, doc, root[key])
1751 |   }
1752 | }
1753 | 
1754 | /**
1755 |  * Checks whether this key is contained within this lunr.TokenStore.
1756 |  *
1757 |  * By default this function starts at the root of the current store, however
1758 |  * it can start at any node of any token store if required.
1759 |  *
1760 |  * @param {String} token The token to check for
1761 |  * @param {Object} root An optional node at which to start
1762 |  * @memberOf TokenStore
1763 |  */
1764 | lunr.TokenStore.prototype.has = function (token) {
1765 |   if (!token) return false
1766 | 
1767 |   var node = this.root
1768 | 
1769 |   for (var i = 0; i < token.length; i++) {
1770 |     if (!node[token[i]]) return false
1771 | 
1772 |     node = node[token[i]]
1773 |   }
1774 | 
1775 |   return true
1776 | }
1777 | 
1778 | /**
1779 |  * Retrieve a node from the token store for a given token.
1780 |  *
1781 |  * By default this function starts at the root of the current store, however
1782 |  * it can start at any node of any token store if required.
1783 |  *
1784 |  * @param {String} token The token to get the node for.
1785 |  * @param {Object} root An optional node at which to start.
1786 |  * @returns {Object}
1787 |  * @see TokenStore.prototype.get
1788 |  * @memberOf TokenStore
1789 |  */
1790 | lunr.TokenStore.prototype.getNode = function (token) {
1791 |   if (!token) return {}
1792 | 
1793 |   var node = this.root
1794 | 
1795 |   for (var i = 0; i < token.length; i++) {
1796 |     if (!node[token[i]]) return {}
1797 | 
1798 |     node = node[token[i]]
1799 |   }
1800 | 
1801 |   return node
1802 | }
1803 | 
1804 | /**
1805 |  * Retrieve the documents for a node for the given token.
1806 |  *
1807 |  * By default this function starts at the root of the current store, however
1808 |  * it can start at any node of any token store if required.
1809 |  *
1810 |  * @param {String} token The token to get the documents for.
1811 |  * @param {Object} root An optional node at which to start.
1812 |  * @returns {Object}
1813 |  * @memberOf TokenStore
1814 |  */
1815 | lunr.TokenStore.prototype.get = function (token, root) {
1816 |   return this.getNode(token, root).docs || {}
1817 | }
1818 | 
1819 | lunr.TokenStore.prototype.count = function (token, root) {
1820 |   return Object.keys(this.get(token, root)).length
1821 | }
1822 | 
1823 | /**
1824 |  * Remove the document identified by ref from the token in the store.
1825 |  *
1826 |  * By default this function starts at the root of the current store, however
1827 |  * it can start at any node of any token store if required.
1828 |  *
1829 |  * @param {String} token The token to get the documents for.
1830 |  * @param {String} ref The ref of the document to remove from this token.
1831 |  * @param {Object} root An optional node at which to start.
1832 |  * @returns {Object}
1833 |  * @memberOf TokenStore
1834 |  */
1835 | lunr.TokenStore.prototype.remove = function (token, ref) {
1836 |   if (!token) return
1837 |   var node = this.root
1838 | 
1839 |   for (var i = 0; i < token.length; i++) {
1840 |     if (!(token[i] in node)) return
1841 |     node = node[token[i]]
1842 |   }
1843 | 
1844 |   delete node.docs[ref]
1845 | }
1846 | 
1847 | /**
1848 |  * Find all the possible suffixes of the passed token using tokens
1849 |  * currently in the store.
1850 |  *
1851 |  * @param {String} token The token to expand.
1852 |  * @returns {Array}
1853 |  * @memberOf TokenStore
1854 |  */
1855 | lunr.TokenStore.prototype.expand = function (token, memo) {
1856 |   var root = this.getNode(token),
1857 |       docs = root.docs || {},
1858 |       memo = memo || []
1859 | 
1860 |   if (Object.keys(docs).length) memo.push(token)
1861 | 
1862 |   Object.keys(root)
1863 |     .forEach(function (key) {
1864 |       if (key === 'docs') return
1865 | 
1866 |       memo.concat(this.expand(token + key, memo))
1867 |     }, this)
1868 | 
1869 |   return memo
1870 | }
1871 | 
1872 | /**
1873 |  * Returns a representation of the token store ready for serialisation.
1874 |  *
1875 |  * @returns {Object}
1876 |  * @memberOf TokenStore
1877 |  */
1878 | lunr.TokenStore.prototype.toJSON = function () {
1879 |   return {
1880 |     root: this.root,
1881 |     length: this.length
1882 |   }
1883 | }
1884 | 
1885 | 
1886 |   /**
1887 |    * export the module via AMD, CommonJS or as a browser global
1888 |    * Export code from https://github.com/umdjs/umd/blob/master/returnExports.js
1889 |    */
1890 |   ;(function (root, factory) {
1891 |     if (typeof define === 'function' && define.amd) {
1892 |       // AMD. Register as an anonymous module.
1893 |       define(factory)
1894 |     } else if (typeof exports === 'object') {
1895 |       /**
1896 |        * Node. Does not work with strict CommonJS, but
1897 |        * only CommonJS-like enviroments that support module.exports,
1898 |        * like Node.
1899 |        */
1900 |       module.exports = factory()
1901 |     } else {
1902 |       // Browser globals (root is window)
1903 |       root.lunr = factory()
1904 |     }
1905 |   }(this, function () {
1906 |     /**
1907 |      * Just return a value to define the module export.
1908 |      * This example returns an object, but the module
1909 |      * can return a function as the exported value.
1910 |      */
1911 |     return lunr
1912 |   }))
1913 | })();
1914 | 


--------------------------------------------------------------------------------
/book/gitbook/gitbook-plugin-lunr/search-lunr.js:
--------------------------------------------------------------------------------
 1 | require([
 2 |     'gitbook',
 3 |     'jquery'
 4 | ], function(gitbook, $) {
 5 |     // Define global search engine
 6 |     function LunrSearchEngine() {
 7 |         this.index = null;
 8 |         this.store = {};
 9 |         this.name = 'LunrSearchEngine';
10 |     }
11 | 
12 |     // Initialize lunr by fetching the search index
13 |     LunrSearchEngine.prototype.init = function() {
14 |         var that = this;
15 |         var d = $.Deferred();
16 | 
17 |         $.getJSON(gitbook.state.basePath+'/search_index.json')
18 |         .then(function(data) {
19 |             // eslint-disable-next-line no-undef
20 |             that.index = lunr.Index.load(data.index);
21 |             that.store = data.store;
22 |             d.resolve();
23 |         });
24 | 
25 |         return d.promise();
26 |     };
27 | 
28 |     // Search for a term and return results
29 |     LunrSearchEngine.prototype.search = function(q, offset, length) {
30 |         var that = this;
31 |         var results = [];
32 | 
33 |         if (this.index) {
34 |             results = $.map(this.index.search(q), function(result) {
35 |                 var doc = that.store[result.ref];
36 | 
37 |                 return {
38 |                     title: doc.title,
39 |                     url: doc.url,
40 |                     body: doc.summary || doc.body
41 |                 };
42 |             });
43 |         }
44 | 
45 |         return $.Deferred().resolve({
46 |             query: q,
47 |             results: results.slice(0, length),
48 |             count: results.length
49 |         }).promise();
50 |     };
51 | 
52 |     // Set gitbook research
53 |     gitbook.events.bind('start', function(e, config) {
54 |         var engine = gitbook.search.getEngine();
55 |         if (!engine) {
56 |             gitbook.search.setEngine(LunrSearchEngine, config);
57 |         }
58 |     });
59 | });
60 | 


--------------------------------------------------------------------------------
/book/gitbook/gitbook-plugin-search/search-engine.js:
--------------------------------------------------------------------------------
 1 | require([
 2 |     'gitbook',
 3 |     'jquery'
 4 | ], function(gitbook, $) {
 5 |     // Global search objects
 6 |     var engine      = null;
 7 |     var initialized = false;
 8 | 
 9 |     // Set a new search engine
10 |     function setEngine(Engine, config) {
11 |         initialized = false;
12 |         engine      = new Engine(config);
13 | 
14 |         init(config);
15 |     }
16 | 
17 |     // Initialize search engine with config
18 |     function init(config) {
19 |         if (!engine) throw new Error('No engine set for research. Set an engine using gitbook.research.setEngine(Engine).');
20 | 
21 |         return engine.init(config)
22 |         .then(function() {
23 |             initialized = true;
24 |             gitbook.events.trigger('search.ready');
25 |         });
26 |     }
27 | 
28 |     // Launch search for query q
29 |     function query(q, offset, length) {
30 |         if (!initialized) throw new Error('Search has not been initialized');
31 |         return engine.search(q, offset, length);
32 |     }
33 | 
34 |     // Get stats about search
35 |     function getEngine() {
36 |         return engine? engine.name : null;
37 |     }
38 | 
39 |     function isInitialized() {
40 |         return initialized;
41 |     }
42 | 
43 |     // Initialize gitbook.search
44 |     gitbook.search = {
45 |         setEngine:     setEngine,
46 |         getEngine:     getEngine,
47 |         query:         query,
48 |         isInitialized: isInitialized
49 |     };
50 | });


--------------------------------------------------------------------------------
/book/gitbook/gitbook-plugin-search/search.js:
--------------------------------------------------------------------------------
  1 | require([
  2 |     'gitbook',
  3 |     'jquery'
  4 | ], function(gitbook, $) {
  5 |     var MAX_RESULTS = 15;
  6 |     var MAX_DESCRIPTION_SIZE = 500;
  7 | 
  8 |     var usePushState = (typeof history.pushState !== 'undefined');
  9 | 
 10 |     // DOM Elements
 11 |     var $body = $('body');
 12 |     var $bookSearchResults;
 13 |     var $searchInput;
 14 |     var $searchList;
 15 |     var $searchTitle;
 16 |     var $searchResultsCount;
 17 |     var $searchQuery;
 18 | 
 19 |     // Throttle search
 20 |     function throttle(fn, wait) {
 21 |         var timeout;
 22 | 
 23 |         return function() {
 24 |             var ctx = this, args = arguments;
 25 |             if (!timeout) {
 26 |                 timeout = setTimeout(function() {
 27 |                     timeout = null;
 28 |                     fn.apply(ctx, args);
 29 |                 }, wait);
 30 |             }
 31 |         };
 32 |     }
 33 | 
 34 |     function displayResults(res) {
 35 |         $bookSearchResults.addClass('open');
 36 | 
 37 |         var noResults = res.count == 0;
 38 |         $bookSearchResults.toggleClass('no-results', noResults);
 39 | 
 40 |         // Clear old results
 41 |         $searchList.empty();
 42 | 
 43 |         // Display title for research
 44 |         $searchResultsCount.text(res.count);
 45 |         $searchQuery.text(res.query);
 46 | 
 47 |         // Create an <li> element for each result
 48 |         res.results.forEach(function(res) {
 49 |             var $li = $('<li>', {
 50 |                 'class': 'search-results-item'
 51 |             });
 52 | 
 53 |             var $title = $('<h3>');
 54 | 
 55 |             var $link = $('<a>', {
 56 |                 'href': gitbook.state.basePath + '/' + res.url,
 57 |                 'text': res.title
 58 |             });
 59 | 
 60 |             var content = res.body.trim();
 61 |             if (content.length > MAX_DESCRIPTION_SIZE) {
 62 |                 content = content.slice(0, MAX_DESCRIPTION_SIZE).trim()+'...';
 63 |             }
 64 |             var $content = $('<p>').html(content);
 65 | 
 66 |             $link.appendTo($title);
 67 |             $title.appendTo($li);
 68 |             $content.appendTo($li);
 69 |             $li.appendTo($searchList);
 70 |         });
 71 |     }
 72 | 
 73 |     function launchSearch(q) {
 74 |         // Add class for loading
 75 |         $body.addClass('with-search');
 76 |         $body.addClass('search-loading');
 77 | 
 78 |         // Launch search query
 79 |         throttle(gitbook.search.query(q, 0, MAX_RESULTS)
 80 |         .then(function(results) {
 81 |             displayResults(results);
 82 |         })
 83 |         .always(function() {
 84 |             $body.removeClass('search-loading');
 85 |         }), 1000);
 86 |     }
 87 | 
 88 |     function closeSearch() {
 89 |         $body.removeClass('with-search');
 90 |         $bookSearchResults.removeClass('open');
 91 |     }
 92 | 
 93 |     function launchSearchFromQueryString() {
 94 |         var q = getParameterByName('q');
 95 |         if (q && q.length > 0) {
 96 |             // Update search input
 97 |             $searchInput.val(q);
 98 | 
 99 |             // Launch search
100 |             launchSearch(q);
101 |         }
102 |     }
103 | 
104 |     function bindSearch() {
105 |         // Bind DOM
106 |         $searchInput        = $('#book-search-input input');
107 |         $bookSearchResults  = $('#book-search-results');
108 |         $searchList         = $bookSearchResults.find('.search-results-list');
109 |         $searchTitle        = $bookSearchResults.find('.search-results-title');
110 |         $searchResultsCount = $searchTitle.find('.search-results-count');
111 |         $searchQuery        = $searchTitle.find('.search-query');
112 | 
113 |         // Launch query based on input content
114 |         function handleUpdate() {
115 |             var q = $searchInput.val();
116 | 
117 |             if (q.length == 0) {
118 |                 closeSearch();
119 |             }
120 |             else {
121 |                 launchSearch(q);
122 |             }
123 |         }
124 | 
125 |         // Detect true content change in search input
126 |         // Workaround for IE < 9
127 |         var propertyChangeUnbound = false;
128 |         $searchInput.on('propertychange', function(e) {
129 |             if (e.originalEvent.propertyName == 'value') {
130 |                 handleUpdate();
131 |             }
132 |         });
133 | 
134 |         // HTML5 (IE9 & others)
135 |         $searchInput.on('input', function(e) {
136 |             // Unbind propertychange event for IE9+
137 |             if (!propertyChangeUnbound) {
138 |                 $(this).unbind('propertychange');
139 |                 propertyChangeUnbound = true;
140 |             }
141 | 
142 |             handleUpdate();
143 |         });
144 | 
145 |         // Push to history on blur
146 |         $searchInput.on('blur', function(e) {
147 |             // Update history state
148 |             if (usePushState) {
149 |                 var uri = updateQueryString('q', $(this).val());
150 |                 history.pushState({ path: uri }, null, uri);
151 |             }
152 |         });
153 |     }
154 | 
155 |     gitbook.events.on('page.change', function() {
156 |         bindSearch();
157 |         closeSearch();
158 | 
159 |         // Launch search based on query parameter
160 |         if (gitbook.search.isInitialized()) {
161 |             launchSearchFromQueryString();
162 |         }
163 |     });
164 | 
165 |     gitbook.events.on('search.ready', function() {
166 |         bindSearch();
167 | 
168 |         // Launch search from query param at start
169 |         launchSearchFromQueryString();
170 |     });
171 | 
172 |     function getParameterByName(name) {
173 |         var url = window.location.href;
174 |         name = name.replace(/[\[\]]/g, '\\$&');
175 |         var regex = new RegExp('[?&]' + name + '(=([^&#]*)|&|#|$)', 'i'),
176 |             results = regex.exec(url);
177 |         if (!results) return null;
178 |         if (!results[2]) return '';
179 |         return decodeURIComponent(results[2].replace(/\+/g, ' '));
180 |     }
181 | 
182 |     function updateQueryString(key, value) {
183 |         value = encodeURIComponent(value);
184 | 
185 |         var url = window.location.href;
186 |         var re = new RegExp('([?&])' + key + '=.*?(&|#|$)(.*)', 'gi'),
187 |             hash;
188 | 
189 |         if (re.test(url)) {
190 |             if (typeof value !== 'undefined' && value !== null)
191 |                 return url.replace(re, '$1' + key + '=' + value + '$2$3');
192 |             else {
193 |                 hash = url.split('#');
194 |                 url = hash[0].replace(re, '$1$3').replace(/(&|\?)$/, '');
195 |                 if (typeof hash[1] !== 'undefined' && hash[1] !== null)
196 |                     url += '#' + hash[1];
197 |                 return url;
198 |             }
199 |         }
200 |         else {
201 |             if (typeof value !== 'undefined' && value !== null) {
202 |                 var separator = url.indexOf('?') !== -1 ? '&' : '?';
203 |                 hash = url.split('#');
204 |                 url = hash[0] + separator + key + '=' + value;
205 |                 if (typeof hash[1] !== 'undefined' && hash[1] !== null)
206 |                     url += '#' + hash[1];
207 |                 return url;
208 |             }
209 |             else
210 |                 return url;
211 |         }
212 |     }
213 | });
214 | 


--------------------------------------------------------------------------------
/book/gitbook/gitbook-plugin-sharing/buttons.js:
--------------------------------------------------------------------------------
 1 | require(['gitbook', 'jquery'], function(gitbook, $) {
 2 |     var SITES = {
 3 |         'facebook': {
 4 |             'label': 'Facebook',
 5 |             'icon': 'fa fa-facebook',
 6 |             'onClick': function(e) {
 7 |                 e.preventDefault();
 8 |                 window.open('http://www.facebook.com/sharer/sharer.php?s=100&p[url]='+encodeURIComponent(location.href));
 9 |             }
10 |         },
11 |         'twitter': {
12 |             'label': 'Twitter',
13 |             'icon': 'fa fa-twitter',
14 |             'onClick': function(e) {
15 |                 e.preventDefault();
16 |                 window.open('http://twitter.com/home?status='+encodeURIComponent(document.title+' '+location.href));
17 |             }
18 |         },
19 |         'google': {
20 |             'label': 'Google+',
21 |             'icon': 'fa fa-google-plus',
22 |             'onClick': function(e) {
23 |                 e.preventDefault();
24 |                 window.open('https://plus.google.com/share?url='+encodeURIComponent(location.href));
25 |             }
26 |         },
27 |         'weibo': {
28 |             'label': 'Weibo',
29 |             'icon': 'fa fa-weibo',
30 |             'onClick': function(e) {
31 |                 e.preventDefault();
32 |                 window.open('http://service.weibo.com/share/share.php?content=utf-8&url='+encodeURIComponent(location.href)+'&title='+encodeURIComponent(document.title));
33 |             }
34 |         },
35 |         'instapaper': {
36 |             'label': 'Instapaper',
37 |             'icon': 'fa fa-instapaper',
38 |             'onClick': function(e) {
39 |                 e.preventDefault();
40 |                 window.open('http://www.instapaper.com/text?u='+encodeURIComponent(location.href));
41 |             }
42 |         },
43 |         'vk': {
44 |             'label': 'VK',
45 |             'icon': 'fa fa-vk',
46 |             'onClick': function(e) {
47 |                 e.preventDefault();
48 |                 window.open('http://vkontakte.ru/share.php?url='+encodeURIComponent(location.href));
49 |             }
50 |         }
51 |     };
52 | 
53 | 
54 | 
55 |     gitbook.events.bind('start', function(e, config) {
56 |         var opts = config.sharing;
57 | 
58 |         // Create dropdown menu
59 |         var menu = $.map(opts.all, function(id) {
60 |             var site = SITES[id];
61 | 
62 |             return {
63 |                 text: site.label,
64 |                 onClick: site.onClick
65 |             };
66 |         });
67 | 
68 |         // Create main button with dropdown
69 |         if (menu.length > 0) {
70 |             gitbook.toolbar.createButton({
71 |                 icon: 'fa fa-share-alt',
72 |                 label: 'Share',
73 |                 position: 'right',
74 |                 dropdown: [menu]
75 |             });
76 |         }
77 | 
78 |         // Direct actions to share
79 |         $.each(SITES, function(sideId, site) {
80 |             if (!opts[sideId]) return;
81 | 
82 |             gitbook.toolbar.createButton({
83 |                 icon: site.icon,
84 |                 label: site.text,
85 |                 position: 'right',
86 |                 onClick: site.onClick
87 |             });
88 |         });
89 |     });
90 | });
91 | 


--------------------------------------------------------------------------------
/book/gitbook/style.css:
--------------------------------------------------------------------------------
  1 | /*! normalize.css v2.1.0 | MIT License | git.io/normalize */article,aside,details,figcaption,figure,footer,header,hgroup,main,nav,section,summary{display:block}audio,canvas,video{display:inline-block}audio:not([controls]){display:none;height:0}[hidden]{display:none}html{font-family:sans-serif;-webkit-text-size-adjust:100%;-ms-text-size-adjust:100%}body{margin:0}a:focus{outline:thin dotted}a:active,a:hover{outline:0}h1{font-size:2em;margin:.67em 0}abbr[title]{border-bottom:1px dotted}b,strong{font-weight:700}dfn{font-style:italic}hr{-moz-box-sizing:content-box;box-sizing:content-box;height:0}mark{background:#ff0;color:#000}code,kbd,pre,samp{font-family:monospace,serif;font-size:1em}pre{white-space:pre-wrap}q{quotes:"\201C" "\201D" "\2018" "\2019"}small{font-size:80%}sub,sup{font-size:75%;line-height:0;position:relative;vertical-align:baseline}sup{top:-.5em}sub{bottom:-.25em}img{border:0}svg:not(:root){overflow:hidden}figure{margin:0}fieldset{border:1px solid silver;margin:0 2px;padding:.35em .625em .75em}legend{border:0;padding:0}button,input,select,textarea{font-family:inherit;font-size:100%;margin:0}button,input{line-height:normal}button,select{text-transform:none}button,html input[type=button],input[type=reset],input[type=submit]{-webkit-appearance:button;cursor:pointer}button[disabled],html input[disabled]{cursor:default}input[type=checkbox],input[type=radio]{box-sizing:border-box;padding:0}input[type=search]{-webkit-appearance:textfield;-moz-box-sizing:content-box;-webkit-box-sizing:content-box;box-sizing:content-box}input[type=search]::-webkit-search-cancel-button,input[type=search]::-webkit-search-decoration{-webkit-appearance:none}button::-moz-focus-inner,input::-moz-focus-inner{border:0;padding:0}textarea{overflow:auto;vertical-align:top}table{border-collapse:collapse;border-spacing:0}.link-inherit{color:inherit}.link-inherit:focus,.link-inherit:hover{color:inherit}.hidden{display:none}.alert{padding:15px;margin-bottom:20px;color:#444;background:#eee;border-bottom:5px solid #ddd}.alert-success{background:#dff0d8;border-color:#d6e9c6;color:#3c763d}.alert-info{background:#d9edf7;border-color:#bce8f1;color:#31708f}.alert-danger{background:#f2dede;border-color:#ebccd1;color:#a94442}.alert-warning{background:#fcf8e3;border-color:#faebcc;color:#8a6d3b}/*!
  2 |  *  Font Awesome 4.6.3 by @davegandy - http://fontawesome.io - @fontawesome
  3 |  *  License - http://fontawesome.io/license (Font: SIL OFL 1.1, CSS: MIT License)
  4 |  */
  5 | @font-face{font-family:FontAwesome;src:url(fonts/fontawesome/fontawesome-webfont.eot?v=4.6.3);src:url(fonts/fontawesome/fontawesome-webfont.eot?#iefix&v=4.6.3) format('embedded-opentype'),url(fonts/fontawesome/fontawesome-webfont.woff2?v=4.6.3) format('woff2'),url(fonts/fontawesome/fontawesome-webfont.woff?v=4.6.3) format('woff'),url(fonts/fontawesome/fontawesome-webfont.ttf?v=4.6.3) format('truetype'),url(fonts/fontawesome/fontawesome-webfont.svg?v=4.6.3#fontawesomeregular) format('svg');font-weight:400;font-style:normal}
  6 | .fa{display:inline-block;font:normal normal normal 14px/1 FontAwesome;font-size:inherit;text-rendering:auto;-webkit-font-smoothing:antialiased;-moz-osx-font-smoothing:grayscale}
  7 | .fa-lg{font-size:1.33333333em;line-height:.75em;vertical-align:-15%}
  8 | .fa-2x{font-size:2em}
  9 | .fa-3x{font-size:3em}
 10 | .fa-4x{font-size:4em}
 11 | .fa-5x{font-size:5em}
 12 | .fa-fw{width:1.28571429em;text-align:center}
 13 | .fa-ul{padding-left:0;margin-left:2.14285714em;list-style-type:none}
 14 | .fa-ul>li{position:relative}
 15 | .fa-li{position:absolute;left:-2.14285714em;width:2.14285714em;top:.14285714em;text-align:center}
 16 | .fa-li.fa-lg{left:-1.85714286em}
 17 | .fa-border{padding:.2em .25em .15em;border:solid .08em #eee;border-radius:.1em}
 18 | .fa-pull-left{float:left}
 19 | .fa-pull-right{float:right}
 20 | .fa.fa-pull-left{margin-right:.3em}
 21 | .fa.fa-pull-right{margin-left:.3em}
 22 | .pull-right{float:right}
 23 | .pull-left{float:left}
 24 | .fa.pull-left{margin-right:.3em}
 25 | .fa.pull-right{margin-left:.3em}
 26 | .fa-spin{-webkit-animation:fa-spin 2s infinite linear;animation:fa-spin 2s infinite linear}
 27 | .fa-pulse{-webkit-animation:fa-spin 1s infinite steps(8);animation:fa-spin 1s infinite steps(8)}
 28 | @-webkit-keyframes fa-spin{0%{-webkit-transform:rotate(0);transform:rotate(0)}
 29 | 100%{-webkit-transform:rotate(359deg);transform:rotate(359deg)}
 30 | }
 31 | @keyframes fa-spin{0%{-webkit-transform:rotate(0);transform:rotate(0)}
 32 | 100%{-webkit-transform:rotate(359deg);transform:rotate(359deg)}
 33 | }
 34 | .fa-rotate-90{-ms-filter:"progid:DXImageTransform.Microsoft.BasicImage(rotation=1)";-webkit-transform:rotate(90deg);-ms-transform:rotate(90deg);transform:rotate(90deg)}
 35 | .fa-rotate-180{-ms-filter:"progid:DXImageTransform.Microsoft.BasicImage(rotation=2)";-webkit-transform:rotate(180deg);-ms-transform:rotate(180deg);transform:rotate(180deg)}
 36 | .fa-rotate-270{-ms-filter:"progid:DXImageTransform.Microsoft.BasicImage(rotation=3)";-webkit-transform:rotate(270deg);-ms-transform:rotate(270deg);transform:rotate(270deg)}
 37 | .fa-flip-horizontal{-ms-filter:"progid:DXImageTransform.Microsoft.BasicImage(rotation=0, mirror=1)";-webkit-transform:scale(-1,1);-ms-transform:scale(-1,1);transform:scale(-1,1)}
 38 | .fa-flip-vertical{-ms-filter:"progid:DXImageTransform.Microsoft.BasicImage(rotation=2, mirror=1)";-webkit-transform:scale(1,-1);-ms-transform:scale(1,-1);transform:scale(1,-1)}
 39 | :root .fa-flip-horizontal,:root .fa-flip-vertical,:root .fa-rotate-180,:root .fa-rotate-270,:root .fa-rotate-90{filter:none}
 40 | .fa-stack{position:relative;display:inline-block;width:2em;height:2em;line-height:2em;vertical-align:middle}
 41 | .fa-stack-1x,.fa-stack-2x{position:absolute;left:0;width:100%;text-align:center}
 42 | .fa-stack-1x{line-height:inherit}
 43 | .fa-stack-2x{font-size:2em}
 44 | .fa-inverse{color:#fff}
 45 | .fa-glass:before{content:"\f000"}
 46 | .fa-music:before{content:"\f001"}
 47 | .fa-search:before{content:"\f002"}
 48 | .fa-envelope-o:before{content:"\f003"}
 49 | .fa-heart:before{content:"\f004"}
 50 | .fa-star:before{content:"\f005"}
 51 | .fa-star-o:before{content:"\f006"}
 52 | .fa-user:before{content:"\f007"}
 53 | .fa-film:before{content:"\f008"}
 54 | .fa-th-large:before{content:"\f009"}
 55 | .fa-th:before{content:"\f00a"}
 56 | .fa-th-list:before{content:"\f00b"}
 57 | .fa-check:before{content:"\f00c"}
 58 | .fa-close:before,.fa-remove:before,.fa-times:before{content:"\f00d"}
 59 | .fa-search-plus:before{content:"\f00e"}
 60 | .fa-search-minus:before{content:"\f010"}
 61 | .fa-power-off:before{content:"\f011"}
 62 | .fa-signal:before{content:"\f012"}
 63 | .fa-cog:before,.fa-gear:before{content:"\f013"}
 64 | .fa-trash-o:before{content:"\f014"}
 65 | .fa-home:before{content:"\f015"}
 66 | .fa-file-o:before{content:"\f016"}
 67 | .fa-clock-o:before{content:"\f017"}
 68 | .fa-road:before{content:"\f018"}
 69 | .fa-download:before{content:"\f019"}
 70 | .fa-arrow-circle-o-down:before{content:"\f01a"}
 71 | .fa-arrow-circle-o-up:before{content:"\f01b"}
 72 | .fa-inbox:before{content:"\f01c"}
 73 | .fa-play-circle-o:before{content:"\f01d"}
 74 | .fa-repeat:before,.fa-rotate-right:before{content:"\f01e"}
 75 | .fa-refresh:before{content:"\f021"}
 76 | .fa-list-alt:before{content:"\f022"}
 77 | .fa-lock:before{content:"\f023"}
 78 | .fa-flag:before{content:"\f024"}
 79 | .fa-headphones:before{content:"\f025"}
 80 | .fa-volume-off:before{content:"\f026"}
 81 | .fa-volume-down:before{content:"\f027"}
 82 | .fa-volume-up:before{content:"\f028"}
 83 | .fa-qrcode:before{content:"\f029"}
 84 | .fa-barcode:before{content:"\f02a"}
 85 | .fa-tag:before{content:"\f02b"}
 86 | .fa-tags:before{content:"\f02c"}
 87 | .fa-book:before{content:"\f02d"}
 88 | .fa-bookmark:before{content:"\f02e"}
 89 | .fa-print:before{content:"\f02f"}
 90 | .fa-camera:before{content:"\f030"}
 91 | .fa-font:before{content:"\f031"}
 92 | .fa-bold:before{content:"\f032"}
 93 | .fa-italic:before{content:"\f033"}
 94 | .fa-text-height:before{content:"\f034"}
 95 | .fa-text-width:before{content:"\f035"}
 96 | .fa-align-left:before{content:"\f036"}
 97 | .fa-align-center:before{content:"\f037"}
 98 | .fa-align-right:before{content:"\f038"}
 99 | .fa-align-justify:before{content:"\f039"}
100 | .fa-list:before{content:"\f03a"}
101 | .fa-dedent:before,.fa-outdent:before{content:"\f03b"}
102 | .fa-indent:before{content:"\f03c"}
103 | .fa-video-camera:before{content:"\f03d"}
104 | .fa-image:before,.fa-photo:before,.fa-picture-o:before{content:"\f03e"}
105 | .fa-pencil:before{content:"\f040"}
106 | .fa-map-marker:before{content:"\f041"}
107 | .fa-adjust:before{content:"\f042"}
108 | .fa-tint:before{content:"\f043"}
109 | .fa-edit:before,.fa-pencil-square-o:before{content:"\f044"}
110 | .fa-share-square-o:before{content:"\f045"}
111 | .fa-check-square-o:before{content:"\f046"}
112 | .fa-arrows:before{content:"\f047"}
113 | .fa-step-backward:before{content:"\f048"}
114 | .fa-fast-backward:before{content:"\f049"}
115 | .fa-backward:before{content:"\f04a"}
116 | .fa-play:before{content:"\f04b"}
117 | .fa-pause:before{content:"\f04c"}
118 | .fa-stop:before{content:"\f04d"}
119 | .fa-forward:before{content:"\f04e"}
120 | .fa-fast-forward:before{content:"\f050"}
121 | .fa-step-forward:before{content:"\f051"}
122 | .fa-eject:before{content:"\f052"}
123 | .fa-chevron-left:before{content:"\f053"}
124 | .fa-chevron-right:before{content:"\f054"}
125 | .fa-plus-circle:before{content:"\f055"}
126 | .fa-minus-circle:before{content:"\f056"}
127 | .fa-times-circle:before{content:"\f057"}
128 | .fa-check-circle:before{content:"\f058"}
129 | .fa-question-circle:before{content:"\f059"}
130 | .fa-info-circle:before{content:"\f05a"}
131 | .fa-crosshairs:before{content:"\f05b"}
132 | .fa-times-circle-o:before{content:"\f05c"}
133 | .fa-check-circle-o:before{content:"\f05d"}
134 | .fa-ban:before{content:"\f05e"}
135 | .fa-arrow-left:before{content:"\f060"}
136 | .fa-arrow-right:before{content:"\f061"}
137 | .fa-arrow-up:before{content:"\f062"}
138 | .fa-arrow-down:before{content:"\f063"}
139 | .fa-mail-forward:before,.fa-share:before{content:"\f064"}
140 | .fa-expand:before{content:"\f065"}
141 | .fa-compress:before{content:"\f066"}
142 | .fa-plus:before{content:"\f067"}
143 | .fa-minus:before{content:"\f068"}
144 | .fa-asterisk:before{content:"\f069"}
145 | .fa-exclamation-circle:before{content:"\f06a"}
146 | .fa-gift:before{content:"\f06b"}
147 | .fa-leaf:before{content:"\f06c"}
148 | .fa-fire:before{content:"\f06d"}
149 | .fa-eye:before{content:"\f06e"}
150 | .fa-eye-slash:before{content:"\f070"}
151 | .fa-exclamation-triangle:before,.fa-warning:before{content:"\f071"}
152 | .fa-plane:before{content:"\f072"}
153 | .fa-calendar:before{content:"\f073"}
154 | .fa-random:before{content:"\f074"}
155 | .fa-comment:before{content:"\f075"}
156 | .fa-magnet:before{content:"\f076"}
157 | .fa-chevron-up:before{content:"\f077"}
158 | .fa-chevron-down:before{content:"\f078"}
159 | .fa-retweet:before{content:"\f079"}
160 | .fa-shopping-cart:before{content:"\f07a"}
161 | .fa-folder:before{content:"\f07b"}
162 | .fa-folder-open:before{content:"\f07c"}
163 | .fa-arrows-v:before{content:"\f07d"}
164 | .fa-arrows-h:before{content:"\f07e"}
165 | .fa-bar-chart-o:before,.fa-bar-chart:before{content:"\f080"}
166 | .fa-twitter-square:before{content:"\f081"}
167 | .fa-facebook-square:before{content:"\f082"}
168 | .fa-camera-retro:before{content:"\f083"}
169 | .fa-key:before{content:"\f084"}
170 | .fa-cogs:before,.fa-gears:before{content:"\f085"}
171 | .fa-comments:before{content:"\f086"}
172 | .fa-thumbs-o-up:before{content:"\f087"}
173 | .fa-thumbs-o-down:before{content:"\f088"}
174 | .fa-star-half:before{content:"\f089"}
175 | .fa-heart-o:before{content:"\f08a"}
176 | .fa-sign-out:before{content:"\f08b"}
177 | .fa-linkedin-square:before{content:"\f08c"}
178 | .fa-thumb-tack:before{content:"\f08d"}
179 | .fa-external-link:before{content:"\f08e"}
180 | .fa-sign-in:before{content:"\f090"}
181 | .fa-trophy:before{content:"\f091"}
182 | .fa-github-square:before{content:"\f092"}
183 | .fa-upload:before{content:"\f093"}
184 | .fa-lemon-o:before{content:"\f094"}
185 | .fa-phone:before{content:"\f095"}
186 | .fa-square-o:before{content:"\f096"}
187 | .fa-bookmark-o:before{content:"\f097"}
188 | .fa-phone-square:before{content:"\f098"}
189 | .fa-twitter:before{content:"\f099"}
190 | .fa-facebook-f:before,.fa-facebook:before{content:"\f09a"}
191 | .fa-github:before{content:"\f09b"}
192 | .fa-unlock:before{content:"\f09c"}
193 | .fa-credit-card:before{content:"\f09d"}
194 | .fa-feed:before,.fa-rss:before{content:"\f09e"}
195 | .fa-hdd-o:before{content:"\f0a0"}
196 | .fa-bullhorn:before{content:"\f0a1"}
197 | .fa-bell:before{content:"\f0f3"}
198 | .fa-certificate:before{content:"\f0a3"}
199 | .fa-hand-o-right:before{content:"\f0a4"}
200 | .fa-hand-o-left:before{content:"\f0a5"}
201 | .fa-hand-o-up:before{content:"\f0a6"}
202 | .fa-hand-o-down:before{content:"\f0a7"}
203 | .fa-arrow-circle-left:before{content:"\f0a8"}
204 | .fa-arrow-circle-right:before{content:"\f0a9"}
205 | .fa-arrow-circle-up:before{content:"\f0aa"}
206 | .fa-arrow-circle-down:before{content:"\f0ab"}
207 | .fa-globe:before{content:"\f0ac"}
208 | .fa-wrench:before{content:"\f0ad"}
209 | .fa-tasks:before{content:"\f0ae"}
210 | .fa-filter:before{content:"\f0b0"}
211 | .fa-briefcase:before{content:"\f0b1"}
212 | .fa-arrows-alt:before{content:"\f0b2"}
213 | .fa-group:before,.fa-users:before{content:"\f0c0"}
214 | .fa-chain:before,.fa-link:before{content:"\f0c1"}
215 | .fa-cloud:before{content:"\f0c2"}
216 | .fa-flask:before{content:"\f0c3"}
217 | .fa-cut:before,.fa-scissors:before{content:"\f0c4"}
218 | .fa-copy:before,.fa-files-o:before{content:"\f0c5"}
219 | .fa-paperclip:before{content:"\f0c6"}
220 | .fa-floppy-o:before,.fa-save:before{content:"\f0c7"}
221 | .fa-square:before{content:"\f0c8"}
222 | .fa-bars:before,.fa-navicon:before,.fa-reorder:before{content:"\f0c9"}
223 | .fa-list-ul:before{content:"\f0ca"}
224 | .fa-list-ol:before{content:"\f0cb"}
225 | .fa-strikethrough:before{content:"\f0cc"}
226 | .fa-underline:before{content:"\f0cd"}
227 | .fa-table:before{content:"\f0ce"}
228 | .fa-magic:before{content:"\f0d0"}
229 | .fa-truck:before{content:"\f0d1"}
230 | .fa-pinterest:before{content:"\f0d2"}
231 | .fa-pinterest-square:before{content:"\f0d3"}
232 | .fa-google-plus-square:before{content:"\f0d4"}
233 | .fa-google-plus:before{content:"\f0d5"}
234 | .fa-money:before{content:"\f0d6"}
235 | .fa-caret-down:before{content:"\f0d7"}
236 | .fa-caret-up:before{content:"\f0d8"}
237 | .fa-caret-left:before{content:"\f0d9"}
238 | .fa-caret-right:before{content:"\f0da"}
239 | .fa-columns:before{content:"\f0db"}
240 | .fa-sort:before,.fa-unsorted:before{content:"\f0dc"}
241 | .fa-sort-desc:before,.fa-sort-down:before{content:"\f0dd"}
242 | .fa-sort-asc:before,.fa-sort-up:before{content:"\f0de"}
243 | .fa-envelope:before{content:"\f0e0"}
244 | .fa-linkedin:before{content:"\f0e1"}
245 | .fa-rotate-left:before,.fa-undo:before{content:"\f0e2"}
246 | .fa-gavel:before,.fa-legal:before{content:"\f0e3"}
247 | .fa-dashboard:before,.fa-tachometer:before{content:"\f0e4"}
248 | .fa-comment-o:before{content:"\f0e5"}
249 | .fa-comments-o:before{content:"\f0e6"}
250 | .fa-bolt:before,.fa-flash:before{content:"\f0e7"}
251 | .fa-sitemap:before{content:"\f0e8"}
252 | .fa-umbrella:before{content:"\f0e9"}
253 | .fa-clipboard:before,.fa-paste:before{content:"\f0ea"}
254 | .fa-lightbulb-o:before{content:"\f0eb"}
255 | .fa-exchange:before{content:"\f0ec"}
256 | .fa-cloud-download:before{content:"\f0ed"}
257 | .fa-cloud-upload:before{content:"\f0ee"}
258 | .fa-user-md:before{content:"\f0f0"}
259 | .fa-stethoscope:before{content:"\f0f1"}
260 | .fa-suitcase:before{content:"\f0f2"}
261 | .fa-bell-o:before{content:"\f0a2"}
262 | .fa-coffee:before{content:"\f0f4"}
263 | .fa-cutlery:before{content:"\f0f5"}
264 | .fa-file-text-o:before{content:"\f0f6"}
265 | .fa-building-o:before{content:"\f0f7"}
266 | .fa-hospital-o:before{content:"\f0f8"}
267 | .fa-ambulance:before{content:"\f0f9"}
268 | .fa-medkit:before{content:"\f0fa"}
269 | .fa-fighter-jet:before{content:"\f0fb"}
270 | .fa-beer:before{content:"\f0fc"}
271 | .fa-h-square:before{content:"\f0fd"}
272 | .fa-plus-square:before{content:"\f0fe"}
273 | .fa-angle-double-left:before{content:"\f100"}
274 | .fa-angle-double-right:before{content:"\f101"}
275 | .fa-angle-double-up:before{content:"\f102"}
276 | .fa-angle-double-down:before{content:"\f103"}
277 | .fa-angle-left:before{content:"\f104"}
278 | .fa-angle-right:before{content:"\f105"}
279 | .fa-angle-up:before{content:"\f106"}
280 | .fa-angle-down:before{content:"\f107"}
281 | .fa-desktop:before{content:"\f108"}
282 | .fa-laptop:before{content:"\f109"}
283 | .fa-tablet:before{content:"\f10a"}
284 | .fa-mobile-phone:before,.fa-mobile:before{content:"\f10b"}
285 | .fa-circle-o:before{content:"\f10c"}
286 | .fa-quote-left:before{content:"\f10d"}
287 | .fa-quote-right:before{content:"\f10e"}
288 | .fa-spinner:before{content:"\f110"}
289 | .fa-circle:before{content:"\f111"}
290 | .fa-mail-reply:before,.fa-reply:before{content:"\f112"}
291 | .fa-github-alt:before{content:"\f113"}
292 | .fa-folder-o:before{content:"\f114"}
293 | .fa-folder-open-o:before{content:"\f115"}
294 | .fa-smile-o:before{content:"\f118"}
295 | .fa-frown-o:before{content:"\f119"}
296 | .fa-meh-o:before{content:"\f11a"}
297 | .fa-gamepad:before{content:"\f11b"}
298 | .fa-keyboard-o:before{content:"\f11c"}
299 | .fa-flag-o:before{content:"\f11d"}
300 | .fa-flag-checkered:before{content:"\f11e"}
301 | .fa-terminal:before{content:"\f120"}
302 | .fa-code:before{content:"\f121"}
303 | .fa-mail-reply-all:before,.fa-reply-all:before{content:"\f122"}
304 | .fa-star-half-empty:before,.fa-star-half-full:before,.fa-star-half-o:before{content:"\f123"}
305 | .fa-location-arrow:before{content:"\f124"}
306 | .fa-crop:before{content:"\f125"}
307 | .fa-code-fork:before{content:"\f126"}
308 | .fa-chain-broken:before,.fa-unlink:before{content:"\f127"}
309 | .fa-question:before{content:"\f128"}
310 | .fa-info:before{content:"\f129"}
311 | .fa-exclamation:before{content:"\f12a"}
312 | .fa-superscript:before{content:"\f12b"}
313 | .fa-subscript:before{content:"\f12c"}
314 | .fa-eraser:before{content:"\f12d"}
315 | .fa-puzzle-piece:before{content:"\f12e"}
316 | .fa-microphone:before{content:"\f130"}
317 | .fa-microphone-slash:before{content:"\f131"}
318 | .fa-shield:before{content:"\f132"}
319 | .fa-calendar-o:before{content:"\f133"}
320 | .fa-fire-extinguisher:before{content:"\f134"}
321 | .fa-rocket:before{content:"\f135"}
322 | .fa-maxcdn:before{content:"\f136"}
323 | .fa-chevron-circle-left:before{content:"\f137"}
324 | .fa-chevron-circle-right:before{content:"\f138"}
325 | .fa-chevron-circle-up:before{content:"\f139"}
326 | .fa-chevron-circle-down:before{content:"\f13a"}
327 | .fa-html5:before{content:"\f13b"}
328 | .fa-css3:before{content:"\f13c"}
329 | .fa-anchor:before{content:"\f13d"}
330 | .fa-unlock-alt:before{content:"\f13e"}
331 | .fa-bullseye:before{content:"\f140"}
332 | .fa-ellipsis-h:before{content:"\f141"}
333 | .fa-ellipsis-v:before{content:"\f142"}
334 | .fa-rss-square:before{content:"\f143"}
335 | .fa-play-circle:before{content:"\f144"}
336 | .fa-ticket:before{content:"\f145"}
337 | .fa-minus-square:before{content:"\f146"}
338 | .fa-minus-square-o:before{content:"\f147"}
339 | .fa-level-up:before{content:"\f148"}
340 | .fa-level-down:before{content:"\f149"}
341 | .fa-check-square:before{content:"\f14a"}
342 | .fa-pencil-square:before{content:"\f14b"}
343 | .fa-external-link-square:before{content:"\f14c"}
344 | .fa-share-square:before{content:"\f14d"}
345 | .fa-compass:before{content:"\f14e"}
346 | .fa-caret-square-o-down:before,.fa-toggle-down:before{content:"\f150"}
347 | .fa-caret-square-o-up:before,.fa-toggle-up:before{content:"\f151"}
348 | .fa-caret-square-o-right:before,.fa-toggle-right:before{content:"\f152"}
349 | .fa-eur:before,.fa-euro:before{content:"\f153"}
350 | .fa-gbp:before{content:"\f154"}
351 | .fa-dollar:before,.fa-usd:before{content:"\f155"}
352 | .fa-inr:before,.fa-rupee:before{content:"\f156"}
353 | .fa-cny:before,.fa-jpy:before,.fa-rmb:before,.fa-yen:before{content:"\f157"}
354 | .fa-rouble:before,.fa-rub:before,.fa-ruble:before{content:"\f158"}
355 | .fa-krw:before,.fa-won:before{content:"\f159"}
356 | .fa-bitcoin:before,.fa-btc:before{content:"\f15a"}
357 | .fa-file:before{content:"\f15b"}
358 | .fa-file-text:before{content:"\f15c"}
359 | .fa-sort-alpha-asc:before{content:"\f15d"}
360 | .fa-sort-alpha-desc:before{content:"\f15e"}
361 | .fa-sort-amount-asc:before{content:"\f160"}
362 | .fa-sort-amount-desc:before{content:"\f161"}
363 | .fa-sort-numeric-asc:before{content:"\f162"}
364 | .fa-sort-numeric-desc:before{content:"\f163"}
365 | .fa-thumbs-up:before{content:"\f164"}
366 | .fa-thumbs-down:before{content:"\f165"}
367 | .fa-youtube-square:before{content:"\f166"}
368 | .fa-youtube:before{content:"\f167"}
369 | .fa-xing:before{content:"\f168"}
370 | .fa-xing-square:before{content:"\f169"}
371 | .fa-youtube-play:before{content:"\f16a"}
372 | .fa-dropbox:before{content:"\f16b"}
373 | .fa-stack-overflow:before{content:"\f16c"}
374 | .fa-instagram:before{content:"\f16d"}
375 | .fa-flickr:before{content:"\f16e"}
376 | .fa-adn:before{content:"\f170"}
377 | .fa-bitbucket:before{content:"\f171"}
378 | .fa-bitbucket-square:before{content:"\f172"}
379 | .fa-tumblr:before{content:"\f173"}
380 | .fa-tumblr-square:before{content:"\f174"}
381 | .fa-long-arrow-down:before{content:"\f175"}
382 | .fa-long-arrow-up:before{content:"\f176"}
383 | .fa-long-arrow-left:before{content:"\f177"}
384 | .fa-long-arrow-right:before{content:"\f178"}
385 | .fa-apple:before{content:"\f179"}
386 | .fa-windows:before{content:"\f17a"}
387 | .fa-android:before{content:"\f17b"}
388 | .fa-linux:before{content:"\f17c"}
389 | .fa-dribbble:before{content:"\f17d"}
390 | .fa-skype:before{content:"\f17e"}
391 | .fa-foursquare:before{content:"\f180"}
392 | .fa-trello:before{content:"\f181"}
393 | .fa-female:before{content:"\f182"}
394 | .fa-male:before{content:"\f183"}
395 | .fa-gittip:before,.fa-gratipay:before{content:"\f184"}
396 | .fa-sun-o:before{content:"\f185"}
397 | .fa-moon-o:before{content:"\f186"}
398 | .fa-archive:before{content:"\f187"}
399 | .fa-bug:before{content:"\f188"}
400 | .fa-vk:before{content:"\f189"}
401 | .fa-weibo:before{content:"\f18a"}
402 | .fa-renren:before{content:"\f18b"}
403 | .fa-pagelines:before{content:"\f18c"}
404 | .fa-stack-exchange:before{content:"\f18d"}
405 | .fa-arrow-circle-o-right:before{content:"\f18e"}
406 | .fa-arrow-circle-o-left:before{content:"\f190"}
407 | .fa-caret-square-o-left:before,.fa-toggle-left:before{content:"\f191"}
408 | .fa-dot-circle-o:before{content:"\f192"}
409 | .fa-wheelchair:before{content:"\f193"}
410 | .fa-vimeo-square:before{content:"\f194"}
411 | .fa-try:before,.fa-turkish-lira:before{content:"\f195"}
412 | .fa-plus-square-o:before{content:"\f196"}
413 | .fa-space-shuttle:before{content:"\f197"}
414 | .fa-slack:before{content:"\f198"}
415 | .fa-envelope-square:before{content:"\f199"}
416 | .fa-wordpress:before{content:"\f19a"}
417 | .fa-openid:before{content:"\f19b"}
418 | .fa-bank:before,.fa-institution:before,.fa-university:before{content:"\f19c"}
419 | .fa-graduation-cap:before,.fa-mortar-board:before{content:"\f19d"}
420 | .fa-yahoo:before{content:"\f19e"}
421 | .fa-google:before{content:"\f1a0"}
422 | .fa-reddit:before{content:"\f1a1"}
423 | .fa-reddit-square:before{content:"\f1a2"}
424 | .fa-stumbleupon-circle:before{content:"\f1a3"}
425 | .fa-stumbleupon:before{content:"\f1a4"}
426 | .fa-delicious:before{content:"\f1a5"}
427 | .fa-digg:before{content:"\f1a6"}
428 | .fa-pied-piper-pp:before{content:"\f1a7"}
429 | .fa-pied-piper-alt:before{content:"\f1a8"}
430 | .fa-drupal:before{content:"\f1a9"}
431 | .fa-joomla:before{content:"\f1aa"}
432 | .fa-language:before{content:"\f1ab"}
433 | .fa-fax:before{content:"\f1ac"}
434 | .fa-building:before{content:"\f1ad"}
435 | .fa-child:before{content:"\f1ae"}
436 | .fa-paw:before{content:"\f1b0"}
437 | .fa-spoon:before{content:"\f1b1"}
438 | .fa-cube:before{content:"\f1b2"}
439 | .fa-cubes:before{content:"\f1b3"}
440 | .fa-behance:before{content:"\f1b4"}
441 | .fa-behance-square:before{content:"\f1b5"}
442 | .fa-steam:before{content:"\f1b6"}
443 | .fa-steam-square:before{content:"\f1b7"}
444 | .fa-recycle:before{content:"\f1b8"}
445 | .fa-automobile:before,.fa-car:before{content:"\f1b9"}
446 | .fa-cab:before,.fa-taxi:before{content:"\f1ba"}
447 | .fa-tree:before{content:"\f1bb"}
448 | .fa-spotify:before{content:"\f1bc"}
449 | .fa-deviantart:before{content:"\f1bd"}
450 | .fa-soundcloud:before{content:"\f1be"}
451 | .fa-database:before{content:"\f1c0"}
452 | .fa-file-pdf-o:before{content:"\f1c1"}
453 | .fa-file-word-o:before{content:"\f1c2"}
454 | .fa-file-excel-o:before{content:"\f1c3"}
455 | .fa-file-powerpoint-o:before{content:"\f1c4"}
456 | .fa-file-image-o:before,.fa-file-photo-o:before,.fa-file-picture-o:before{content:"\f1c5"}
457 | .fa-file-archive-o:before,.fa-file-zip-o:before{content:"\f1c6"}
458 | .fa-file-audio-o:before,.fa-file-sound-o:before{content:"\f1c7"}
459 | .fa-file-movie-o:before,.fa-file-video-o:before{content:"\f1c8"}
460 | .fa-file-code-o:before{content:"\f1c9"}
461 | .fa-vine:before{content:"\f1ca"}
462 | .fa-codepen:before{content:"\f1cb"}
463 | .fa-jsfiddle:before{content:"\f1cc"}
464 | .fa-life-bouy:before,.fa-life-buoy:before,.fa-life-ring:before,.fa-life-saver:before,.fa-support:before{content:"\f1cd"}
465 | .fa-circle-o-notch:before{content:"\f1ce"}
466 | .fa-ra:before,.fa-rebel:before,.fa-resistance:before{content:"\f1d0"}
467 | .fa-empire:before,.fa-ge:before{content:"\f1d1"}
468 | .fa-git-square:before{content:"\f1d2"}
469 | .fa-git:before{content:"\f1d3"}
470 | .fa-hacker-news:before,.fa-y-combinator-square:before,.fa-yc-square:before{content:"\f1d4"}
471 | .fa-tencent-weibo:before{content:"\f1d5"}
472 | .fa-qq:before{content:"\f1d6"}
473 | .fa-wechat:before,.fa-weixin:before{content:"\f1d7"}
474 | .fa-paper-plane:before,.fa-send:before{content:"\f1d8"}
475 | .fa-paper-plane-o:before,.fa-send-o:before{content:"\f1d9"}
476 | .fa-history:before{content:"\f1da"}
477 | .fa-circle-thin:before{content:"\f1db"}
478 | .fa-header:before{content:"\f1dc"}
479 | .fa-paragraph:before{content:"\f1dd"}
480 | .fa-sliders:before{content:"\f1de"}
481 | .fa-share-alt:before{content:"\f1e0"}
482 | .fa-share-alt-square:before{content:"\f1e1"}
483 | .fa-bomb:before{content:"\f1e2"}
484 | .fa-futbol-o:before,.fa-soccer-ball-o:before{content:"\f1e3"}
485 | .fa-tty:before{content:"\f1e4"}
486 | .fa-binoculars:before{content:"\f1e5"}
487 | .fa-plug:before{content:"\f1e6"}
488 | .fa-slideshare:before{content:"\f1e7"}
489 | .fa-twitch:before{content:"\f1e8"}
490 | .fa-yelp:before{content:"\f1e9"}
491 | .fa-newspaper-o:before{content:"\f1ea"}
492 | .fa-wifi:before{content:"\f1eb"}
493 | .fa-calculator:before{content:"\f1ec"}
494 | .fa-paypal:before{content:"\f1ed"}
495 | .fa-google-wallet:before{content:"\f1ee"}
496 | .fa-cc-visa:before{content:"\f1f0"}
497 | .fa-cc-mastercard:before{content:"\f1f1"}
498 | .fa-cc-discover:before{content:"\f1f2"}
499 | .fa-cc-amex:before{content:"\f1f3"}
500 | .fa-cc-paypal:before{content:"\f1f4"}
501 | .fa-cc-stripe:before{content:"\f1f5"}
502 | .fa-bell-slash:before{content:"\f1f6"}
503 | .fa-bell-slash-o:before{content:"\f1f7"}
504 | .fa-trash:before{content:"\f1f8"}
505 | .fa-copyright:before{content:"\f1f9"}
506 | .fa-at:before{content:"\f1fa"}
507 | .fa-eyedropper:before{content:"\f1fb"}
508 | .fa-paint-brush:before{content:"\f1fc"}
509 | .fa-birthday-cake:before{content:"\f1fd"}
510 | .fa-area-chart:before{content:"\f1fe"}
511 | .fa-pie-chart:before{content:"\f200"}
512 | .fa-line-chart:before{content:"\f201"}
513 | .fa-lastfm:before{content:"\f202"}
514 | .fa-lastfm-square:before{content:"\f203"}
515 | .fa-toggle-off:before{content:"\f204"}
516 | .fa-toggle-on:before{content:"\f205"}
517 | .fa-bicycle:before{content:"\f206"}
518 | .fa-bus:before{content:"\f207"}
519 | .fa-ioxhost:before{content:"\f208"}
520 | .fa-angellist:before{content:"\f209"}
521 | .fa-cc:before{content:"\f20a"}
522 | .fa-ils:before,.fa-shekel:before,.fa-sheqel:before{content:"\f20b"}
523 | .fa-meanpath:before{content:"\f20c"}
524 | .fa-buysellads:before{content:"\f20d"}
525 | .fa-connectdevelop:before{content:"\f20e"}
526 | .fa-dashcube:before{content:"\f210"}
527 | .fa-forumbee:before{content:"\f211"}
528 | .fa-leanpub:before{content:"\f212"}
529 | .fa-sellsy:before{content:"\f213"}
530 | .fa-shirtsinbulk:before{content:"\f214"}
531 | .fa-simplybuilt:before{content:"\f215"}
532 | .fa-skyatlas:before{content:"\f216"}
533 | .fa-cart-plus:before{content:"\f217"}
534 | .fa-cart-arrow-down:before{content:"\f218"}
535 | .fa-diamond:before{content:"\f219"}
536 | .fa-ship:before{content:"\f21a"}
537 | .fa-user-secret:before{content:"\f21b"}
538 | .fa-motorcycle:before{content:"\f21c"}
539 | .fa-street-view:before{content:"\f21d"}
540 | .fa-heartbeat:before{content:"\f21e"}
541 | .fa-venus:before{content:"\f221"}
542 | .fa-mars:before{content:"\f222"}
543 | .fa-mercury:before{content:"\f223"}
544 | .fa-intersex:before,.fa-transgender:before{content:"\f224"}
545 | .fa-transgender-alt:before{content:"\f225"}
546 | .fa-venus-double:before{content:"\f226"}
547 | .fa-mars-double:before{content:"\f227"}
548 | .fa-venus-mars:before{content:"\f228"}
549 | .fa-mars-stroke:before{content:"\f229"}
550 | .fa-mars-stroke-v:before{content:"\f22a"}
551 | .fa-mars-stroke-h:before{content:"\f22b"}
552 | .fa-neuter:before{content:"\f22c"}
553 | .fa-genderless:before{content:"\f22d"}
554 | .fa-facebook-official:before{content:"\f230"}
555 | .fa-pinterest-p:before{content:"\f231"}
556 | .fa-whatsapp:before{content:"\f232"}
557 | .fa-server:before{content:"\f233"}
558 | .fa-user-plus:before{content:"\f234"}
559 | .fa-user-times:before{content:"\f235"}
560 | .fa-bed:before,.fa-hotel:before{content:"\f236"}
561 | .fa-viacoin:before{content:"\f237"}
562 | .fa-train:before{content:"\f238"}
563 | .fa-subway:before{content:"\f239"}
564 | .fa-medium:before{content:"\f23a"}
565 | .fa-y-combinator:before,.fa-yc:before{content:"\f23b"}
566 | .fa-optin-monster:before{content:"\f23c"}
567 | .fa-opencart:before{content:"\f23d"}
568 | .fa-expeditedssl:before{content:"\f23e"}
569 | .fa-battery-4:before,.fa-battery-full:before{content:"\f240"}
570 | .fa-battery-3:before,.fa-battery-three-quarters:before{content:"\f241"}
571 | .fa-battery-2:before,.fa-battery-half:before{content:"\f242"}
572 | .fa-battery-1:before,.fa-battery-quarter:before{content:"\f243"}
573 | .fa-battery-0:before,.fa-battery-empty:before{content:"\f244"}
574 | .fa-mouse-pointer:before{content:"\f245"}
575 | .fa-i-cursor:before{content:"\f246"}
576 | .fa-object-group:before{content:"\f247"}
577 | .fa-object-ungroup:before{content:"\f248"}
578 | .fa-sticky-note:before{content:"\f249"}
579 | .fa-sticky-note-o:before{content:"\f24a"}
580 | .fa-cc-jcb:before{content:"\f24b"}
581 | .fa-cc-diners-club:before{content:"\f24c"}
582 | .fa-clone:before{content:"\f24d"}
583 | .fa-balance-scale:before{content:"\f24e"}
584 | .fa-hourglass-o:before{content:"\f250"}
585 | .fa-hourglass-1:before,.fa-hourglass-start:before{content:"\f251"}
586 | .fa-hourglass-2:before,.fa-hourglass-half:before{content:"\f252"}
587 | .fa-hourglass-3:before,.fa-hourglass-end:before{content:"\f253"}
588 | .fa-hourglass:before{content:"\f254"}
589 | .fa-hand-grab-o:before,.fa-hand-rock-o:before{content:"\f255"}
590 | .fa-hand-paper-o:before,.fa-hand-stop-o:before{content:"\f256"}
591 | .fa-hand-scissors-o:before{content:"\f257"}
592 | .fa-hand-lizard-o:before{content:"\f258"}
593 | .fa-hand-spock-o:before{content:"\f259"}
594 | .fa-hand-pointer-o:before{content:"\f25a"}
595 | .fa-hand-peace-o:before{content:"\f25b"}
596 | .fa-trademark:before{content:"\f25c"}
597 | .fa-registered:before{content:"\f25d"}
598 | .fa-creative-commons:before{content:"\f25e"}
599 | .fa-gg:before{content:"\f260"}
600 | .fa-gg-circle:before{content:"\f261"}
601 | .fa-tripadvisor:before{content:"\f262"}
602 | .fa-odnoklassniki:before{content:"\f263"}
603 | .fa-odnoklassniki-square:before{content:"\f264"}
604 | .fa-get-pocket:before{content:"\f265"}
605 | .fa-wikipedia-w:before{content:"\f266"}
606 | .fa-safari:before{content:"\f267"}
607 | .fa-chrome:before{content:"\f268"}
608 | .fa-firefox:before{content:"\f269"}
609 | .fa-opera:before{content:"\f26a"}
610 | .fa-internet-explorer:before{content:"\f26b"}
611 | .fa-television:before,.fa-tv:before{content:"\f26c"}
612 | .fa-contao:before{content:"\f26d"}
613 | .fa-500px:before{content:"\f26e"}
614 | .fa-amazon:before{content:"\f270"}
615 | .fa-calendar-plus-o:before{content:"\f271"}
616 | .fa-calendar-minus-o:before{content:"\f272"}
617 | .fa-calendar-times-o:before{content:"\f273"}
618 | .fa-calendar-check-o:before{content:"\f274"}
619 | .fa-industry:before{content:"\f275"}
620 | .fa-map-pin:before{content:"\f276"}
621 | .fa-map-signs:before{content:"\f277"}
622 | .fa-map-o:before{content:"\f278"}
623 | .fa-map:before{content:"\f279"}
624 | .fa-commenting:before{content:"\f27a"}
625 | .fa-commenting-o:before{content:"\f27b"}
626 | .fa-houzz:before{content:"\f27c"}
627 | .fa-vimeo:before{content:"\f27d"}
628 | .fa-black-tie:before{content:"\f27e"}
629 | .fa-fonticons:before{content:"\f280"}
630 | .fa-reddit-alien:before{content:"\f281"}
631 | .fa-edge:before{content:"\f282"}
632 | .fa-credit-card-alt:before{content:"\f283"}
633 | .fa-codiepie:before{content:"\f284"}
634 | .fa-modx:before{content:"\f285"}
635 | .fa-fort-awesome:before{content:"\f286"}
636 | .fa-usb:before{content:"\f287"}
637 | .fa-product-hunt:before{content:"\f288"}
638 | .fa-mixcloud:before{content:"\f289"}
639 | .fa-scribd:before{content:"\f28a"}
640 | .fa-pause-circle:before{content:"\f28b"}
641 | .fa-pause-circle-o:before{content:"\f28c"}
642 | .fa-stop-circle:before{content:"\f28d"}
643 | .fa-stop-circle-o:before{content:"\f28e"}
644 | .fa-shopping-bag:before{content:"\f290"}
645 | .fa-shopping-basket:before{content:"\f291"}
646 | .fa-hashtag:before{content:"\f292"}
647 | .fa-bluetooth:before{content:"\f293"}
648 | .fa-bluetooth-b:before{content:"\f294"}
649 | .fa-percent:before{content:"\f295"}
650 | .fa-gitlab:before{content:"\f296"}
651 | .fa-wpbeginner:before{content:"\f297"}
652 | .fa-wpforms:before{content:"\f298"}
653 | .fa-envira:before{content:"\f299"}
654 | .fa-universal-access:before{content:"\f29a"}
655 | .fa-wheelchair-alt:before{content:"\f29b"}
656 | .fa-question-circle-o:before{content:"\f29c"}
657 | .fa-blind:before{content:"\f29d"}
658 | .fa-audio-description:before{content:"\f29e"}
659 | .fa-volume-control-phone:before{content:"\f2a0"}
660 | .fa-braille:before{content:"\f2a1"}
661 | .fa-assistive-listening-systems:before{content:"\f2a2"}
662 | .fa-american-sign-language-interpreting:before,.fa-asl-interpreting:before{content:"\f2a3"}
663 | .fa-deaf:before,.fa-deafness:before,.fa-hard-of-hearing:before{content:"\f2a4"}
664 | .fa-glide:before{content:"\f2a5"}
665 | .fa-glide-g:before{content:"\f2a6"}
666 | .fa-sign-language:before,.fa-signing:before{content:"\f2a7"}
667 | .fa-low-vision:before{content:"\f2a8"}
668 | .fa-viadeo:before{content:"\f2a9"}
669 | .fa-viadeo-square:before{content:"\f2aa"}
670 | .fa-snapchat:before{content:"\f2ab"}
671 | .fa-snapchat-ghost:before{content:"\f2ac"}
672 | .fa-snapchat-square:before{content:"\f2ad"}
673 | .fa-pied-piper:before{content:"\f2ae"}
674 | .fa-first-order:before{content:"\f2b0"}
675 | .fa-yoast:before{content:"\f2b1"}
676 | .fa-themeisle:before{content:"\f2b2"}
677 | .fa-google-plus-circle:before,.fa-google-plus-official:before{content:"\f2b3"}
678 | .fa-fa:before,.fa-font-awesome:before{content:"\f2b4"}
679 | .sr-only{position:absolute;width:1px;height:1px;padding:0;margin:-1px;overflow:hidden;clip:rect(0,0,0,0);border:0}
680 | .sr-only-focusable:active,.sr-only-focusable:focus{position:static;width:auto;height:auto;margin:0;overflow:visible;clip:auto}
681 | /*!
682 |  * Preboot v2
683 |  *
684 |  * Open sourced under MIT license by @mdo.
685 |  * Some variables and mixins from Bootstrap (Apache 2 license).
686 |  */
687 | .book-langs-index{width:100%;height:100%;padding:40px 0;margin:0;overflow:auto}
688 | @media (max-width:600px){.book-langs-index{padding:0}}
689 | .book-langs-index .inner{max-width:600px;width:100%;margin:0 auto;padding:30px;background:#fff;border-radius:3px}
690 | .book-langs-index .inner h3{margin:0}
691 | .book-langs-index .inner .languages{list-style:none;padding:20px 30px;margin-top:20px;border-top:1px solid #eee}
692 | .book-langs-index .inner .languages:after,.book-langs-index .inner .languages:before{content:" ";display:table;line-height:0}
693 | .book-langs-index .inner .languages:after{clear:both}
694 | .book-langs-index .inner .languages li{width:50%;float:left;padding:10px 5px;font-size:16px}
695 | @media (max-width:600px){.book-langs-index .inner .languages li{width:100%;max-width:100%}}.book-header{font-family:"Helvetica Neue",Helvetica,Arial,sans-serif;overflow:visible;height:50px;padding:0 8px;z-index:2;font-size:.85em;color:#7e888b;background:0 0}.book-header .btn{display:block;height:50px;padding:0 15px;border-bottom:none;color:#ccc;text-transform:uppercase;line-height:50px;-webkit-box-shadow:none!important;box-shadow:none!important;position:relative;font-size:14px}.book-header .btn:hover{position:relative;text-decoration:none;color:#444;background:0 0}.book-header .btn:focus{outline:0}.book-header h1{margin:0;font-size:20px;font-weight:200;text-align:center;line-height:50px;opacity:0;-webkit-transition:opacity ease .4s;-moz-transition:opacity ease .4s;-o-transition:opacity ease .4s;transition:opacity ease .4s;padding-left:200px;padding-right:200px;-webkit-transition:opacity .2s ease;-moz-transition:opacity .2s ease;-o-transition:opacity .2s ease;transition:opacity .2s ease;overflow:hidden;text-overflow:ellipsis;white-space:nowrap}.book-header h1 a,.book-header h1 a:hover{color:inherit;text-decoration:none}@media (max-width:1000px){.book-header h1{display:none}}.book-header h1 i{display:none}.book-header:hover h1{opacity:1}.book.is-loading .book-header h1 i{display:inline-block}.book.is-loading .book-header h1 a{display:none}.dropdown{position:relative}.dropdown-menu{position:absolute;top:100%;left:0;z-index:100;display:none;float:left;min-width:160px;padding:0;margin:2px 0 0;list-style:none;font-size:14px;background-color:#fafafa;border:1px solid rgba(0,0,0,.07);border-radius:1px;-webkit-box-shadow:0 6px 12px rgba(0,0,0,.175);box-shadow:0 6px 12px rgba(0,0,0,.175);background-clip:padding-box}.dropdown-menu.open{display:block}.dropdown-menu.dropdown-left{left:auto;right:4%}.dropdown-menu.dropdown-left .dropdown-caret{right:14px;left:auto}.dropdown-menu .dropdown-caret{position:absolute;top:-8px;left:14px;width:18px;height:10px;float:left;overflow:hidden}.dropdown-menu .dropdown-caret .caret-outer{position:absolute;border-left:9px solid transparent;border-right:9px solid transparent;border-bottom:9px solid rgba(0,0,0,.1);height:auto;left:0;top:0;width:auto;display:inline-block;margin-left:-1px}.dropdown-menu .dropdown-caret .caret-inner{position:absolute;display:inline-block;margin-top:-1px;top:0;top:1px;border-left:9px solid transparent;border-right:9px solid transparent;border-bottom:9px solid #fafafa}.dropdown-menu .buttons{border-bottom:1px solid rgba(0,0,0,.07)}.dropdown-menu .buttons:after,.dropdown-menu .buttons:before{content:" ";display:table;line-height:0}.dropdown-menu .buttons:after{clear:both}.dropdown-menu .buttons:last-child{border-bottom:none}.dropdown-menu .buttons .button{border:0;background-color:transparent;color:#a6a6a6;width:100%;text-align:center;float:left;line-height:1.42857143;padding:8px 4px}.dropdown-menu .buttons .button:hover{color:#444}.dropdown-menu .buttons .button:focus,.dropdown-menu .buttons .button:hover{outline:0}.dropdown-menu .buttons .button.size-2{width:50%}.dropdown-menu .buttons .button.size-3{width:33%}
696 | .book-summary{font-family:"Helvetica Neue",Helvetica,Arial,sans-serif;position:absolute;top:0;left:-300px;bottom:0;z-index:1;overflow-y:auto;width:300px;color:#364149;background:#fafafa;border-right:1px solid rgba(0,0,0,.07);-webkit-transition:left 250ms ease;-moz-transition:left 250ms ease;-o-transition:left 250ms ease;transition:left 250ms ease}
697 | .book-summary nav.summary h1{display:none;}
698 | .book-summary nav.summary ul{list-style:none;margin:0;padding:0;-webkit-transition:top .5s ease;-moz-transition:top .5s ease;-o-transition:top .5s ease;transition:top .5s ease}
699 | .book-summary nav.summary ul li{list-style:none}
700 | .book-summary nav.summary ul li.header{padding:10px 15px;padding-top:20px;text-transform:uppercase;color:#939da3}
701 | .book-summary nav.summary ul li.divider{height:1px;margin:7px 0;overflow:hidden;background:rgba(0,0,0,.07)}
702 | .book-summary nav.summary ul li i.fa-check{display:none;position:absolute;right:9px;top:16px;font-size:9px;color:#3c3}
703 | .book-summary nav.summary ul li.done>a{color:#364149;font-weight:400}
704 | .book-summary nav.summary ul li.done>a i{display:inline}
705 | .book-summary nav.summary ul li a,.book-summary nav.summary ul li span{display:block;padding:10px 15px;border-bottom:none;color:#364149;background:0 0;text-overflow:ellipsis;overflow:hidden;white-space:nowrap;position:relative}
706 | .book-summary nav.summary ul li a:hover{text-decoration:underline}
707 | .book-summary nav.summary ul li a:focus{outline:0}
708 | .book-summary nav.summary ul li.active>a{color:#008cff;background:0 0;text-decoration:none}
709 | .book-summary nav.summary ul li ul{padding-left:20px}
710 | @media (max-width:600px){.book-summary{width:calc(100% - 60px);bottom:0;left:-100%}
711 | }
712 | .book.with-summary .book-summary{left:0}
713 | .book.without-animation .book-summary{-webkit-transition:none!important;-moz-transition:none!important;-o-transition:none!important;transition:none!important}
714 | .book{position:relative;width:100%;height:100%}
715 | @media (min-width:600px){.book.with-summary .book-body{left:300px}
716 | }
717 | @media (max-width:600px){.book.with-summary{overflow:hidden}
718 | .book.with-summary .book-body{-webkit-transform:translate(calc(100% - 60px),0);-moz-transform:translate(calc(100% - 60px),0);-ms-transform:translate(calc(100% - 60px),0);-o-transform:translate(calc(100% - 60px),0);transform:translate(calc(100% - 60px),0)}
719 | }
720 | .book.without-animation .book-body{-webkit-transition:none!important;-moz-transition:none!important;-o-transition:none!important;transition:none!important}
721 | .book-body{position:absolute;top:0;right:0;left:0;bottom:0;overflow-y:auto;color:#000;background:#fff;-webkit-transition:left 250ms ease;-moz-transition:left 250ms ease;-o-transition:left 250ms ease;transition:left 250ms ease}
722 | .book-body .body-inner{position:absolute;top:0;right:0;left:0;bottom:0;overflow-y:auto}
723 | @media (max-width:1240px){.book-body{-webkit-transition:-webkit-transform 250ms ease;-moz-transition:-moz-transform 250ms ease;-o-transition:-o-transform 250ms ease;transition:transform 250ms ease;padding-bottom:20px}
724 | .book-body .body-inner{position:static;min-height:calc(100% - 50px)}
725 | }
726 | .page-wrapper{position:relative;outline:0}
727 | .page-inner{position:relative;max-width:800px;margin:0 auto;padding:20px 15px 40px 15px}
728 | .page-inner .btn-group .btn{border-radius:0;background:#eee;border:0}
729 | .buttons:after,.buttons:before{content:" ";display:table;line-height:0}
730 | .buttons:after{clear:both}
731 | .button{border:0;background-color:transparent;background:#eee;color:#666;width:100%;text-align:center;float:left;line-height:1.42857143;padding:8px 4px}
732 | .button:hover{color:#444}
733 | .button:focus,.button:hover{outline:0}
734 | .button.size-2{width:50%}
735 | .button.size-3{width:33%}
736 | .markdown-section{display:block;word-wrap:break-word;overflow:hidden;color:#333;line-height:1.7;text-size-adjust:100%;-ms-text-size-adjust:100%;-webkit-text-size-adjust:100%;-moz-text-size-adjust:100%}
737 | .markdown-section *{box-sizing:border-box;-webkit-box-sizing:border-box;font-size:inherit}
738 | .markdown-section>:first-child{margin-top:0!important}
739 | .markdown-section>:last-child{margin-bottom:0!important}
740 | .markdown-section blockquote,.markdown-section code,.markdown-section figure,.markdown-section img,.markdown-section pre,.markdown-section table,.markdown-section tr{page-break-inside:avoid}
741 | .markdown-section h2,.markdown-section h3,.markdown-section h4,.markdown-section h5,.markdown-section p{orphans:3;widows:3}
742 | .markdown-section h1,.markdown-section h2,.markdown-section h3,.markdown-section h4,.markdown-section h5{page-break-after:avoid}
743 | .markdown-section b,.markdown-section strong{font-weight:700}
744 | .markdown-section em{font-style:italic}
745 | .markdown-section blockquote,.markdown-section dl,.markdown-section ol,.markdown-section p,.markdown-section table,.markdown-section ul{margin-top:0;margin-bottom:.85em}
746 | .markdown-section a{color:#4183c4;text-decoration:none;background:0 0}
747 | .markdown-section a:active,.markdown-section a:focus,.markdown-section a:hover{outline:0;text-decoration:underline}
748 | .markdown-section img{border:0;max-width:100%}
749 | .markdown-section hr{height:4px;padding:0;margin:1.7em 0;overflow:hidden;background-color:#e7e7e7;border:none}
750 | .markdown-section hr:after,.markdown-section hr:before{display:table;content:" "}
751 | .markdown-section hr:after{clear:both}
752 | .markdown-section h1,.markdown-section h2,.markdown-section h3,.markdown-section h4,.markdown-section h5,.markdown-section h6{margin-top:1.275em;margin-bottom:.85em;font-weight:700}
753 | .markdown-section h1{font-size:2em}
754 | .markdown-section h2{font-size:1.75em}
755 | .markdown-section h3{font-size:1.5em}
756 | .markdown-section h4{font-size:1.25em}
757 | .markdown-section h5{font-size:1em}
758 | .markdown-section h6{font-size:1em;color:#777}
759 | .markdown-section code,.markdown-section pre{font-family:Consolas,"Liberation Mono",Menlo,Courier,monospace;direction:ltr;margin:0;padding:0;border:none;color:inherit}
760 | .markdown-section pre{overflow:auto;word-wrap:normal;margin:0;padding:.85em 1em;margin-bottom:1.275em;background:#f7f7f7}
761 | .markdown-section pre>code{display:inline;max-width:initial;padding:0;margin:0;overflow:initial;line-height:inherit;font-size:.85em;white-space:pre;background:0 0}
762 | .markdown-section pre>code:after,.markdown-section pre>code:before{content:normal}
763 | .markdown-section code{padding:.2em;margin:0;font-size:.85em;background-color:#f7f7f7}
764 | .markdown-section code:after,.markdown-section code:before{letter-spacing:-.2em;content:"\00a0"}
765 | .markdown-section table{display:table;width:100%;border-collapse:collapse;border-spacing:0;overflow:auto}
766 | .markdown-section table td,.markdown-section table th{padding:6px 13px;border:1px solid #ddd}
767 | .markdown-section table tr{background-color:#fff;border-top:1px solid #ccc}
768 | .markdown-section table tr:nth-child(2n){background-color:#f8f8f8}
769 | .markdown-section table th{font-weight:700}
770 | .markdown-section ol,.markdown-section ul{padding:0;margin:0;margin-bottom:.85em;padding-left:2em}
771 | .markdown-section ol ol,.markdown-section ol ul,.markdown-section ul ol,.markdown-section ul ul{margin-top:0;margin-bottom:0}
772 | .markdown-section ol ol{list-style-type:lower-roman}
773 | .markdown-section blockquote{margin:0;margin-bottom:.85em;padding:0 15px;color:#858585;border-left:4px solid #e5e5e5}
774 | .markdown-section blockquote:first-child{margin-top:0}
775 | .markdown-section blockquote:last-child{margin-bottom:0}
776 | .markdown-section dl{padding:0}
777 | .markdown-section dl dt{padding:0;margin-top:.85em;font-style:italic;font-weight:700}
778 | .markdown-section dl dd{padding:0 .85em;margin-bottom:.85em}
779 | .markdown-section dd{margin-left:0}
780 | .markdown-section .glossary-term{cursor:help;text-decoration:underline}
781 | .navigation{position:absolute;top:50px;bottom:0;margin:0;max-width:150px;min-width:90px;display:flex;justify-content:center;align-content:center;flex-direction:column;font-size:40px;color:#ccc;text-align:center;-webkit-transition:all 350ms ease;-moz-transition:all 350ms ease;-o-transition:all 350ms ease;transition:all 350ms ease}
782 | .navigation:hover{text-decoration:none;color:#444}
783 | .navigation.navigation-next{right:0}
784 | .navigation.navigation-prev{left:0}
785 | @media (max-width:1240px){.navigation{position:static;top:auto;max-width:50%;width:50%;display:inline-block;float:left}
786 | .navigation.navigation-unique{max-width:100%;width:100%}
787 | }
788 | #book-search-input{padding:6px;background:0 0;transition:top .5s ease;background:#fff;border-bottom:1px solid rgba(0,0,0,.07);border-top:1px solid rgba(0,0,0,.07);margin-bottom:10px;margin-top:-1px}
789 | #book-search-input input,#book-search-input input:focus,#book-search-input input:hover{width:100%;background:0 0;border:1px solid transparent;box-shadow:none;outline:0;line-height:22px;padding:7px 7px;color:inherit}
790 | #book-search-results{opacity:1}
791 | #book-search-results .search-results .search-results-title{text-transform:uppercase;text-align:center;font-weight:200;margin-bottom:35px;opacity:.6}
792 | #book-search-results .search-results .has-results .search-results-item{display:block;word-wrap:break-word;overflow:hidden;color:#333;line-height:1.7;text-size-adjust:100%;-ms-text-size-adjust:100%;-webkit-text-size-adjust:100%;-moz-text-size-adjust:100%}
793 | #book-search-results .search-results .has-results .search-results-item *{box-sizing:border-box;-webkit-box-sizing:border-box;font-size:inherit}
794 | #book-search-results .search-results .has-results .search-results-item>:first-child{margin-top:0!important}
795 | #book-search-results .search-results .has-results .search-results-item>:last-child{margin-bottom:0!important}
796 | #book-search-results .search-results .has-results .search-results-item blockquote,#book-search-results .search-results .has-results .search-results-item code,#book-search-results .search-results .has-results .search-results-item figure,#book-search-results .search-results .has-results .search-results-item img,#book-search-results .search-results .has-results .search-results-item pre,#book-search-results .search-results .has-results .search-results-item table,#book-search-results .search-results .has-results .search-results-item tr{page-break-inside:avoid}
797 | #book-search-results .search-results .has-results .search-results-item h2,#book-search-results .search-results .has-results .search-results-item h3,#book-search-results .search-results .has-results .search-results-item h4,#book-search-results .search-results .has-results .search-results-item h5,#book-search-results .search-results .has-results .search-results-item p{orphans:3;widows:3}
798 | #book-search-results .search-results .has-results .search-results-item h1,#book-search-results .search-results .has-results .search-results-item h2,#book-search-results .search-results .has-results .search-results-item h3,#book-search-results .search-results .has-results .search-results-item h4,#book-search-results .search-results .has-results .search-results-item h5{page-break-after:avoid}
799 | #book-search-results .search-results .has-results .search-results-item b,#book-search-results .search-results .has-results .search-results-item strong{font-weight:700}
800 | #book-search-results .search-results .has-results .search-results-item em{font-style:italic}
801 | #book-search-results .search-results .has-results .search-results-item blockquote,#book-search-results .search-results .has-results .search-results-item dl,#book-search-results .search-results .has-results .search-results-item ol,#book-search-results .search-results .has-results .search-results-item p,#book-search-results .search-results .has-results .search-results-item table,#book-search-results .search-results .has-results .search-results-item ul{margin-top:0;margin-bottom:.85em}
802 | #book-search-results .search-results .has-results .search-results-item a{color:#4183c4;text-decoration:none;background:0 0}
803 | #book-search-results .search-results .has-results .search-results-item a:active,#book-search-results .search-results .has-results .search-results-item a:focus,#book-search-results .search-results .has-results .search-results-item a:hover{outline:0;text-decoration:underline}
804 | #book-search-results .search-results .has-results .search-results-item img{border:0;max-width:100%}
805 | #book-search-results .search-results .has-results .search-results-item hr{height:4px;padding:0;margin:1.7em 0;overflow:hidden;background-color:#e7e7e7;border:none}
806 | #book-search-results .search-results .has-results .search-results-item hr:after,#book-search-results .search-results .has-results .search-results-item hr:before{display:table;content:" "}
807 | #book-search-results .search-results .has-results .search-results-item hr:after{clear:both}
808 | #book-search-results .search-results .has-results .search-results-item h1,#book-search-results .search-results .has-results .search-results-item h2,#book-search-results .search-results .has-results .search-results-item h3,#book-search-results .search-results .has-results .search-results-item h4,#book-search-results .search-results .has-results .search-results-item h5,#book-search-results .search-results .has-results .search-results-item h6{margin-top:1.275em;margin-bottom:.85em;font-weight:700}
809 | #book-search-results .search-results .has-results .search-results-item h1{font-size:2em}
810 | #book-search-results .search-results .has-results .search-results-item h2{font-size:1.75em}
811 | #book-search-results .search-results .has-results .search-results-item h3{font-size:1.5em}
812 | #book-search-results .search-results .has-results .search-results-item h4{font-size:1.25em}
813 | #book-search-results .search-results .has-results .search-results-item h5{font-size:1em}
814 | #book-search-results .search-results .has-results .search-results-item h6{font-size:1em;color:#777}
815 | #book-search-results .search-results .has-results .search-results-item code,#book-search-results .search-results .has-results .search-results-item pre{font-family:Consolas,"Liberation Mono",Menlo,Courier,monospace;direction:ltr;margin:0;padding:0;border:none;color:inherit}
816 | #book-search-results .search-results .has-results .search-results-item pre{overflow:auto;word-wrap:normal;margin:0;padding:.85em 1em;margin-bottom:1.275em;background:#f7f7f7}
817 | #book-search-results .search-results .has-results .search-results-item pre>code{display:inline;max-width:initial;padding:0;margin:0;overflow:initial;line-height:inherit;font-size:.85em;white-space:pre;background:0 0}
818 | #book-search-results .search-results .has-results .search-results-item pre>code:after,#book-search-results .search-results .has-results .search-results-item pre>code:before{content:normal}
819 | #book-search-results .search-results .has-results .search-results-item code{padding:.2em;margin:0;font-size:.85em;background-color:#f7f7f7}
820 | #book-search-results .search-results .has-results .search-results-item code:after,#book-search-results .search-results .has-results .search-results-item code:before{letter-spacing:-.2em;content:"\00a0"}
821 | #book-search-results .search-results .has-results .search-results-item table{display:table;width:100%;border-collapse:collapse;border-spacing:0;overflow:auto}
822 | #book-search-results .search-results .has-results .search-results-item table td,#book-search-results .search-results .has-results .search-results-item table th{padding:6px 13px;border:1px solid #ddd}
823 | #book-search-results .search-results .has-results .search-results-item table tr{background-color:#fff;border-top:1px solid #ccc}
824 | #book-search-results .search-results .has-results .search-results-item table tr:nth-child(2n){background-color:#f8f8f8}
825 | #book-search-results .search-results .has-results .search-results-item table th{font-weight:700}
826 | #book-search-results .search-results .has-results .search-results-item ol,#book-search-results .search-results .has-results .search-results-item ul{padding:0;margin:0;margin-bottom:.85em;padding-left:2em}
827 | #book-search-results .search-results .has-results .search-results-item ol ol,#book-search-results .search-results .has-results .search-results-item ol ul,#book-search-results .search-results .has-results .search-results-item ul ol,#book-search-results .search-results .has-results .search-results-item ul ul{margin-top:0;margin-bottom:0}
828 | #book-search-results .search-results .has-results .search-results-item ol ol{list-style-type:lower-roman}
829 | #book-search-results .search-results .has-results .search-results-item blockquote{margin:0;margin-bottom:.85em;padding:0 15px;color:#858585;border-left:4px solid #e5e5e5}
830 | #book-search-results .search-results .has-results .search-results-item blockquote:first-child{margin-top:0}
831 | #book-search-results .search-results .has-results .search-results-item blockquote:last-child{margin-bottom:0}
832 | #book-search-results .search-results .has-results .search-results-item dl{padding:0}
833 | #book-search-results .search-results .has-results .search-results-item dl dt{padding:0;margin-top:.85em;font-style:italic;font-weight:700}
834 | #book-search-results .search-results .has-results .search-results-item dl dd{padding:0 .85em;margin-bottom:.85em}
835 | #book-search-results .search-results .has-results .search-results-item dd{margin-left:0}
836 | #book-search-results .search-results .has-results .search-results-item h3{margin-top:0;margin-bottom:0}
837 | #book-search-results .search-results .no-results{padding:40px 0}
838 | body.search-loading #book-search-results{opacity:.3}
839 | body.with-search .navigation{display:none}
840 | *{-webkit-box-sizing:border-box;-moz-box-sizing:border-box;box-sizing:border-box;-webkit-overflow-scrolling:touch;-webkit-tap-highlight-color:transparent;-webkit-text-size-adjust:none;-webkit-touch-callout:none;-webkit-font-smoothing:antialiased}
841 | a{text-decoration:none}
842 | body,html{height:100%}
843 | html{font-size:62.5%}
844 | body{text-rendering:optimizeLegibility;font-smoothing:antialiased;font-family:"Helvetica Neue",Helvetica,Arial,sans-serif;font-size:14px;letter-spacing:.2px;text-size-adjust:100%;-ms-text-size-adjust:100%;-webkit-text-size-adjust:100%}
845 | 
846 | /*
847 |     This CSS only styled the search results section, not the search input
848 |     It defines the basic interraction to hide content when displaying results, etc
849 | */
850 | #book-search-results .search-results {
851 |   display: none;
852 | }
853 | #book-search-results .search-results ul.search-results-list {
854 |   list-style-type: none;
855 |   padding-left: 0;
856 | }
857 | #book-search-results .search-results ul.search-results-list li {
858 |   margin-bottom: 1.5rem;
859 |   padding-bottom: 0.5rem;
860 |   /* Highlight results */
861 | }
862 | #book-search-results .search-results ul.search-results-list li p em {
863 |   background-color: rgba(255, 220, 0, 0.4);
864 |   font-style: normal;
865 | }
866 | #book-search-results .search-results .no-results {
867 |   display: none;
868 | }
869 | #book-search-results.open .search-results {
870 |   display: block;
871 | }
872 | #book-search-results.open .search-noresults {
873 |   display: none;
874 | }
875 | #book-search-results.no-results .search-results .has-results {
876 |   display: none;
877 | }
878 | #book-search-results.no-results .search-results .no-results {
879 |   display: block;
880 | }
881 | 


--------------------------------------------------------------------------------
/book/gitbook/website.css:
--------------------------------------------------------------------------------
  1 | /*
  2 |  * Theme 1
  3 |  */
  4 | .color-theme-1 .dropdown-menu {
  5 |   background-color: #111111;
  6 |   border-color: #7e888b;
  7 | }
  8 | .color-theme-1 .dropdown-menu .dropdown-caret .caret-inner {
  9 |   border-bottom: 9px solid #111111;
 10 | }
 11 | .color-theme-1 .dropdown-menu .buttons {
 12 |   border-color: #7e888b;
 13 | }
 14 | .color-theme-1 .dropdown-menu .button {
 15 |   color: #afa790;
 16 | }
 17 | .color-theme-1 .dropdown-menu .button:hover {
 18 |   color: #73553c;
 19 | }
 20 | /*
 21 |  * Theme 2
 22 |  */
 23 | .color-theme-2 .dropdown-menu {
 24 |   background-color: #2d3143;
 25 |   border-color: #272a3a;
 26 | }
 27 | .color-theme-2 .dropdown-menu .dropdown-caret .caret-inner {
 28 |   border-bottom: 9px solid #2d3143;
 29 | }
 30 | .color-theme-2 .dropdown-menu .buttons {
 31 |   border-color: #272a3a;
 32 | }
 33 | .color-theme-2 .dropdown-menu .button {
 34 |   color: #62677f;
 35 | }
 36 | .color-theme-2 .dropdown-menu .button:hover {
 37 |   color: #f4f4f5;
 38 | }
 39 | .book .book-header .font-settings .font-enlarge {
 40 |   line-height: 30px;
 41 |   font-size: 1.4em;
 42 | }
 43 | .book .book-header .font-settings .font-reduce {
 44 |   line-height: 30px;
 45 |   font-size: 1em;
 46 | }
 47 | .book.color-theme-1 .book-body {
 48 |   color: #704214;
 49 |   background: #f3eacb;
 50 | }
 51 | .book.color-theme-1 .book-body .page-wrapper .page-inner section {
 52 |   background: #f3eacb;
 53 | }
 54 | .book.color-theme-2 .book-body {
 55 |   color: #bdcadb;
 56 |   background: #1c1f2b;
 57 | }
 58 | .book.color-theme-2 .book-body .page-wrapper .page-inner section {
 59 |   background: #1c1f2b;
 60 | }
 61 | .book.font-size-0 .book-body .page-inner section {
 62 |   font-size: 1.2rem;
 63 | }
 64 | .book.font-size-1 .book-body .page-inner section {
 65 |   font-size: 1.4rem;
 66 | }
 67 | .book.font-size-2 .book-body .page-inner section {
 68 |   font-size: 1.6rem;
 69 | }
 70 | .book.font-size-3 .book-body .page-inner section {
 71 |   font-size: 2.2rem;
 72 | }
 73 | .book.font-size-4 .book-body .page-inner section {
 74 |   font-size: 4rem;
 75 | }
 76 | .book.font-family-0 {
 77 |   font-family: Georgia, serif;
 78 | }
 79 | .book.font-family-1 {
 80 |   font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;
 81 | }
 82 | .book.color-theme-1 .book-body .page-wrapper .page-inner section.normal {
 83 |   color: #704214;
 84 | }
 85 | .book.color-theme-1 .book-body .page-wrapper .page-inner section.normal a {
 86 |   color: inherit;
 87 | }
 88 | .book.color-theme-1 .book-body .page-wrapper .page-inner section.normal h1,
 89 | .book.color-theme-1 .book-body .page-wrapper .page-inner section.normal h2,
 90 | .book.color-theme-1 .book-body .page-wrapper .page-inner section.normal h3,
 91 | .book.color-theme-1 .book-body .page-wrapper .page-inner section.normal h4,
 92 | .book.color-theme-1 .book-body .page-wrapper .page-inner section.normal h5,
 93 | .book.color-theme-1 .book-body .page-wrapper .page-inner section.normal h6 {
 94 |   color: inherit;
 95 | }
 96 | .book.color-theme-1 .book-body .page-wrapper .page-inner section.normal h1,
 97 | .book.color-theme-1 .book-body .page-wrapper .page-inner section.normal h2 {
 98 |   border-color: inherit;
 99 | }
100 | .book.color-theme-1 .book-body .page-wrapper .page-inner section.normal h6 {
101 |   color: inherit;
102 | }
103 | .book.color-theme-1 .book-body .page-wrapper .page-inner section.normal hr {
104 |   background-color: inherit;
105 | }
106 | .book.color-theme-1 .book-body .page-wrapper .page-inner section.normal blockquote {
107 |   border-color: inherit;
108 | }
109 | .book.color-theme-1 .book-body .page-wrapper .page-inner section.normal pre,
110 | .book.color-theme-1 .book-body .page-wrapper .page-inner section.normal code {
111 |   background: #fdf6e3;
112 |   color: #657b83;
113 |   border-color: #f8df9c;
114 | }
115 | .book.color-theme-1 .book-body .page-wrapper .page-inner section.normal .highlight {
116 |   background-color: inherit;
117 | }
118 | .book.color-theme-1 .book-body .page-wrapper .page-inner section.normal table th,
119 | .book.color-theme-1 .book-body .page-wrapper .page-inner section.normal table td {
120 |   border-color: #f5d06c;
121 | }
122 | .book.color-theme-1 .book-body .page-wrapper .page-inner section.normal table tr {
123 |   color: inherit;
124 |   background-color: #fdf6e3;
125 |   border-color: #444444;
126 | }
127 | .book.color-theme-1 .book-body .page-wrapper .page-inner section.normal table tr:nth-child(2n) {
128 |   background-color: #fbeecb;
129 | }
130 | .book.color-theme-2 .book-body .page-wrapper .page-inner section.normal {
131 |   color: #bdcadb;
132 | }
133 | .book.color-theme-2 .book-body .page-wrapper .page-inner section.normal a {
134 |   color: #3eb1d0;
135 | }
136 | .book.color-theme-2 .book-body .page-wrapper .page-inner section.normal h1,
137 | .book.color-theme-2 .book-body .page-wrapper .page-inner section.normal h2,
138 | .book.color-theme-2 .book-body .page-wrapper .page-inner section.normal h3,
139 | .book.color-theme-2 .book-body .page-wrapper .page-inner section.normal h4,
140 | .book.color-theme-2 .book-body .page-wrapper .page-inner section.normal h5,
141 | .book.color-theme-2 .book-body .page-wrapper .page-inner section.normal h6 {
142 |   color: #fffffa;
143 | }
144 | .book.color-theme-2 .book-body .page-wrapper .page-inner section.normal h1,
145 | .book.color-theme-2 .book-body .page-wrapper .page-inner section.normal h2 {
146 |   border-color: #373b4e;
147 | }
148 | .book.color-theme-2 .book-body .page-wrapper .page-inner section.normal h6 {
149 |   color: #373b4e;
150 | }
151 | .book.color-theme-2 .book-body .page-wrapper .page-inner section.normal hr {
152 |   background-color: #373b4e;
153 | }
154 | .book.color-theme-2 .book-body .page-wrapper .page-inner section.normal blockquote {
155 |   border-color: #373b4e;
156 | }
157 | .book.color-theme-2 .book-body .page-wrapper .page-inner section.normal pre,
158 | .book.color-theme-2 .book-body .page-wrapper .page-inner section.normal code {
159 |   color: #9dbed8;
160 |   background: #2d3143;
161 |   border-color: #2d3143;
162 | }
163 | .book.color-theme-2 .book-body .page-wrapper .page-inner section.normal .highlight {
164 |   background-color: #282a39;
165 | }
166 | .book.color-theme-2 .book-body .page-wrapper .page-inner section.normal table th,
167 | .book.color-theme-2 .book-body .page-wrapper .page-inner section.normal table td {
168 |   border-color: #3b3f54;
169 | }
170 | .book.color-theme-2 .book-body .page-wrapper .page-inner section.normal table tr {
171 |   color: #b6c2d2;
172 |   background-color: #2d3143;
173 |   border-color: #3b3f54;
174 | }
175 | .book.color-theme-2 .book-body .page-wrapper .page-inner section.normal table tr:nth-child(2n) {
176 |   background-color: #35394b;
177 | }
178 | .book.color-theme-1 .book-header {
179 |   color: #afa790;
180 |   background: transparent;
181 | }
182 | .book.color-theme-1 .book-header .btn {
183 |   color: #afa790;
184 | }
185 | .book.color-theme-1 .book-header .btn:hover {
186 |   color: #73553c;
187 |   background: none;
188 | }
189 | .book.color-theme-1 .book-header h1 {
190 |   color: #704214;
191 | }
192 | .book.color-theme-2 .book-header {
193 |   color: #7e888b;
194 |   background: transparent;
195 | }
196 | .book.color-theme-2 .book-header .btn {
197 |   color: #3b3f54;
198 | }
199 | .book.color-theme-2 .book-header .btn:hover {
200 |   color: #fffff5;
201 |   background: none;
202 | }
203 | .book.color-theme-2 .book-header h1 {
204 |   color: #bdcadb;
205 | }
206 | .book.color-theme-1 .book-body .navigation {
207 |   color: #afa790;
208 | }
209 | .book.color-theme-1 .book-body .navigation:hover {
210 |   color: #73553c;
211 | }
212 | .book.color-theme-2 .book-body .navigation {
213 |   color: #383f52;
214 | }
215 | .book.color-theme-2 .book-body .navigation:hover {
216 |   color: #fffff5;
217 | }
218 | /*
219 |  * Theme 1
220 |  */
221 | .book.color-theme-1 .book-summary {
222 |   color: #afa790;
223 |   background: #111111;
224 |   border-right: 1px solid rgba(0, 0, 0, 0.07);
225 | }
226 | .book.color-theme-1 .book-summary .book-search {
227 |   background: transparent;
228 | }
229 | .book.color-theme-1 .book-summary .book-search input,
230 | .book.color-theme-1 .book-summary .book-search input:focus {
231 |   border: 1px solid transparent;
232 | }
233 | .book.color-theme-1 .book-summary ul.summary li.divider {
234 |   background: #7e888b;
235 |   box-shadow: none;
236 | }
237 | .book.color-theme-1 .book-summary ul.summary li i.fa-check {
238 |   color: #33cc33;
239 | }
240 | .book.color-theme-1 .book-summary ul.summary li.done > a {
241 |   color: #877f6a;
242 | }
243 | .book.color-theme-1 .book-summary ul.summary li a,
244 | .book.color-theme-1 .book-summary ul.summary li span {
245 |   color: #877f6a;
246 |   background: transparent;
247 |   font-weight: normal;
248 | }
249 | .book.color-theme-1 .book-summary ul.summary li.active > a,
250 | .book.color-theme-1 .book-summary ul.summary li a:hover {
251 |   color: #704214;
252 |   background: transparent;
253 |   font-weight: normal;
254 | }
255 | /*
256 |  * Theme 2
257 |  */
258 | .book.color-theme-2 .book-summary {
259 |   color: #bcc1d2;
260 |   background: #2d3143;
261 |   border-right: none;
262 | }
263 | .book.color-theme-2 .book-summary .book-search {
264 |   background: transparent;
265 | }
266 | .book.color-theme-2 .book-summary .book-search input,
267 | .book.color-theme-2 .book-summary .book-search input:focus {
268 |   border: 1px solid transparent;
269 | }
270 | .book.color-theme-2 .book-summary ul.summary li.divider {
271 |   background: #272a3a;
272 |   box-shadow: none;
273 | }
274 | .book.color-theme-2 .book-summary ul.summary li i.fa-check {
275 |   color: #33cc33;
276 | }
277 | .book.color-theme-2 .book-summary ul.summary li.done > a {
278 |   color: #62687f;
279 | }
280 | .book.color-theme-2 .book-summary ul.summary li a,
281 | .book.color-theme-2 .book-summary ul.summary li span {
282 |   color: #c1c6d7;
283 |   background: transparent;
284 |   font-weight: 600;
285 | }
286 | .book.color-theme-2 .book-summary ul.summary li.active > a,
287 | .book.color-theme-2 .book-summary ul.summary li a:hover {
288 |   color: #f4f4f5;
289 |   background: #252737;
290 |   font-weight: 600;
291 | }
292 | 


--------------------------------------------------------------------------------
/build.sh:
--------------------------------------------------------------------------------
 1 | set -x -e
 2 | mkdir -p tmp
 3 | 
 4 | # Build navigation
 5 | pandoc -f markdown -t html SUMMARY.md | \
 6 |     sed -e 's|\.md|.html|' -e 's|href="|href="/intro2UnixandSGE/|' > book/SUMMARY.html
 7 | 
 8 | echo '[' > tmp/documents.json
 9 | 
10 | for file in $(find pages -type f -printf '%P\n'); do
11 |     echo $file
12 |     title=$(egrep --max-count=1 '^# ' pages/$file | tail -c +3)
13 | 
14 |     # Build JSON documents for indexing
15 |     tr \" \' < pages/$file | tr -d "[:punct:]" | \
16 |         pandoc -f gfm \
17 |                -t plain \
18 |                -V url="/intro2UnixandSGE/$(dirname $file)/$(basename $file .md).html" \
19 |                -V pagetitle="$title" \
20 |                --template template.json - | tr "\n" " " >> tmp/documents.json
21 | 
22 |     # Build web pages
23 |     mkdir -p book/$(dirname $file)
24 |     # TODO: level should be taken from SUMMARY
25 |     pandoc -f markdown_github+smart \
26 |            -t html \
27 |            -V level="1.1" \
28 |            -V navigation="$(cat book/SUMMARY.html)" \
29 |            -V pagetitle="$title" \
30 |            -o "book/$(dirname $file)/$(basename $file .md).html" \
31 |            --template template.html pages/$file
32 | done
33 | echo '{}]' >> tmp/documents.json
34 | 
35 | cp book/README.html book/index.html
36 | node bake-index.js < tmp/documents.json > book/search_index.json
37 | rm tmp/documents.json 
38 | 


--------------------------------------------------------------------------------
/manifest.scm:
--------------------------------------------------------------------------------
1 | ;; guix environment -m manifest.scm
2 | (specifications->manifest '("pandoc" "node"))
3 | 


--------------------------------------------------------------------------------
/package-lock.json:
--------------------------------------------------------------------------------
 1 | {
 2 |   "name": "shell-intro",
 3 |   "version": "1.0.0",
 4 |   "lockfileVersion": 1,
 5 |   "requires": true,
 6 |   "dependencies": {
 7 |     "lunr": {
 8 |       "version": "0.5.12",
 9 |       "resolved": "https://registry.npmjs.org/lunr/-/lunr-0.5.12.tgz",
10 |       "integrity": "sha1-ova314AcvizLFpbaZ/H3eI+J4Mg="
11 |     }
12 |   }
13 | }
14 | 


--------------------------------------------------------------------------------
/package.json:
--------------------------------------------------------------------------------
 1 | {
 2 |   "name": "shell-intro",
 3 |   "version": "1.0.0",
 4 |   "description": "",
 5 |   "main": "bake-index.js",
 6 |   "dependencies": {
 7 |     "lunr": "^0.5.12"
 8 |   },
 9 |   "devDependencies": {},
10 |   "scripts": {
11 |     "test": "echo \"Error: no test specified\" && exit 1"
12 |   },
13 |   "repository": {
14 |     "type": "git",
15 |     "url": "git+https://github.com/BIMSBbioinfo/intro2UnixandSGE.git"
16 |   },
17 |   "author": "",
18 |   "license": "gpl3",
19 |   "bugs": {
20 |     "url": "https://github.com/BIMSBbioinfo/intro2UnixandSGE/issues"
21 |   },
22 |   "homepage": "https://github.com/BIMSBbioinfo/intro2UnixandSGE"
23 | }
24 | 


--------------------------------------------------------------------------------
/pages/README.md:
--------------------------------------------------------------------------------
 1 | ![Group Logo](http://bioinformatics.mdc-berlin.de/img/GroupLogo.png)
 2 | 
 3 | ## Introduction to Unix and Grid Engine for beginners
 4 | 
 5 | This is a guide on using unix systems and the Grid Engine cluster
 6 | environment.
 7 | 
 8 | First chapter will introduce basic usage for unix systems. The second
 9 | chapter will explore the Grid Engine environment and show how to use the queuing
10 | system from users perspective.
11 | 
12 | ###  What will you get out of this ?
13 | 
14 | After reading, you will:
15 | 
16 | * be able to use unix commands to navigate the file system
17 | * use unix commands to interrogate files
18 | * understand and write basic bash scripts
19 | * understand Grid Engine and queueing system
20 | * be able to submit jobs to a Grid Engine cluster and troubleshoot
21 | 
22 | ### Contribute to the development
23 | 
24 | You can contribute to the development of this guide using github
25 | features such as pull-requests and issue creation.
26 | 
27 | 
28 | ### Build the book
29 | 
30 | This book is compiled with pandoc.
31 | 
32 | Run `guix environment -m manifest.scm` to enter a suitable environment
33 | to hack on this book.  Then run `npm install` to install the lunr
34 | JavaScript library for the search index.
35 | 
36 | 
37 | ### How to update the book
38 | 
39 | Edit the .md files using markdown syntax and run **bash
40 | build.sh**. This will regenerate the book and store the files in the
41 | `book` directory.  Copy the contents of this directory to the
42 | **gh-pages** branch (the contents of this branch are served by GitHub
43 | pages) and push those changes to **"gh-pages"** branch of the online
44 | repository. You should also commit the changes you made in the
45 | **"master"** branch via `git commit`. Basically, **"master"** branch
46 | has the markdown files, **"gh-pages"** branch has the html website.
47 | 
48 | 
49 | ### Acknowledgements
50 | 
51 | Initially created by Altuna Akalin. Some of the material is based on
52 | Martin Siegert's documentation of the Grid Engine cluster.
53 | 
54 | 


--------------------------------------------------------------------------------
/pages/downloading_files_with_wget,_curl_and_ftp/README.md:
--------------------------------------------------------------------------------
 1 | # Downloading files with wget, curl and ftp
 2 | You will often need to download files using the shell interface. There are multiple options on Unix-like systems that will allow you to do that. Below are a few examples.
 3 | 
 4 | ## wget
 5 | **wget** can be used to download files from internet and store them. The following command downloads a compressed archive from the web and stores it in the current directory.
 6 | 
 7 | ```
 8 | $ wget http://www.openss7.org/repos/tarballs/strx25-0.9.2.1.tar.bz2
 9 | ```
10 | 
11 | The **-O** option can be used to change the output file name.
12 | 
13 | ```
14 | $ wget -O strx25.tar.bz2 http://www.openss7.org/repos/tarballs/strx25-0.9.2.1.tar.bz2
15 | ```
16 | 
17 | You can also use `wget` to download a file list using **-i** option and giving a text file containing file URLs. Here is an example:
18 | 
19 | ```
20 | $ cat download-file-list.txt
21 | URL1
22 | URL2
23 | URL3
24 | URL4
25 | 
26 | $ wget -i download-file-list.txt
27 | ```
28 | 
29 | ## curl
30 | 
31 | 
32 | ## ftp
33 | 


--------------------------------------------------------------------------------
/pages/sun_grid_engine_for_beginners/README.md:
--------------------------------------------------------------------------------
 1 | # Grid Engine for beginners
 2 | Using the Max cluster environment is similar to using GNU/Linux environments for your job submission (e.g running your scripts or other software). The difference is that you need to specify needed resources beforehand. The cluster is controlled by the Grid Engine scheduler that organizes the queues and resources. This sort of scheduling system is necessary when limited computational resources are shared by many. And, it would be useful if you are running alignments for multiple samples and want to distribute those tasks (jobs) across multiple machines or CPUs, or when running statistical simulations that needs to run on multiple CPUs for a long time. For these cases and many more alike, you just need to submit your job script (which is a shell script) and Grid Engine will take care of the rest (as long as there is no error in your script).
 3 | 
 4 | Grid Engine will do the **"job scheduling"**. That means you can submit all your jobs and Grid Engine will queue them and run them when resources you requested becomes available. It will also achieve **"load balancing"** where the jobs will be distributed so that specific nodes do not get overloaded. In addition, Grid Engine will allow you to do **"job monitoring and accounting"** which will be useful when you want to check if your job is running ,and if it failed it will help you understand what went wrong.
 5 | 
 6 | 
 7 | 
 8 | 
 9 | Within the next sections, we will show how to use Grid Engine for **job submission**, **monitoring** and **troubleshooting**.
10 | 


--------------------------------------------------------------------------------
/pages/sun_grid_engine_for_beginners/faq.md:
--------------------------------------------------------------------------------
1 | # FAQ
2 | 
3 | Some FAQ goes here, we can sample from most asked questions/themes in the help desk mails.
4 | 


--------------------------------------------------------------------------------
/pages/sun_grid_engine_for_beginners/how_to_run_array_jobs.md:
--------------------------------------------------------------------------------
1 | # How to run array jobs
2 | Running array jobs goes here, there is some material at bbc already
3 | 


--------------------------------------------------------------------------------
/pages/sun_grid_engine_for_beginners/how_to_submit_a_job_using_qsub.md:
--------------------------------------------------------------------------------
 1 | # How to submit a job using qsub
 2 | `qsub` is a command used for submission to the Grid Engine cluster. In the section 2.1 Quickstart and basics, we showed that you can submit an example job using qsub as follows:
 3 | ```
 4 | username@max-loginX:~$ qsub -V -b n -cwd runJob.sh
 5 | Your job 1 ("runJob.sh") has been submitted
 6 | ```
 7 | The general syntax of how to use qsub is below.
 8 | ```
 9 | qsub -q <queue> -w e -N <job_name> -l h_vmem=<memory, e.g. 4G> -l h_rt=<time> -l s_rt=<time> -pe smp <num_slots> -o <outputlogfile> -e <errorlogfile> <pathtoScript> <arg1> <arg2>
10 | ```
11 | 
12 | Here are the some of the options and their explanations.
13 | 
14 | * `-q <queue>`   set the queue. Often you will use the standard queue, so no need to set this up.
15 | 
16 | * `-V`  will pass all environment variables to the job
17 | * `-v var[=value]`   will specifically pass environment variable 'var' to the job
18 | * `-b y`  allow command to be a binary file instead of a script.
19 | * `-w e`  verify options and abort if there is an error
20 | * `-N <jobname>`  name of the job. This you will see when you use `qstat`, to check status of your jobs.
21 | * `-l h_vmem=size` specify the amount of maximum memory required (e.g. 3G or 3500M) (NOTE: This is memory per processor slot. So if you ask for 2 processors total memory will be 2 * hvmem_value)
22 | * `-l h_rt=<hh:mm:ss>` specify the maximum run time (hours, minutes and seconds)
23 | * `-l s_rt=hh:mm:ss` specify the soft run time limit (hours, minutes and seconds) - Remember to set both s_rt and h_rt.
24 | * `-pe smp <n_slots>` This specifies the parallel environment. `smp` runs a parallel job using shared-memory and n_processors amount of cores.
25 | * `-cwd` run in current working directory
26 | * `-wd <dir>`  Set working directory for this job as `<dir>`
27 | * `-o <output_logfile>` name of the output log file
28 | * `-e <error_logfile>` name of the error log file
29 | * `-m ea` Will send email when job ends or aborts
30 | * `-P <projectName>` set the job's project
31 | * `-M <emailaddress>` Email address to send email to
32 | * `-t <start>-<end>:<incr>` submit a job array with start index <start>, stop index <end> in increments using <incr>
33 | 
34 | You can see full list of arguments and explanations [here](http://gridscheduler.sourceforge.net/htmlman/htmlman1/qsub.html).
35 | 
36 | Now let's see some example bash scripts and qsub commands that submit those jobs to the cluster.
37 | ### Submitting a bowtie job
38 | [Bowtie](http://bowtie-bio.sourceforge.net/) is a short-read aligner used to align reads from next-gen sequencing machines. The script includes the commandline options within it, so no need to pass those options on the commandline. In a shell script, you can set the qsub options in lines that begin with #$. This an alternative to passing them with the qsub command.
39 | 
40 | ```
41 | #!/bin/bash
42 | #$ -N run_bowtie2
43 | #$ -cwd
44 | #$ -pe smp 6
45 | #$ -l h_vmem=6G
46 | 
47 | 
48 | infile=/data/bioinfo/READS2/R1_001.fastq.gz
49 | outfile=/data/bioinfo/READS2/aln/R1_001.sam
50 | btindex=/data/bioinfo/genome_data/Caenorhabditis_elegans/UCSC/ce10/Sequence/BowtieIndex/genome
51 | 
52 | gzip -dc $infile | bowtie  --chunkmbs 300 --best -m 1 -p 6 --phred33 -q $btindex   -  -S $outfile
53 | 
54 | ```
55 | 
56 | 
57 | * Since the options we care about are in the script, we do not need to pass them with the qsub command. The lines starting with `#$` are the qsub options described above. They customize the job and ask for resources such as CPU and memory.
58 | * The input/output files for the bowtie command are stored in `infile`,`outfile` and `btindex` variables. Then, passed to the bowtie command. This is not really necessary but it is easier to read later on what is going on.
59 | 
60 | * The execution of bowtie starts with the `gzip -dc ...`. Since fastq files are compressed we first need to decompress them and feed the output to bowtie via `|` pipe.
61 | * `--chunkmbs 300 --best -m 1 -p 6 --phred33 -q` are bowtie specific options. Look them up in the [Bowtie manual](http://bowtie-bio.sourceforge.net/).
62 | 
63 | And, you can run this as follows (assuming this file is saved as 'runBowtie.sh').
64 | ```
65 | $ qsub runBowtie.sh
66 | ```
67 | 
68 | ### more examples to come...
69 | 
70 | 


--------------------------------------------------------------------------------
/pages/sun_grid_engine_for_beginners/how_to_use_interactive_sessions_with_qrsh.md:
--------------------------------------------------------------------------------
 1 | # How to use interactive sessions with qrsh
 2 | If you want to run an interactive session using software such as R or Matlab, you need to use *qrsh* to start an interactive session and similar to qsub you need to ask for specific resources. You may want to use *screen* command before you start your session so that after you logged out and if you left somethings running in your session you can re-attach your session. See [here] for screen usage tutorial. In addition, if your software needs X11 forwarding (for example you will need this for R plots) you need to ssh to max-login.mdc-berlin.net  with `-X` option such as `ssh -X username@max-login.mdc-berlin.net`
 3 | 
 4 | 
 5 | Here is how you can start an R session using qrsh. The session directly starts R, and qrsh asks for 10G memory max and 5G memory should be available at the moment.
 6 | ```powershell
 7 | username@login1:~$ qrsh -V -l h_vmem=10G,mem_free=5G R
 8 | ```
 9 | 
10 | Alternatively, you can login to a suitable machine using qrsh and then start R.
11 | The qrsh reguests 3 slots and 5G per slot maximum memory (3*5=15G max memory).
12 | 
13 | ```powershell
14 | username@login1:~ $  qrsh -now no -pe smp 3 -l  h_vmem=5G
15 | local configuration login1.mdccluster not defined - using global configuration
16 | aakalin@node023:~$ R
17 | 
18 | R version 3.0.2 (2013-09-25) -- "Frisbee Sailing"
19 | Copyright (C) 2013 The R Foundation for Statistical Computing
20 | Platform: x86_64-pc-linux-gnu (64-bit)
21 | 
22 | ```
23 | A "particular" node can request by:
24 | ```powershell
25 | username@login1:~ $ qrsh -l h='node050' -now no ....
26 | ...
27 | username@node050:~$ 
28 | ```
29 | 
30 | 


--------------------------------------------------------------------------------
/pages/sun_grid_engine_for_beginners/monitoring_cluster_usage_and_troubleshooting.md:
--------------------------------------------------------------------------------
 1 | # Monitoring cluster usage and troubleshooting
 2 | You can monitor the cluster usage and also monitor and control your jobs using the following examples.
 3 | 
 4 | `qhost -F` will show the resources available for each node.
 5 | 
 6 | `qmon` and ganglia(http://141.80.186.22/ganglia/) will give you visual interface to see the load of the cluster. qmon works when you ssh -X to the login node. Can bu also used to submit jobs other than monitoring.
 7 | 
 8 | ### monitor your jobs ###
 9 | To see a list of all your pending and currently-running jobs, use the qstat command:
10 | `qstat`
11 | 
12 | To see details about a particular job, use qstat with the -j option. The jobid is the ID number of the job reported by qsub and qstat:
13 | `qstat -j <jobid>`
14 | 
15 | To see why a pending job has not been scheduled yet, look at the output from `qstat -j <jobid>`.
16 | 
17 | By default qstat only shows your own jobs. To see all the jobs on the cluster:
18 | `qstat -u \*`
19 | 
20 | To check memory used by a job
21 | `qstat -f -j <jobid>| grep vmem # -f means qstat in full mode. Gives details`
22 | 
23 | ### delete your jobs ###
24 | `qdel <jobid>` will delete the jobs from the queue.
25 | 
26 | ## Troubleshooting:
27 | 
28 | ### Why my job doesn't start:
29 | Usually, this is because the requested memory or CPU resources are not available. Sometimes, nodes are taken out of the cluster for maintanence, which reduces the available resources.
30 | 
31 | ### Why my job has failed:
32 | Here are a couple of steps that might help you understand why your job failed. More often than not, you probably exceed the resources you asked for.
33 | 
34 |  * Read at the error file (default <jobname>.e<jobid>)
35 |  * Look at the `qacct -j <jobid>`
36 |     * Runtime above limit
37 |     * Maxvmem above requested limit?
38 |     * Check the exit status ? (137 means SIGKILL, force killed )
39 |     * record what host the process was running
40 |  * ssh to the host node and grep the jobid in `/var/spool/sge/nodeXXX/messages`
41 | 
42 | ```powershell
43 | $ ssh nodeXXX
44 | $ grep <jobid> /var/spool/sge/nodeXXX/messages
45 | ```
46 |  * request assistance from helpdesk with all the above information
47 | 


--------------------------------------------------------------------------------
/pages/sun_grid_engine_for_beginners/parallel_environments.md:
--------------------------------------------------------------------------------
1 | # Parallel environments
2 | Parallel environments are programming environments designed for parallel computing in clusters. The environments enable execution of shared-memory and distributed-memory parallel applications. The most common  parallel environments are Message Passing Interface (MPI) for distributed-memory machines, and OpenMP for shared-memory machines.
3 | 
4 | There are two parallel environments configured in the cluster. **orte** defines openMPI based environment for running MPI programs, can be invoked with `-pe orte [num_slots]` in the terminal or in the qsub script. However, most of the time you will be using **smp** environment which is for shared-memory jobs with multi-threading. This can be invoked by `-pe smp [number of slots]` option.
5 | 
6 | `qconf -sp orte` and `qconf -sp smp` will give you more info on the exact settings of each parallel environment.
7 | 


--------------------------------------------------------------------------------
/pages/sun_grid_engine_for_beginners/quickstart_and_basics.md:
--------------------------------------------------------------------------------
 1 | # Quickstart and basics
 2 | 
 3 | 
 4 | ## Quickstart
 5 | Login to the head node: `ssh username@max-login.mdc-berlin.net`, you can not do any computation here (see [cluster abuse]). The point of the head node is to distribute and schedule your jobs based on the resources demanded by you. Here is how you can start a job:
 6 | 
 7 | ```ruby
 8 | username@max-loginX:~$ qsub -V -b n -cwd runJob.sh
 9 | Your job 1 ("runJob.sh") has been submitted
10 | ```
11 | - The **-V** option to qsub states that the job should have the same environment variables as the shell executing qsub.
12 | - The **-b** option to qsub states that the command being executed could be a single binary executable or a bash script. In this case the command hostname is a single binary. This option takes a y or n argument indicating either yes the command is a binary or no it is not a binary.
13 | - The **-cwd** option to qsub tells Grid Engine that the job should be executed in the same directory that qsub was called.
14 | - The last argument to qsub is the command to be executed  or script to be run.
15 | The qsub command, if successful, will print the job number to stdout. See [How to submit a job using qsub] section for more.
16 | 
17 | ### what is runJob.sh
18 | `runJob.sh` is a shell script that has the specific commands to run our program. It basically looks like a bash script on section 1.7 but it can have some additional variables that can be used to configure the resources that the job demands. Command line options explained above (**-V**,**-cwd** etc.) can also be declared in runJob.sh via special syntax. More on qsub in later sections.
19 | 
20 | ### Specifying resources:
21 | The main resources you will be asking for are CPU(slots) and memory.
22 | 
23 | The memory can be requested with **h_vmem**, this is the maximum amount of memory a slot can take, if it exceeds this amount your job will be automatically killed. Another memory related option is **mem_free**
24 | 
25 | Here is how you can request those resources:
26 | ```powershell
27 | username@max-loginX:~$ qsub -l h_vmem=4G myJob.sh
28 | ```
29 | will ask for a machine that has 4GB memory
30 | 
31 | 
32 | Now, we can also ask for more CPU using **-pe** option. This option stands for "parallel environment" and each cluster sets up a set of parallel environments for parallel processing. The syntax for the option is as follows:`-pe [environment name] [number of slots]`. The following will start a job with 4 slots using "smp" environment.
33 | 
34 | ```powershell
35 | username@max-loginX:~$ qsub -pe smp 4 -l h_vmem=4G myJob.sh
36 | 
37 | ```
38 | 
39 | 
40 | 
41 | 
42 | 


--------------------------------------------------------------------------------
/pages/sun_grid_engine_for_beginners/resources_and_queues.md:
--------------------------------------------------------------------------------
 1 | # Resources and queues
 2 | 
 3 | ### Queue(s)
 4 | 
 5 | * are where jobs *RUN", NOT where jobs wait
 6 | * span multiple hosts -> cluster queues
 7 | * that resides on a particular host (node) is called "queue instance"
 8 | * provide "slots" - usually 1 slot / cpu core
 9 | * can be explicity selected or not (the default one is used)
10 | 
11 | ...
12 | 


--------------------------------------------------------------------------------
/pages/unix_for_beginners/README.md:
--------------------------------------------------------------------------------
 1 | # Unix for beginners
 2 | 
 3 | ### Unix
 4 | 
 5 | Unix is an operating system similar to DOS and Windows supporting
 6 | multiple users.  It was designed at Bell labs in the 1970s. Many other
 7 | operating systems such as Linux and Mac OS X are based on Unix
 8 | operating system or behave like Unix systems.
 9 | 
10 | ### Why should you learn Unix?
11 | 
12 | Apart from being the base of many operating systems, a multitude of
13 | scientific software currently runs only on Unix-based operating
14 | systems. Having Unix skills is a desirable attribute for people who
15 | are analyzing data and working in a scientific environment. In
16 | addition, Unix skills are necessary to understand the Grid Engine
17 | environment and run jobs in Grid Engine clusters.
18 | 
19 | ### What will you learn?
20 | 
21 | In this section, you will be learning:
22 | * File management and directories (commands: `ls`, `cd`, `cp`, `mv`,
23 |   `rm`)
24 | * Editing, viewing and concatenating text files (commands: `more`,
25 |   `less`, `head`, `tail`, `cat`, `cut` etc.)
26 | * Compressing and decompressing files (commands: `gzip` and `zcat`)
27 | * Connecting to a remote server with ssh
28 | * Downloading files with `wget`, `curl` and `ftp`
29 | * Simple shell scripts with bash
30 | 


--------------------------------------------------------------------------------
/pages/unix_for_beginners/basics.md:
--------------------------------------------------------------------------------
  1 | # The Shell
  2 | 
  3 | The traditional and arguably most effective way to interact with a
  4 | Unix-like system is through a special programme called "shell".  A
  5 | shell can be used interactively as a command line interface or as a
  6 | batch processor.
  7 | 
  8 | In the following screenshot you can see what a shell environment looks
  9 | like on MacOS.  You see four terminal windows in a graphical user
 10 | interface, running different shells (a descendent of the original
 11 | shell `sh`, and `tcsh`).
 12 | 
 13 | ![alt](http://upload.wikimedia.org/wikipedia/en/8/8c/TcshAndShScreenCapture.png)
 14 | 
 15 | In this tutorial we assume that the popular GNU shell `bash` is used
 16 | instead.
 17 | 
 18 | 
 19 | ## What is GNU?
 20 | 
 21 | According to the [GNU website](http://gnu.org),
 22 | 
 23 | > GNU is a Unix-like operating system that is free softwareit respects
 24 | > your freedom. You can install versions of GNU (more precisely,
 25 | > GNU/Linux systems) which are entirely free software.
 26 | 
 27 | > The GNU Project was launched in 1984 to develop the GNU system. The
 28 | > name “GNU” is a recursive acronym for “GNU's Not Unix!”.
 29 | 
 30 | Although GNU is by its own admission "not Unix", the GNU system is one
 31 | of the most popular modern implementations of a Unix-like system.
 32 | Many of the GNU applications (including the `bash` shell) are
 33 | available for other operating systems as well.
 34 | 
 35 | 
 36 | ## Starting a shell session
 37 | 
 38 | We highly recommended that a Unix-like system be used for this course.
 39 | If this is not an option for you and you are tied to Microsoft
 40 | Windows, you should install
 41 | [Cygwin](http://en.wikipedia.org/wiki/Cygwin), a Unix-like environment
 42 | for Windows.  If you have remote access to a system running a
 43 | Unix-like operating system such as GNU/Linux, it may be sufficient to
 44 | install [PuTTY](http://en.wikipedia.org/wiki/PuTTY), a terminal
 45 | application for accessing remote systems over the SSH protocol.  Many
 46 | Windows users use PuTTY to connect to remote servers, such as the
 47 | login node of a cluster.
 48 | 
 49 | Let's start a shell session!
 50 | 
 51 | * In Mac OS X, go to "utilities" and start "terminal"
 52 | * In Windows open the Cygwin terminal or use PuTTY to connect to a
 53 |   remote Unix host
 54 | * If you are using GNU/Linux, start your preferred terminal
 55 |   application (e.g. xterm, urxvt, konsole, terminal, etc.)
 56 | 
 57 | 
 58 | ## What are commands?
 59 | 
 60 | The shell interprets text as commands.  In interactive mode the user
 61 | inputs text commands on the command line prompt and submits them for
 62 | processing; the shell reads from the "standard input" stream
 63 | (connected to the keyboard).  In batch processing mode, on the other
 64 | hand, the shell reads commands from a specified file, called a
 65 | "script".  By default, the shell is configured to print all potential
 66 | output of the commands to the screen.
 67 | 
 68 | Any command line consists of one or more words; the first word is the
 69 | *name* of the command itself, whereas anything that follows belongs to
 70 | the *arguments* to the command.
 71 | 
 72 | Arguments are passed to the command.  They can be *switches* or
 73 | *options* (indicated by the `-` prefix) to modify the behaviour of the
 74 | command, patterns, the names of files to operate on, etc.  The meaning
 75 | of the arguments depends on the command.
 76 | 
 77 | The below example shows the `ls` command (which lists the files in a
 78 | given directory) without any arguments and run with the `-l` option.
 79 | (The `$` stands for the shell prompt and is not part of the command.)
 80 | 
 81 | ~~~
 82 | $ ls
 83 | Documents
 84 | 
 85 | $ ls -l
 86 | total 0
 87 | drwxr-xr-x  22 root    staff   748 May 26 19:08 Documents
 88 | ~~~
 89 | 
 90 | As you can see, the `-l` option changed the output of the `ls`
 91 | command.
 92 | 
 93 | 
 94 | ## Getting help
 95 | 
 96 | * **Man pages**.  Type "man commandName", such as `man ls`. this will return the
 97 |   manual page on the given command. Most unix commands have extensive
 98 |   explanations and examples on those pages.  Type `q` on your keyboard
 99 |   to quit the manual view.
100 | * **Info manuals**.  All GNU software comes with extensive manuals,
101 |   called info pages.  You can read them with the `info` programme on
102 |   the command line or from within Emacs.  Type `info ls` for the `ls`
103 |   manual page.  The info pages are hypertext documents with a
104 |   hierarchical structure and links.  When in `info`, type `H` to learn
105 |   how to use info.  To open info documentation inside of Emacs issue
106 |   the command "Ctrl-h i".
107 | * **Web search**.  Search online for the command followed by "+ unix"
108 |   or "+ linux", this will usually return forums and webpages about the
109 |   command.  Look for example usage and explanations.
110 | 


--------------------------------------------------------------------------------
/pages/unix_for_beginners/compressing_and_decompressing_files.md:
--------------------------------------------------------------------------------
 1 | # Compressing and decompressing files
 2 | 
 3 | UNIX systems usually support a number of utilities for backing up and compressing files. Below we will show tar,gzip and zcat utilities
 4 | 
 5 | ## tar (tape archiver)
 6 | tar backs up entire directories and files as an archive. An archive is a file that contains other files plus information about them, such as  their filename, owner, timestamps, and access permissions. tar does not perform any compression by default.
 7 | 
 8 | To create a disk file tar archive, use
 9 | 
10 |     $ tar -cvf archivename filenames
11 | 
12 | where archivename will usually have a .tar extension, so `tar -cvf archivename.tar filenames`. The *c option* means create, the *v option* means verbose (output filenames as they are archived), and *option f* means file.To list the contents of a tar archive, use
13 | 
14 |     $ tar -tvf archivename
15 | 
16 | To restore files from a tar archive, use
17 | 
18 |     $ tar -xvf archivename
19 | 
20 | 
21 | ## compressing files with gzip
22 | gzip is a utility for compressing and decompressing individual files. To compress files, use:
23 | 
24 |     $ gzip filename
25 | 
26 | The filename will be deleted and replaced by a compressed file called filename.Z or filename.gz. To reverse the compression process, use:
27 | 
28 |     $ gzip -d filename
29 | 
30 | ## viewing compressed text files with zcat
31 | zcat uncompresses the file and writes content to the standard output (which usually means the output will be on your shell screen). The following decompresses the files and writes the content on the standard output.
32 | 
33 |  `$ zcat geneList.gz`
34 | 
35 | or in some systems:
36 | 
37 |  `$ gzcat geneList.gz`
38 | 
39 | If the file is big and you just want to see what is in it (first few lines), you can combine zcat with **head**, you will see more of this in the next section, here is an example.
40 | 
41 |  `$ zcat geneList.gz | head`
42 | 
43 | "|" allows piping commands together. **head** command is applied on the output of **gzcat** command.
44 | 


--------------------------------------------------------------------------------
/pages/unix_for_beginners/connecting_to_a_remote_server.md:
--------------------------------------------------------------------------------
 1 | # Connecting to a remote server with SSH
 2 | 
 3 | In a shell session programmes read from and output to text streams
 4 | only.  These input and output streams do not have to be connected to
 5 | local resources; an input stream may just as well be connected to an
 6 | input source on the network and write to an output stream on a
 7 | different machine.  This feature can be used to start a shell session
 8 | on a network host, provided that it accepts such connections.
 9 | 
10 | Nowadays, for security reasons plain connections to remote machines
11 | are usually no longer used for shell sessions.  Instead, an encrypted
12 | connection is negotiated before the shell session is started.  The
13 | most commonly used way to achieve this is the Secure Shell protocol,
14 | or short: SSH.  When a remote host (e.g. the login node of a cluster)
15 | listens for SSH connections (commonly on network port 22) and you have
16 | credentials to authenticate on the remote host, you can connect to the
17 | remote and start a shell session there.  This means you can start a
18 | shell session on a remote computer and use the filesystem and
19 | resources on that computer.
20 | 
21 | To establish a connection to the remote host `remote.host.net` and
22 | authenticate as user `username` execute the following command in a
23 | regular shell session:
24 | 
25 |     ssh username@remote.host.net
26 | 
27 | Dependent on the authentication method you may be asked for the
28 | password for `username` on the remote machine before you are admitted.
29 | You should have a user account on the remote machine to be able to use
30 | this.  Ask the remote machine's system administrator if you do not
31 | have an account.
32 | 
33 | The very first time you connect to a remote machine, you will be asked
34 | if you wish to add the remote host to a list of known hosts, looking
35 | something like this:
36 | 
37 | ```
38 | The authenticity of host 'remote.host.net(213.9.122.134)' can't be established.
39 | RSA key fingerprint is 53:b4:ad:c8:51:17:99:4b:c9:08:ac:c1:b6:05:71:9b.
40 | Are you sure you want to continue connecting (yes/no)?
41 | ```
42 | 
43 | You are asked to confirm your intention to connect because SSH cannot
44 | guarantee that the remote host is really the host you intend to
45 | connect to --- it simply has never encounter this host before, so it
46 | cannot validate the fingerprint against a record from a previous
47 | connection.  The only way to be sure that the machine is indeed the
48 | one you want to connect to is to compare the fingerprint manually, but
49 | this is not feasible for people without physical access to the
50 | machine.
51 | 
52 | When connecting to a cluster node on a local network you can be
53 | reasonably sure that the connection is safe.  Type `yes` and press
54 | enter to continue.  Your SSH client will record the fingerprint for
55 | this host and prevent you from connecting to a host with the same name
56 | but a different fingerprint to prevent a man-in-the-middle attack.
57 | 
58 | Upon establishing a connection a shell session will be started.
59 | Confirm that you are on a remote system by running `hostname`.
60 | 
61 | 
62 | ## X11 forwarding
63 | 
64 | This is a useful feature of SSH because it enables you to see windows
65 | and bitmap information on the remote host. That means you can use
66 | programs with a user-interface and can see the visual output of your
67 | work such as R or matlab plots.
68 | 
69 | To use this feature, you need to use -X or -Y option with SSH. See below:
70 | 
71 |     ssh -X username@remote.host.com
72 | 
73 | or
74 | 
75 |     ssh -Y username@remote.host.com
76 | 
77 | You can check if X11 forwarding works by typing `echo $DISPLAY`, this
78 | should return something like `localhost:18.0`; it should not return an
79 | empty string.
80 | 
81 | To test if this is working, run `xeyes` on the remote host.  A window
82 | should appear on your machine.  While the programme runs on the remote
83 | host, the window contents are forwarded (hence the name) to your local
84 | machine.  This also works with more complicated applications, but
85 | performance may be inadequate when doing this over a poor connection.
86 | 


--------------------------------------------------------------------------------
/pages/unix_for_beginners/editing_and_manipulating_files.md:
--------------------------------------------------------------------------------
 1 | # Editing, viewing and concatenating text files
 2 | In many cases, you would want to see what is in a text file or edit a file, or create one from scratch. There are multiple ways to view the files.
 3 | 
 4 | 
 5 | ### cat : print the content of a file
 6 | `cat` will print the whole content of the text file to your shell, if you don't redirect the output to another file. Here is how it works:
 7 | ```
 8 | $ cat log.txt
 9 | AD 123
10 | AA 233
11 | Ad 443
12 | $
13 | ```
14 | 
15 | ### head or tail: Print beginning or end of a file
16 | If you would like to display only the beginning of a file or the end, you can use `head` or `tail`. `head` shows the beginning and `tail` the end. Here we look at beginning and the end of `example.fastq` file, which contains reads from a next-generation sequencing experiment.
17 | 
18 | ```
19 | $ head example.fastq
20 | @DJG60NM1:206:C2L3LACXX:1:1101:1934:1996 1:N:0:GCCAAT
21 | NTTTGTAGAACCTTTTGTAATTCTGCTTATATTGGTAGCCAATGCAATTGT
22 | +
23 | #1=DFFFFHHHHHIJJIIIIJJFIJJJJIJJJJIIIJJIJJIJIJJIIJJG
24 | @DJG60NM1:206:C2L3LACXX:1:1101:2193:1996 1:N:0:GCCAAT
25 | NGAATCACCCCTTTAAATCCCCTAGAAGTACCCCTTCTAAATACATCAGTC
26 | +
27 | #1=DDDFFHHHHHJIIJIJIJJGIGIHI?FHGIJIJIJIJIFIEEIGJBBE
28 | @DJG60NM1:206:C2L3LACXX:1:1101:2277:1999 1:N:0:GCCAAT
29 | NTTTAATAATGCGCTCCCCAAACAGAACAGCACCACCACTGGGGTCTCCGT
30 | $
31 | $
32 | $ tail example.fastq
33 | @DJG60NM1:206:C2L3LACXX:1:1101:2023:1996 1:N:0:CAGATC
34 | NTTGAAGTTAAATTTGGGAACTCATAGGAAATAAAGGAGCATGAACCAAGG
35 | +
36 | #1=DDDFFHHHHHJJIJJIJJJJIJJJJIIJJJJJJJJJJJJIJJJJJJJI
37 | @DJG60NM1:206:C2L3LACXX:1:1101:2057:2000 1:N:0:CAGATC
38 | NGGTTGGTGGGCTGATGTCTATAAGTACTAGGGTAGCTCCTCCGATTAGAT
39 | +
40 | #1:4ABDDDDD?D@DEEEBFFFEIEEBBEDD;BC?DEDEBBDDD6BD@B8B
41 | @DJG60NM1:206:C2L3LACXX:1:1101:2305:1999 1:N:0:CAGATC
42 | NGTATTTCATGTGGTATAAGCATCTGGATAATCAGAGTAACGACGAGGTAT
43 | ```
44 | 
45 | ### more and less: Read files page by page
46 | In some cases, you may want to look at a large file page by page. If you use `cat`, the whole file will be printed at once. It is inconvenient to use that if you want to inspect a large file. Instead you can use `more` or `less`, to view the files page by page.
47 | 
48 | 
49 | ### creating text files with echo
50 | `echo` command prints the argument on the shell. See the following example.
51 | 
52 | ```
53 | $ echo hello world
54 | hello world
55 | $
56 | $ echo here it is
57 | here it is
58 | ```
59 | However, you can also use echo to write files using `>`. When you finish typing just add `> filename.txt` and the output will be written on `filename.txt`
60 | 
61 | ```
62 | $ echo hello world > myfile.txt
63 | $
64 | $ cat myfile.txt
65 | hello world
66 | $
67 | ```
68 | 
69 | ## Editing and creating files using Emacs
70 | Emacs is a text editor that you can invoke using `emacs` shell command. It is a powerfull text editor used by programmers and system adminstrators to create and manipulate text file, as well as, writing programs. Detailed introductions to emacs is beyond the scope of this document, but you can [follow this link](https://www.gnu.org/software/emacs/tour/) to learn more about emacs.
71 | 
72 | You can open a text document using the `emacs filename` command. Once Emacs is started, you can type the content of the text file using your keyboard and save the file using `C-x C-s`, which means you have to type Ctrl+x then Ctrl+s, and your file will be saved. You can quit an Emacs session using `C-x C-c`.
73 | 
74 | 
75 | # Editing and creating text files using vi
76 | vi is another popular text editor with a somewhat arcane modal command language.  Like Emacs it has a devoted user community. People [often argue](http://en.wikipedia.org/wiki/Editor_war) which one is the best. Long story short, Emacs is the best (and it has support for vi-like operation with `evil-mode`). But if you want to learn more about vi, [follow this link](http://www.howtogeek.com/102468/a-beginners-guide-to-editing-text-files-with-vi/).
77 | 
78 | 


--------------------------------------------------------------------------------
/pages/unix_for_beginners/file_management_and_directories.md:
--------------------------------------------------------------------------------
  1 | # File management and directories
  2 | 
  3 | 
  4 | 
  5 | ### Directories
  6 | File and directory paths in UNIX use the forward slash "/"
  7 | to separate directory names in a path. If you are using a server your shell will start from /home/yourUserName/ directory. Also have a look at the conventional directory layout [here](http://en.wikipedia.org/wiki/Unix_filesystem#Conventional_directory_layout).
  8 | 
  9 | Here are a few examples of the directory strcucture:
 10 | 
 11 | | directory | explanation |
 12 | | -- | -- |
 13 | | `/` | "root" directory |
 14 | | `/usr`  | directory usr (sub-directory of / "root" directory)|
 15 | | `/usr/local` | local is a subdirectory of /usr |
 16 | 
 17 | #### Creating a directory
 18 | 
 19 | **mkdir** command creates a new directory. The command below creates a new directory named "newDir" under the current directory.
 20 | ```
 21 | $ mkdir newDir
 22 | ```
 23 | 
 24 | This command creates a new directory in user's home directory.
 25 | ```
 26 | $ mkdir ~/newDir
 27 | ```
 28 | 
 29 | The next command creates a the target directory and all the non-existing directories in the path. The command will create samtools directory, and will create "opt" directory if it does not exist. All of this will be done in user's home directory as indicated by "~/" in that path.
 30 | 
 31 | ```
 32 | $ mkdir -p ~/opt/samtools
 33 | ```
 34 | 
 35 | ### Moving around the file system with cd
 36 | ***cd*** command stands for "change directory" lets you move around the file system. Here are a few examples of the ***cd*** command and ***pwd***.
 37 | 
 38 | Type variants of these to your shell to move around your file system.
 39 | 
 40 | | Command + arguments| explanation |
 41 | | -- | -- |
 42 | | `pwd`  |Show the "present working directory", or current directory. |
 43 | | `cd` | Change current directory to your HOME directory. |
 44 | | `cd /usr/local` |Change current directory to /usr/local  |
 45 | | `cd INIT` | change current directory to INIT which is a sub-directory of the current |
 46 | | `cd ..` | Change current directory to the parent directory of the current|
 47 | | `cd ~akalin`| Change the current directory to the user akalin's home directory (if you have permission).|
 48 | 
 49 | 
 50 | 
 51 | ### Listing directory contents
 52 | ***ls*** command lists the contets of a directory. It can take multiple options, some of those are explained below.
 53 | 
 54 | | commands | explanation |
 55 | | -- | -- |
 56 | | `ls`| list a directory |
 57 | | `ls -l` | list a directory in detailed format including **file sizes** and **permissions** |
 58 | | `ls -a` | List the current directory including hidden files. Hidden files start with "." |
 59 | | `ls -ld *` | List all the file and directory names in the current directory using  long format. Without the "d" option, ls would list the contents of any sub-directory of the current. With the "d" option, ls just lists them like regular files. |
 60 | | `ls -lh ` | list detailed format this time file sizes are human readable not in bytes |
 61 | 
 62 | 
 63 | 
 64 | 
 65 | ### Moving, renaming and copying files
 66 | ***cp*** command **copies** the files and ***mv*** command **moves** the files. They are generally used with two main arguments. `cp target_file destination_file` or `mv target_file destination_file`.
 67 | 
 68 | | commands | explanation |
 69 | | -- | -- |
 70 | |`cp file1 file2`|          copy file1 as file2
 71 | |`cp /data/seq_data/file1  ~/`|          copy file1 at /data/seq_data to your home directory.
 72 | |`mv file1 newname` |        move or rename a file|
 73 | |`mv file1 ~/opt/` |         move file1 into sub-directory opt in your home directory.|
 74 | 
 75 | ### Finding files
 76 | There are a couple of ways you can find files in your file system. We will show the **find** command, it works in the following syntax `find directory -name targetfile`. It is useful when you have a rough idea about file location.
 77 | 
 78 | The following finds all files ending in ".html" under /home/user directory.
 79 | ```
 80 | $ find /home/user -name "*.html"
 81 | ```
 82 | find can also do more than just finding files. It also execute commands on the files you find via -exec option. The following command finds all files in the current directory with ".txt" ending and counts the number of lines in every text file. The '{}' is replaced by the name of each file found and the ';' ends the -exec clause.
 83 | 
 84 | ```
 85 | $ find . -name "*.txt" -exec wc -l '{}' ';'
 86 | 
 87 | ```
 88 | 
 89 | Another command that can find files is **locate**.
 90 | The locate command provides a faster way of locating all files whose names match a particular search string. For example:
 91 | ```
 92 |  $ locate ".txt"
 93 | ```
 94 | will find all filenames in the filesystem that contain ".txt" anywhere in their full paths.
 95 | 
 96 | A disadvantage of locate is that it stores all filenames on the system in an index that is usually updated only once a day. This means locate will not find files that have been created very recently.
 97 | 
 98 | ### Searching the contents of a text file
 99 | Often times you would need search a file for existence of certain characters or words. Imagine that you need to find gene ids in a text file containing some scores and gene ids, you would like to get the line(s) that contains your gene id of interest. This is similar to "find" functions in modern text processors such as MS Word. This can be achieved via **grep commmand**. Syntax of the command is: `grep options pattern files`
100 | 
101 | | Command | Explanation |
102 | | -- | -- |
103 | | `grep id1 genes.txt` | searches and prints lines matching "id1" in "genes.txt" |
104 | | `grep id1 *.txt` | searches and prints lines matching "id1" in files ending with ".txt" |
105 | |`grep -vi id1 *.txt`   |  similar to above, but -i option ignores the case (Id1,ID1,iD1 and id1 treated equally), -v option prints lines that don't match the pattern   |
106 | 
107 | #### using grep and find together
108 | You can search all files in an entire directory tree for a particular pattern by combining **grep** and **find**. The following command prints lines containing "genes" string, from the files 'find . -name "*.txt" -print' found.
109 | 
110 |     $ grep genes `find . -name "*.txt" -print`
111 | 
112 | The search patterns that grep uses are a special
113 | named **regular expressions**. You can have more comlicated searches using regular expressions, but that is more of an advanced application. See [] for more on that.
114 | 
115 | ### See disk usage and free disk space with du and df
116 | 
117 | ### Deleting files and directories
118 | Use these with caution.
119 | 


--------------------------------------------------------------------------------
/pages/unix_for_beginners/more_on_unix.md:
--------------------------------------------------------------------------------
1 | # More on Unix...
2 | Here goes further info and links: particulary more about shell scripting and awk/sed type of things.
3 | 


--------------------------------------------------------------------------------
/pages/unix_for_beginners/shell_scripting_bash.md:
--------------------------------------------------------------------------------
  1 | # Shell scripting (bash)
  2 | 
  3 | ## What is a shell script?
  4 | A shell script is a text file with a list of shell commands and it is executed like a program to perform a task or a set of tasks. The primary aim of a shell script is to automate tasks and save time. **It is important to understand basic structure of a shell script, since it is you interact with a computing clusters via shell scripts (See next chapter on Grid Engine)**
  5 | 
  6 | ## what is Bash ?
  7 | There are many different shells available in Unix-like systems. The Bourne Again Shell (Bash) is one of them, it is the default shell on GNU/Linux systems. It has some advantages to other shells and is pretty much the standard shell, and we will show how to use it for scripting below.
  8 | 
  9 | ## Writing a simple bash shell script
 10 | A basic shell script is just a series of commands. That is what we will show next.
 11 | 
 12 | Let us write a simple script that outputs "hello world" on the screen using the `echo` command. We will save the text file as `myScript.sh`
 13 | 
 14 | ```
 15 |   #!/bin/bash
 16 |   echo Hello World
 17 | ```
 18 | **executing a shell script**
 19 | syntax:`bash your-script-name`. In our case, we write:
 20 | 
 21 | ```
 22 | $ bash myScript.sh
 23 | Hello World
 24 | ```
 25 | ### more complicated example
 26 | Let's write a bit more complicated script using more of the shell commands. The script uses the `ls` to list the files and uses `wc -l` command which counts number of lines in a given file or standard input. In this case, `wc -l` counts the number of lines in the output of `ls -l`. All this achieved by using pipe `|`.
 27 | 
 28 | contents of script.sh:
 29 | ```
 30 |  #!/bin/bash
 31 |  echo here are the list of files
 32 |  ls -l
 33 | 
 34 |  echo  The number of files:
 35 |  ls -l | wc -l
 36 | 
 37 | ```
 38 | We can execute it as follows:
 39 | ```
 40 | $ bash script.sh
 41 | ```
 42 | ### variables in bash scripts
 43 | You can also use variables in bash scripts. Which are useful to capture the output of intermediate commands and use them to run other commands.There are no data types for variables. A variable in bash can contain any of the following: a number, a character or a string of characters.
 44 | 
 45 | You do not need to declare a variable, just assigning a value to its reference will create it.
 46 | 
 47 | Now we will create a simple script with one variable. We will assign `Hello world` string to that variable and print that variable with `echo`.
 48 | ```
 49 |  #!/bin/bash
 50 |  VAR="Hello world"
 51 | 
 52 |  echo  $VAR
 53 | 
 54 | ```
 55 | When assigning the variable we did not use the `$` sign, but when using the variable we had to use the `$` sign.
 56 | 
 57 | ### command line arguments in bash scripts
 58 | The script can also take command line arguments. Here we modify the script that lists the file to take a command line argument. The argument will be a path to a directory.
 59 | 
 60 | 
 61 | contents of script2.sh:
 62 | ```
 63 |  #!/bin/bash
 64 |  VAR=$1
 65 |  echo here are the list of files
 66 |  ls -l $VAR
 67 | 
 68 |  echo  The number of files:
 69 |  ls -l $VAR | wc -l
 70 | 
 71 | ```
 72 | 
 73 | Here is how you run the script:
 74 | ```
 75 | $ bash script2.sh /home/user/project
 76 | ```
 77 | The arguments are stored in variables with a number in the order of the argument starting at 1
 78 | * First Argument: $1
 79 | * Second Argument: $2
 80 | * and so on...
 81 | 
 82 | In the our case, `$1` corresponds to `/home/user/project`.
 83 | 
 84 | 
 85 | ### Arithmetic operations bash scripts
 86 | Arithmetic operations on integers in bash are done in the following format:
 87 | ```
 88 | #!/bin/bash
 89 | x=6
 90 | y=2
 91 | $((10 - 5))
 92 | $((x-y))
 93 | 
 94 | echo $((x-y))
 95 | echo $((10-5))
 96 | ```
 97 | You can also copy paste these commands to the console to see how they work. The `echo` commands should output `4` and `5`.
 98 | 
 99 | Bash arithmetic does not support floating points (e.g. 1.3 -1  operation will not work in bash), you need to use `bc` command. See [this stackOverflow example](http://stackoverflow.com/questions/12147040/division-in-script-and-floating-point) for an example on how to use  `bc`.
100 | 
101 | ### Looping over files
102 | If you are trying to automate a task using bash scripting, it is very likely you will have to apply certain commands on each file in a directory. This could be achieved with wild character`*` and `for` loops. The following script stores all the '.txt' files in `/path/to` directory in `FILES` variable. Then, for each file it calculates number of lines and outputs that with `wc -l` command.
103 | 
104 | ```
105 | #!/bin/bash
106 | FILES=/path/to/*.txt
107 | for f in $FILES
108 | do
109 |   echo "Processing $f file..."
110 |   # count number of lines and output that for file $f
111 |   wc -l $f
112 | done
113 | 
114 | ```
115 | 
116 | 
117 | ## More on bash scripts
118 | You can write even more complicated shell scripts using control structures (if/else, for/while loops) and achieve a lot just using the shell scripting, but that is beyond the scope of the document. See the links below if you want to get better at writing shell scripts.
119 | 
120 | 
121 | * http://www.freeos.com/guides/lsst/
122 | * http://www.tldp.org/LDP/Bash-Beginners-Guide/html/
123 | 


--------------------------------------------------------------------------------
/template.html:
--------------------------------------------------------------------------------
  1 | <!DOCTYPE HTML>
  2 | <html lang="en">
  3 |   <head>
  4 |     <meta charset="UTF-8">
  5 |     <meta content="text/html; charset=utf-8" http-equiv="Content-Type">
  6 |     <title>$title$</title>
  7 |     <meta http-equiv="X-UA-Compatible" content="IE=edge" />
  8 |     <meta name="description" content="">
  9 |     <link rel="stylesheet" href="/intro2UnixandSGE/gitbook/style.css">
 10 |     <link rel="stylesheet" href="/intro2UnixandSGE/gitbook/website.css">
 11 |     <meta name="HandheldFriendly" content="true"/>
 12 |     <meta name="viewport" content="width=device-width, initial-scale=1, user-scalable=no">
 13 |     <meta name="apple-mobile-web-app-capable" content="yes">
 14 |     <meta name="apple-mobile-web-app-status-bar-style" content="black">
 15 |     <link rel="apple-touch-icon-precomposed" sizes="152x152" href="gitbook/images/apple-touch-icon-precomposed-152.png">
 16 |     <link rel="shortcut icon" href="favicon.ico" type="image/x-icon">
 17 |   </head>
 18 |   <body>
 19 |     <div class="book with-summary">
 20 |       <div class="book-summary">
 21 |         <div id="book-search-input" role="search">
 22 |           <input type="text" placeholder="Type to search" />
 23 |         </div>
 24 |         
 25 |         <nav class="summary" id="$idprefix$TOC" role="doc-toc">
 26 |           $navigation$
 27 |         </nav>
 28 |       </div>
 29 | 
 30 |       <div class="book-body">
 31 |         <div class="body-inner">
 32 |           <div class="book-header" role="navigation">
 33 |             <!-- Title -->
 34 |             <h1>
 35 |               <i class="fa fa-circle-o-notch fa-spin"></i>
 36 |               <a href="." >$title$</a>
 37 |             </h1>
 38 |           </div>
 39 |           <div class="page-wrapper" tabindex="-1" role="main">
 40 |             <div class="page-inner">
 41 |               <div id="book-search-results">
 42 |                 <div class="search-noresults">
 43 |                   <section class="normal markdown-section">
 44 |                     $body$
 45 |                   </section>
 46 |                 </div>
 47 |                 <div class="search-results">
 48 |                   <div class="has-results">
 49 |                     <h1 class="search-results-title"><span class='search-results-count'></span> results matching "<span class='search-query'></span>"</h1>
 50 |                     <ul class="search-results-list"></ul>
 51 |                   </div>
 52 |                   <div class="no-results">
 53 |                     <h1 class="search-results-title">No results matching "<span class='search-query'></span>"</h1>
 54 |                   </div>
 55 |                 </div>
 56 |               </div>
 57 |             </div>
 58 |           </div>
 59 |         </div>
 60 |       </div>
 61 |       <script>
 62 |         var gitbook = gitbook || [];
 63 |         gitbook.push(function() {
 64 |           gitbook.page.hasChanged(
 65 |             {
 66 |               "page":
 67 |               {
 68 |                 "title":"$title$",
 69 |                 "level":"$level$",
 70 |                 "depth":1,
 71 |                 "next":{},
 72 |                 "dir":"ltr"
 73 |               },
 74 |               "config":
 75 |               {
 76 |                 "gitbook":"*",
 77 |                 "theme":"default",
 78 |                 "variables":{},
 79 |                 "plugins":[],
 80 |                 "pluginsConfig":
 81 |                 {
 82 |                   "highlight":{},
 83 |                   "search":{},
 84 |                   "lunr": {
 85 |                     "maxIndexSize":1000000,
 86 |                     "ignoreSpecialCharacters":false
 87 |                   },
 88 |                   "sharing": {
 89 |                     "facebook":true,
 90 |                     "twitter":true,
 91 |                     "google":false,
 92 |                     "weibo":false,
 93 |                     "instapaper":false,
 94 |                     "vk":false,
 95 |                     "all":[
 96 |                       "facebook",
 97 |                       "google",
 98 |                       "twitter",
 99 |                       "weibo",
100 |                       "instapaper"
101 |                     ]},
102 |                   "fontsettings": {
103 |                     "theme":"white",
104 |                     "family":"sans",
105 |                     "size":2
106 |                   },
107 |                   "theme-default": {
108 |                     "styles": {
109 |                       "website":"styles/website.css",
110 |                       "pdf":"styles/pdf.css",
111 |                       "epub":"styles/epub.css",
112 |                       "mobi":"styles/mobi.css",
113 |                       "ebook":"styles/ebook.css",
114 |                       "print":"styles/print.css"
115 |                     },
116 |                     "showLevel":false
117 |                   }
118 |                 },
119 |                 "structure": {
120 |                   "langs":"LANGS.md",
121 |                   "readme":"README.md",
122 |                   "glossary":"GLOSSARY.md",
123 |                   "summary":"SUMMARY.md"
124 |                 },
125 |                 "pdf": {
126 |                   "pageNumbers":true,
127 |                   "fontSize":12,
128 |                   "fontFamily":"Arial",
129 |                   "paperSize":"a4",
130 |                   "chapterMark":"pagebreak",
131 |                   "pageBreaksBefore":"/",
132 |                   "margin": {
133 |                     "right":62,"left":62,"top":56,"bottom":56
134 |                   }
135 |                 },
136 |                 "styles": {
137 |                   "website":"styles/website.css",
138 |                   "pdf":"styles/pdf.css",
139 |                   "epub":"styles/epub.css",
140 |                   "mobi":"styles/mobi.css",
141 |                   "ebook":"styles/ebook.css",
142 |                   "print":"styles/print.css"
143 |                 }
144 |               },
145 |               "file": {
146 |                 "path":"$filename$",
147 |                 "mtime":"$date$",
148 |                 "type":"markdown"
149 |               },
150 |               "gitbook": {
151 |                 "version":"3.2.3",
152 |                 "time":"2019-07-08T15:24:30.549Z"
153 |               },
154 |               "basePath":".",
155 |               "book": {"language":""}});
156 |         });
157 |     </script>
158 |     </div>
159 |     <script src="https://code.jquery.com/jquery-3.5.1.min.js"></script>
160 |     <script src="/intro2UnixandSGE/gitbook/gitbook.js"></script>
161 |     <script src="/intro2UnixandSGE/gitbook/theme.js"></script>
162 |     <script src="/intro2UnixandSGE/gitbook/gitbook-plugin-search/search-engine.js"></script>
163 |     <script src="/intro2UnixandSGE/gitbook/gitbook-plugin-search/search.js"></script>
164 |     <script src="/intro2UnixandSGE/gitbook/gitbook-plugin-lunr/lunr.js"></script>
165 |     <script src="/intro2UnixandSGE/gitbook/gitbook-plugin-lunr/search-lunr.js"></script>
166 |     <script src="/intro2UnixandSGE/gitbook/gitbook-plugin-sharing/buttons.js"></script>
167 |     <script src="/intro2UnixandSGE/gitbook/gitbook-plugin-fontsettings/fontsettings.js"></script>
168 |   </body>
169 | </html>
170 | 


--------------------------------------------------------------------------------
/template.json:
--------------------------------------------------------------------------------
1 |   {
2 |     "url":"$url$",
3 |     "title":"$pagetitle$",
4 |     "keywords":"$keywords$",
5 |     "body":"$body$"
6 |   },
7 | 


--------------------------------------------------------------------------------