├── .gitattributes
├── LICENSE
├── README.md
├── bin
    ├── gtf_extract_gene_regions.py
    ├── gtf_extract_transcript_regions.py
    └── rnaprot
├── docs
    └── framework_overview.png
├── rnaprot
    ├── RNNNets.py
    ├── __init__.py
    ├── content
    │   ├── logo1.png
    │   ├── logo2.png
    │   ├── plotly-latest.min.js
    │   └── sorttable.js
    ├── rnn_util.py
    ├── rplib.py
    └── test_data
    │   ├── empty_file
    │   ├── feat_666.bed
    │   ├── feat_666_1.exp.out
    │   ├── feat_666_2.exp.out
    │   ├── feat_in.bed
    │   ├── feat_old_nick.bed
    │   ├── feat_old_nick_1.exp.out
    │   ├── feat_old_nick_2.exp.out
    │   ├── file1
    │   ├── file2
    │   ├── gene_test_in.gtf
    │   ├── gtf_exon_out.bed
    │   ├── gtf_exon_out_exp.bed
    │   ├── gtf_gene_out.exp.bed
    │   ├── gtf_intron_out.bed
    │   ├── gtf_intron_out_exp.bed
    │   ├── gtf_transcript_out.exp.bed
    │   ├── map_test_in.bed
    │   ├── map_test_in.gtf
    │   ├── map_test_out_all_unique.bed
    │   ├── map_test_out_transcript_stats.out
    │   ├── negatives.bed
    │   ├── negatives.bpp
    │   ├── negatives.con
    │   ├── negatives.entr
    │   ├── negatives.fa
    │   ├── negatives.sf
    │   ├── negatives.str_elem.up
    │   ├── negatives.up
    │   ├── new_format.eia
    │   ├── positives.bed
    │   ├── positives.bpp
    │   ├── positives.con
    │   ├── positives.entr
    │   ├── positives.fa
    │   ├── positives.sf
    │   ├── positives.str_elem.up
    │   ├── positives.up
    │   ├── test.bpp
    │   ├── test.con
    │   ├── test.elem_p.str
    │   ├── test.entr
    │   ├── test.exon_intron_labels
    │   ├── test.fa
    │   ├── test.ids
    │   ├── test.pp.con
    │   ├── test.region_labels
    │   ├── test.sf
    │   ├── test.sorted.bed
    │   ├── test.sorted.merged.exp.bed
    │   ├── test.str_elem.up
    │   ├── test.tra
    │   ├── test.up
    │   ├── test1.bed
    │   ├── test2.bed
    │   ├── test2.bpp
    │   ├── test2.con
    │   ├── test2.exon_intron_labels
    │   ├── test2.exp.bed
    │   ├── test2.exp.con
    │   ├── test2.exp.exon_intron_labels
    │   ├── test2.fa
    │   ├── test2.pp.con
    │   ├── test2.up
    │   ├── test3.bed
    │   ├── test3.fa
    │   ├── test4.bed
    │   ├── test4.exp.fa
    │   ├── test4.fa
    │   ├── test5.bed
    │   ├── test5.centered_zero_sc.bed
    │   ├── test5.exp.bed
    │   ├── test5.exp.fa
    │   ├── test6.bed
    │   ├── test7.exp.out
    │   ├── test7.feat.bed
    │   ├── test7.in.bed
    │   ├── test8.bed
    │   ├── test8.exp.rra
    │   ├── test_border_annot.exp.bed
    │   ├── test_border_annot.gtf
    │   ├── test_con.bed
    │   ├── test_con.bw
    │   ├── test_con.exp.con
    │   ├── test_con2.exp.con
    │   ├── test_eia.bed
    │   ├── test_eia.exp1.eia
    │   ├── test_eia.exp2.eia
    │   ├── test_eia.exp3.eia
    │   ├── test_eia.exp4.eia
    │   ├── test_eia.gtf
    │   ├── test_intersect.genes.bed
    │   ├── test_intersect.sites.bed
    │   ├── test_lengths_to_bed.exp.bed
    │   ├── test_most_prom_select.gtf
    │   ├── test_new_format.tra
    │   ├── test_seq_extr.chr_sizes
    │   ├── test_seq_extr.sequences.2bit
    │   ├── test_seq_extr.sequences.fa
    │   ├── test_seq_extr.sites.bed
    │   ├── test_seq_extr.sites.exp.fa
    │   ├── test_seq_feat.in
    │   ├── test_seq_feat_gp.exp.out
    │   ├── test_seq_feat_gp.in
    │   ├── test_seq_feat_neg.exp.out
    │   ├── test_seq_feat_pos.exp.out
    │   ├── test_settings.out
    │   ├── test_start_end.bed
    │   ├── test_start_end.exp.bed
    │   ├── test_tr2gen.bed
    │   ├── test_tr2gen.exp.bed
    │   ├── test_tr2gen.gtf
    │   ├── test_tr_annot.bed
    │   ├── test_tr_annot.codons.exp.tra
    │   ├── test_tr_annot.exp.tra
    │   ├── test_tr_annot.gtf
    │   ├── test_tr_annot_gtf.exp.bed
    │   ├── test_tsl_genes.exp.bed
    │   └── test_tsl_genes.gtf
├── setup.py
└── test
    ├── CDE_sites.bed
    ├── ENST00000314032.fa
    ├── NORAD_lncRNA.fa
    ├── PUM2_PARCLIP.negatives.fa
    ├── PUM2_PARCLIP.positives.fa
    └── cde_sites_str_model_folder.zip


/.gitattributes:
--------------------------------------------------------------------------------
1 | supplements export-ignore
2 | 


--------------------------------------------------------------------------------
/LICENSE:
--------------------------------------------------------------------------------
 1 | MIT License
 2 | 
 3 | Copyright (c) 2021 Michael Uhl
 4 | 
 5 | Permission is hereby granted, free of charge, to any person obtaining a copy
 6 | of this software and associated documentation files (the "Software"), to deal
 7 | in the Software without restriction, including without limitation the rights
 8 | to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
 9 | copies of the Software, and to permit persons to whom the Software is
10 | furnished to do so, subject to the following conditions:
11 | 
12 | The above copyright notice and this permission notice shall be included in all
13 | copies or substantial portions of the Software.
14 | 
15 | THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
16 | IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
17 | FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
18 | AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
19 | LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
20 | OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
21 | SOFTWARE.
22 | 


--------------------------------------------------------------------------------
/bin/gtf_extract_gene_regions.py:
--------------------------------------------------------------------------------
 1 | #!/usr/bin/env python3
 2 | 
 3 | from rnaprot import rplib
 4 | import subprocess
 5 | import argparse
 6 | import os
 7 | import re
 8 | 
 9 | 
10 | def setup_argument_parser():
11 |     """Setup argparse parser."""
12 |     help_description = """
13 |     Extract gene regions in BED format (6-col) from (Ensembl) GTF.
14 |     
15 |     """
16 |     # Define argument parser.
17 |     p = argparse.ArgumentParser(add_help=False,
18 |                                 prog="gtf_extract_gene_regions.py",
19 |                                 description=help_description,
20 |                                 formatter_class=argparse.MetavarTypeHelpFormatter)
21 | 
22 |     # Required arguments.
23 |     p.add_argument("-h", "--help",
24 |                    action="help",
25 |                    help="Print help message")
26 |     p.add_argument("--ids",
27 |                    dest="in_gene_ids",
28 |                    type=str,
29 |                    nargs='+',
30 |                    required = True,
31 |                    help = "Provide gene ID(s) to extract BED regions for (e.g. --ids ENSG00000223972 ENSG00000227232) from --gtf. NOTE1 that IDs must be provided without version number. NOTE2 --ids also accepts a file with gene IDs (one ID per row)")
32 |     p.add_argument("--gtf",
33 |                    dest="in_gtf",
34 |                    type=str,
35 |                    metavar='str',
36 |                    required = True,
37 |                    help = "Genomic annotations GTF file (.gtf or .gtf.gz)")
38 |     p.add_argument("--out",
39 |                    dest="out_bed",
40 |                    type=str,
41 |                    required = True,
42 |                    help = "Output BED file")
43 |     return p
44 | 
45 | 
46 | 
47 | if __name__ == '__main__':
48 | 
49 |     parser = setup_argument_parser()
50 |     args = parser.parse_args()
51 |     
52 |     assert os.path.exists(args.in_gtf), "input .gtf file \"%s\" not found" %(args.in_gtf)
53 |     
54 |     gene_ids_dic = {}
55 |     if len(args.in_gene_ids) == 1 and os.path.exists(args.in_gene_ids[0]):
56 |         gene_ids_dic = rplib.read_ids_into_dic(args.in_gene_ids[0],
57 |                                                check_dic=False)
58 |         assert gene_ids_dic, "no gene IDs read in from %s" %(args.in_gene_ids[0])
59 |     else:
60 |         for gene_id in args.in_gene_ids:
61 |             gene_ids_dic[gene_id] = 1
62 |     assert gene_ids_dic, "no gene IDs read into gene_ids_dic"
63 | 
64 |     print("Extracting gene regions from GTF ... ")
65 |     rplib.gtf_extract_gene_bed(args.in_gtf, args.out_bed,
66 |                                gene_ids_dic=gene_ids_dic)
67 | 
68 |     bed_ids_dic = rplib.bed_get_region_ids(args.out_bed,
69 |                                            check_dic=False)
70 | 
71 |     assert bed_ids_dic, "no gene regions extracted from --gtf. Gene IDs provided via --ids must be present in --gtf"
72 | 
73 |     c_extracted = 0
74 |     for gene_id in gene_ids_dic:
75 |         if gene_id not in bed_ids_dic:
76 |             print("WARNING: no gene region extracted for --in gene ID %s" %(gene_id))
77 |         else:
78 |             c_extracted += 1
79 |     if c_extracted:
80 |         print("# of extracted gene regions:  %i" %(c_extracted))
81 |         print("Gene regions written to:\n%s" %(args.out_bed))
82 | 


--------------------------------------------------------------------------------
/bin/gtf_extract_transcript_regions.py:
--------------------------------------------------------------------------------
 1 | #!/usr/bin/env python3
 2 | 
 3 | from rnaprot import rplib
 4 | import subprocess
 5 | import argparse
 6 | import os
 7 | import re
 8 | 
 9 | 
10 | def setup_argument_parser():
11 |     """Setup argparse parser."""
12 |     help_description = """
13 |     Extract transcript regions in BED format (6-col) from (Ensembl) GTF.
14 |     
15 |     """
16 |     # Define argument parser.
17 |     p = argparse.ArgumentParser(add_help=False,
18 |                                 prog="gtf_extract_transcript_regions.py",
19 |                                 description=help_description,
20 |                                 formatter_class=argparse.MetavarTypeHelpFormatter)
21 | 
22 |     # Required arguments.
23 |     p.add_argument("-h", "--help",
24 |                    action="help",
25 |                    help="Print help message")
26 |     p.add_argument("--ids",
27 |                    dest="in_tr_ids",
28 |                    type=str,
29 |                    nargs='+',
30 |                    required = True,
31 |                    help = "Provide transcript ID(s) to extract BED regions for (e.g. --ids ENST00000456328 ENST00000488147) from --gtf. NOTE1 that IDs must be provided without version number. NOTE2 --ids also accepts a file with transcript IDs (one ID per row)")
32 |     p.add_argument("--gtf",
33 |                    dest="in_gtf",
34 |                    type=str,
35 |                    metavar='str',
36 |                    required = True,
37 |                    help = "Genomic annotations GTF file (.gtf or .gtf.gz)")
38 |     p.add_argument("--out",
39 |                    dest="out_bed",
40 |                    type=str,
41 |                    required = True,
42 |                    help = "Output BED file")
43 |     return p
44 | 
45 | 
46 | 
47 | if __name__ == '__main__':
48 | 
49 |     parser = setup_argument_parser()
50 |     args = parser.parse_args()
51 |     
52 |     assert os.path.exists(args.in_gtf), "input .gtf file \"%s\" not found" %(args.in_gtf)
53 |     
54 |     tr_ids_dic = {}
55 |     if len(args.in_tr_ids) == 1 and os.path.exists(args.in_tr_ids[0]):
56 |         tr_ids_dic = rplib.read_ids_into_dic(args.in_tr_ids[0],
57 |                                                check_dic=False)
58 |         assert tr_ids_dic, "no transcript IDs read in from %s" %(args.in_tr_ids[0])
59 |     else:
60 |         for tr_id in args.in_tr_ids:
61 |             tr_ids_dic[tr_id] = 1
62 |     assert tr_ids_dic, "no transcript IDs read into tr_ids_dic"
63 | 
64 |     print("Extracting transcript regions from GTF ... ")
65 |     tr_len_dic = rplib.gtf_get_transcript_lengths(args.in_gtf)
66 |     assert tr_len_dic, "no transcript lengths extracted from --gtf %s" %(args.in_gtf)
67 | 
68 |     c_miss = 0
69 |     c_found = 0
70 |     for tr_id in tr_ids_dic:
71 |         if tr_id not in tr_len_dic:
72 |             print("WARNING: --in transcript ID %s has no entry in --gtf" %(tr_id))
73 |         else:
74 |             c_found += 1
75 |     assert c_found, "no --gtf entries for any --in transcript IDs"
76 |     rplib.bed_sequence_lengths_to_bed(tr_len_dic, args.out_bed,
77 |                                       ids_dic=tr_ids_dic)
78 | 
79 |     print("# of extracted transcript regions:  %i" %(c_found))
80 |     print("Transcript regions written to:\n%s" %(args.out_bed))
81 | 
82 | 


--------------------------------------------------------------------------------
/docs/framework_overview.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/BackofenLab/RNAProt/6091c9882d0355e3457607f12ee43ddf82cbb11b/docs/framework_overview.png


--------------------------------------------------------------------------------
/rnaprot/RNNNets.py:
--------------------------------------------------------------------------------
  1 | import torch
  2 | from torch.utils.data import Dataset
  3 | from torch.nn.utils.rnn import pack_padded_sequence
  4 | import torch.nn as nn
  5 | import torch.nn.functional as F
  6 | import sys
  7 | 
  8 | ###############################################################################
  9 | 
 10 | class RNNDataset(Dataset):
 11 |     def __init__(self, in_data, in_labels):
 12 |         self.data = in_data
 13 |         self.labels = in_labels
 14 | 
 15 |     def __len__(self):
 16 |         return len(self.data)
 17 | 
 18 |     def __getitem__(self, index):
 19 |         return self.data[index], self.labels[index]
 20 | 
 21 | 
 22 | ###############################################################################
 23 | 
 24 | class LSTMModel_old(nn.Module):
 25 |     def __init__(self, input_dim, hidden_dim, n_layer, n_class, device):
 26 |         super(LSTMModel_old, self).__init__()
 27 |         self.input_dim = input_dim
 28 |         self.hidden_dim = hidden_dim
 29 |         self.n_layer = n_layer
 30 |         self.lstm = nn.LSTM(self.input_dim, self.hidden_dim, self.n_layer, batch_first=True)
 31 |         self.fc = nn.Linear(self.hidden_dim, n_class)
 32 |         self.device = device
 33 | 
 34 |     def zero_state(self, batch_size):
 35 |         h0 = torch.zeros(self.n_layer, batch_size, self.hidden_dim, dtype=torch.float).requires_grad_().to(self.device)
 36 |         c0 = torch.zeros(self.n_layer, batch_size, self.hidden_dim, dtype=torch.float).requires_grad_().to(self.device)
 37 |         return h0, c0
 38 | 
 39 |     def forward(self, embed):
 40 |         embed = embed.cuda()
 41 |         batch_size = embed.batch_sizes[0].item()
 42 |         h0, c0 = self.zero_state(batch_size)
 43 |         out, (hidden, cell) = self.lstm(embed, (h0, c0))
 44 |         x = F.log_softmax(self.fc(hidden.float()), dim=-1)
 45 |         return x
 46 | 
 47 | 
 48 | ###############################################################################
 49 | 
 50 | class GRUModel_old(nn.Module):
 51 |     def __init__(self, input_dim, hidden_dim, n_layer, n_class, device,
 52 |                  dr=0.5):
 53 |         super(GRUModel_old, self).__init__()
 54 |         self.hidden_dim = hidden_dim
 55 |         self.n_layer = n_layer
 56 |         self.gru = nn.GRU(input_dim, hidden_dim, n_layer, batch_first=True)
 57 |         self.fc = nn.Linear(hidden_dim, n_class)
 58 |         self.device = device
 59 |         self.dr = dr
 60 | 
 61 |     def zero_state(self, batch_size):
 62 |         h0 = torch.zeros(self.n_layer, batch_size, self.hidden_dim, dtype=torch.float).requires_grad_().to(self.device)
 63 |         return h0
 64 | 
 65 |     def forward(self, embed):
 66 |         embed = embed.cuda()
 67 |         batch_size = embed.batch_sizes[0].item()
 68 |         h0 = self.zero_state(batch_size)
 69 |         out, hidden = self.gru(embed, h0.detach())
 70 |         x = F.dropout(hidden, p=self.dr, training=self.training)
 71 |         x = F.log_softmax(self.fc(x), dim=-1)
 72 |         return x
 73 | 
 74 | 
 75 | ###############################################################################
 76 | 
 77 | class GRUModel(nn.Module):
 78 |     def __init__(self, input_dim, n_class, device,
 79 |                  gru_n_layers=2,
 80 |                  gru_hidden_dim=32,
 81 |                  bidirect=True,
 82 |                  add_feat=False,
 83 |                  dropout_rate=0.5,
 84 |                  add_fc_layer=True,
 85 |                  embed=True,
 86 |                  embed_vocab_size=5,
 87 |                  embed_dim=10):
 88 | 
 89 |         super(GRUModel, self).__init__()
 90 | 
 91 |         self.bidirect = bidirect
 92 |         self.embed = embed
 93 |         self.add_feat = add_feat
 94 |         self.gru_n_layers = gru_n_layers
 95 |         self.gru_hidden_dim = gru_hidden_dim
 96 |         self.device = device
 97 |         self.add_fc_layer = add_fc_layer
 98 |         self.embedding = nn.Embedding(embed_vocab_size, embed_dim)
 99 |         # Dropout.
100 |         self.dropout = nn.Dropout(dropout_rate)
101 |         # GRU.
102 |         if embed:
103 |             if add_feat:
104 |                 self.gru = nn.GRU(embed_dim + (input_dim - 1), gru_hidden_dim, gru_n_layers,
105 |                                   bidirectional=bidirect, bias=True,
106 |                                   batch_first=True).to(device)
107 |             else:
108 |                 self.gru = nn.GRU(embed_dim, gru_hidden_dim, gru_n_layers,
109 |                                   bidirectional=bidirect, bias=True,
110 |                                   batch_first=True).to(device)
111 |         else:
112 |             self.gru = nn.GRU(input_dim, gru_hidden_dim, gru_n_layers,
113 |                               bidirectional=bidirect, bias=True,
114 |                               batch_first=True).to(device)
115 |         if bidirect:
116 |             if add_fc_layer:
117 |                 self.fc1 = nn.Linear(2*gru_hidden_dim, gru_hidden_dim)
118 |                 self.fc2 = nn.Linear(gru_hidden_dim, n_class)
119 |             else:
120 |                 self.fc = nn.Linear(2*gru_hidden_dim, n_class)
121 |         else:
122 |             if add_fc_layer:
123 |                 self.fc1 = nn.Linear(gru_hidden_dim, int(gru_hidden_dim/2))
124 |                 self.fc2 = nn.Linear(int(gru_hidden_dim/2), n_class)
125 |             else:
126 |                 self.fc = nn.Linear(gru_hidden_dim, n_class)
127 | 
128 | 
129 |     def zero_state(self, batch_size):
130 |         if self.bidirect:
131 |             h0 = torch.zeros(2*self.gru_n_layers, batch_size, self.gru_hidden_dim, dtype=torch.float).requires_grad_().to(self.device)
132 |         else:
133 |             h0 = torch.zeros(self.gru_n_layers, batch_size, self.gru_hidden_dim, dtype=torch.float).requires_grad_().to(self.device)
134 |         return h0
135 | 
136 | 
137 |     def forward(self, batch_data, batch_lens, batch_size):
138 |         h0 = self.zero_state(batch_size)
139 | 
140 |         if self.embed:
141 |             x_embed = self.embedding(batch_data[:, :, 0].long()).clone().detach().requires_grad_(True)
142 |             if self.add_feat:
143 |                 x_embed = torch.cat([x_embed, batch_data[:, :, 1:]], dim=2)
144 |         else:
145 |             # Without embedding.
146 |             x_embed = batch_data.clone().detach().requires_grad_(True)
147 | 
148 |         x_packed = pack_padded_sequence(x_embed, batch_lens, batch_first=True, enforce_sorted=False)
149 | 
150 |         if self.bidirect:
151 |             out, hidden = self.gru(x_packed, h0)
152 |             hidden = torch.cat([hidden[0], hidden[1]], dim=1).unsqueeze(0)
153 |         else:
154 |             out, hidden = self.gru(x_packed, h0)
155 | 
156 |         x = self.dropout(hidden)
157 | 
158 |         if self.add_fc_layer:
159 |             x = self.dropout(self.fc1(x))
160 |             x = self.fc2(x)
161 |         else:
162 |             x = self.fc(x)
163 | 
164 |         return x, x_embed
165 | 
166 | 
167 | ###############################################################################
168 | 
169 | class RNNModel(nn.Module):
170 |     def __init__(self, input_dim, n_class, device,
171 |                  rnn_type=1,
172 |                  rnn_n_layers=2,
173 |                  rnn_hidden_dim=32,
174 |                  bidirect=True,
175 |                  add_feat=False,
176 |                  dropout_rate=0.5,
177 |                  add_fc_layer=True,
178 |                  embed=True,
179 |                  embed_vocab_size=5,
180 |                  embed_dim=10):
181 | 
182 |         super(RNNModel, self).__init__()
183 | 
184 |         self.bidirect = bidirect
185 |         self.embed = embed
186 |         self.add_feat = add_feat
187 |         self.rnn_type = rnn_type
188 |         self.rnn_n_layers = rnn_n_layers
189 |         self.rnn_hidden_dim = rnn_hidden_dim
190 |         self.device = device
191 |         self.add_fc_layer = add_fc_layer
192 | 
193 |         # Embedding.
194 |         self.embedding = nn.Embedding(embed_vocab_size, embed_dim)
195 | 
196 |         # Dropout.
197 |         self.dropout = nn.Dropout(dropout_rate)
198 | 
199 |         # RNN layer.
200 |         if embed:
201 |             if add_feat:
202 |                 if rnn_type == 1:
203 |                     self.gru = nn.GRU(embed_dim + (input_dim - 1),
204 |                                       rnn_hidden_dim, rnn_n_layers,
205 |                                       bidirectional=bidirect, bias=True,
206 |                                       batch_first=True).to(device)
207 |                 else:
208 |                     self.lstm = nn.LSTM(embed_dim + (input_dim - 1),
209 |                                         rnn_hidden_dim, rnn_n_layers,
210 |                                         bidirectional=bidirect, bias=True,
211 |                                         batch_first=True).to(device)
212 | 
213 |             else:
214 |                 if rnn_type == 1:
215 |                     self.gru = nn.GRU(embed_dim, rnn_hidden_dim, rnn_n_layers,
216 |                                       bidirectional=bidirect, bias=True,
217 |                                       batch_first=True).to(device)
218 |                 else:
219 |                     self.lstm = nn.LSTM(embed_dim, rnn_hidden_dim, rnn_n_layers,
220 |                                        bidirectional=bidirect, bias=True,
221 |                                        batch_first=True).to(device)
222 |         else:
223 |             if rnn_type == 1:
224 |                 self.gru = nn.GRU(input_dim, rnn_hidden_dim, rnn_n_layers,
225 |                                   bidirectional=bidirect, bias=True,
226 |                                   batch_first=True).to(device)
227 |             else:
228 |                 self.lstm = nn.LSTM(input_dim, rnn_hidden_dim, rnn_n_layers,
229 |                                    bidirectional=bidirect, bias=True,
230 |                                    batch_first=True).to(device)
231 |         # FC layers.
232 |         if bidirect:
233 |             if add_fc_layer:
234 |                 self.fc1 = nn.Linear(2*rnn_hidden_dim, rnn_hidden_dim)
235 |                 self.fc2 = nn.Linear(rnn_hidden_dim, n_class)
236 |             else:
237 |                 self.fc = nn.Linear(2*rnn_hidden_dim, n_class)
238 |         else:
239 |             if add_fc_layer:
240 |                 self.fc1 = nn.Linear(rnn_hidden_dim, int(rnn_hidden_dim/2))
241 |                 self.fc2 = nn.Linear(int(rnn_hidden_dim/2), n_class)
242 |             else:
243 |                 self.fc = nn.Linear(rnn_hidden_dim, n_class)
244 | 
245 | 
246 |     def zero_state(self, batch_size):
247 |         if self.rnn_type == 1:
248 |             if self.bidirect:
249 |                 h0 = torch.zeros(2*self.rnn_n_layers, batch_size, self.rnn_hidden_dim, dtype=torch.float).requires_grad_().to(self.device)
250 |             else:
251 |                 h0 = torch.zeros(self.rnn_n_layers, batch_size, self.rnn_hidden_dim, dtype=torch.float).requires_grad_().to(self.device)
252 |             return h0
253 |         else:
254 |             if self.bidirect:
255 |                 h0 = torch.zeros(2*self.rnn_n_layers, batch_size, self.rnn_hidden_dim, dtype=torch.float).requires_grad_().to(self.device)
256 |                 c0 = torch.zeros(2*self.rnn_n_layers, batch_size, self.rnn_hidden_dim, dtype=torch.float).requires_grad_().to(self.device)
257 |             else:
258 |                 h0 = torch.zeros(self.rnn_n_layers, batch_size, self.rnn_hidden_dim, dtype=torch.float).requires_grad_().to(self.device)
259 |                 c0 = torch.zeros(self.rnn_n_layers, batch_size, self.rnn_hidden_dim, dtype=torch.float).requires_grad_().to(self.device)
260 |             return h0, c0
261 | 
262 | 
263 |     def forward(self, batch_data, batch_lens, batch_size):
264 |         if self.rnn_type == 1:
265 |             h0 = self.zero_state(batch_size)
266 |         else:
267 |             h0, c0 = self.zero_state(batch_size)
268 | 
269 |         if self.embed:
270 |             x_embed = self.embedding(batch_data[:, :, 0].long()).clone().detach().requires_grad_(True)
271 |             if self.add_feat:
272 |                 x_embed = torch.cat([x_embed, batch_data[:, :, 1:]], dim=2)
273 |                 x_embed = x_embed.clone().detach().requires_grad_(True)
274 |         else:
275 |             # Without embedding.
276 |             x_embed = batch_data.clone().detach().requires_grad_(True)
277 | 
278 |         x_packed = pack_padded_sequence(x_embed, batch_lens, batch_first=True, enforce_sorted=False)
279 | 
280 |         if self.rnn_type == 1:
281 |             if self.bidirect:
282 |                 out, hidden = self.gru(x_packed, h0)
283 |                 hidden = torch.cat([hidden[0], hidden[1]], dim=1).unsqueeze(0)
284 |             else:
285 |                 out, hidden = self.gru(x_packed, h0)
286 |         else:
287 |             if self.bidirect:
288 |                 out, (hidden, cell) = self.lstm(x_packed, (h0, c0))
289 |                 hidden = torch.cat([hidden[0], hidden[1]], dim=1).unsqueeze(0)
290 |             else:
291 |                 out, (hidden, cell) = self.lstm(x_packed, (h0, c0))
292 | 
293 |         x = self.dropout(hidden)
294 | 
295 |         if self.add_fc_layer:
296 |             x = self.dropout(self.fc1(x))
297 |             x = self.fc2(x)
298 |         else:
299 |             x = self.fc(x)
300 | 
301 |         #x = F.log_softmax(x, dim=-1)
302 | 
303 |         return x, x_embed
304 | 
305 | 
306 | ###############################################################################
307 | 
308 | class LSTMModel(nn.Module):
309 |     def __init__(self, input_dim, n_class, device,
310 |                  lstm_n_layers=2,
311 |                  lstm_hidden_dim=32,
312 |                  bidirect=True,
313 |                  add_feat=False,
314 |                  dropout_rate=0.5,
315 |                  add_fc_layer=True,
316 |                  embed=True,
317 |                  embed_vocab_size=5,
318 |                  embed_dim=10):
319 | 
320 |         super(LSTMModel, self).__init__()
321 | 
322 |         self.bidirect = bidirect
323 |         self.embed = embed
324 |         self.add_feat = add_feat
325 |         self.lstm_n_layers = lstm_n_layers
326 |         self.lstm_hidden_dim = lstm_hidden_dim
327 |         self.device = device
328 |         self.add_fc_layer = add_fc_layer
329 |         self.embedding = nn.Embedding(embed_vocab_size, embed_dim)
330 |         # Dropout.
331 |         self.dropout = nn.Dropout(dropout_rate)
332 |         # LSTM.
333 |         if embed:
334 |             if add_feat:
335 |                 self.lstm = nn.LSTM(embed_dim + (input_dim - 1), lstm_hidden_dim, lstm_n_layers,
336 |                                    bidirectional=bidirect, bias=True,
337 |                                    batch_first=True).to(device)
338 |             else:
339 |                 self.lstm = nn.LSTM(embed_dim, lstm_hidden_dim, lstm_n_layers,
340 |                                    bidirectional=bidirect, bias=True,
341 |                                    batch_first=True).to(device)
342 |         else:
343 |             self.lstm = nn.LSTM(input_dim, lstm_hidden_dim, lstm_n_layers,
344 |                                bidirectional=bidirect, bias=True,
345 |                                batch_first=True).to(device)
346 |         if bidirect:
347 |             if add_fc_layer:
348 |                 self.fc1 = nn.Linear(2*lstm_hidden_dim, lstm_hidden_dim)
349 |                 self.fc2 = nn.Linear(lstm_hidden_dim, n_class)
350 |             else:
351 |                 self.fc = nn.Linear(2*lstm_hidden_dim, n_class)
352 |         else:
353 |             if add_fc_layer:
354 |                 self.fc1 = nn.Linear(lstm_hidden_dim, int(lstm_hidden_dim/2))
355 |                 self.fc2 = nn.Linear(int(lstm_hidden_dim/2), n_class)
356 |             else:
357 |                 self.fc = nn.Linear(lstm_hidden_dim, n_class)
358 | 
359 | 
360 |     def zero_state(self, batch_size):
361 |         if self.bidirect:
362 |             h0 = torch.zeros(2*self.lstm_n_layers, batch_size, self.lstm_hidden_dim, dtype=torch.float).requires_grad_().to(self.device)
363 |             c0 = torch.zeros(2*self.lstm_n_layers, batch_size, self.lstm_hidden_dim, dtype=torch.float).requires_grad_().to(self.device)
364 |         else:
365 |             h0 = torch.zeros(self.lstm_n_layers, batch_size, self.lstm_hidden_dim, dtype=torch.float).requires_grad_().to(self.device)
366 |             c0 = torch.zeros(self.lstm_n_layers, batch_size, self.lstm_hidden_dim, dtype=torch.float).requires_grad_().to(self.device)
367 |         return h0, c0
368 | 
369 | 
370 |     def forward(self, batch_data, batch_lens, batch_size):
371 |         h0, c0 = self.zero_state(batch_size)
372 | 
373 |         if self.embed:
374 |             x_embed = self.embedding(batch_data[:, :, 0].long()).clone().detach().requires_grad_(True)
375 |             if self.add_feat:
376 |                 x_embed = torch.cat([x_embed, batch_data[:, :, 1:]], dim=2)
377 |         else:
378 |             x_embed = batch_data.clone().detach().requires_grad_(True)
379 | 
380 |         x_packed = pack_padded_sequence(x_embed, batch_lens, batch_first=True, enforce_sorted=False)
381 | 
382 |         if self.bidirect:
383 |             out, (hidden, cell) = self.lstm(x_packed, (h0, c0))
384 |             hidden = torch.cat([hidden[0], hidden[1]], dim=1).unsqueeze(0)
385 |         else:
386 |             out, (hidden, cell) = self.lstm(x_packed, (h0, c0))
387 | 
388 |         x = self.dropout(hidden)
389 | 
390 |         if self.add_fc_layer:
391 |             x = self.dropout(self.fc1(x))
392 |             x = self.fc2(x)
393 |         else:
394 |             x = self.fc(x)
395 | 
396 |         return x, x_embed
397 | 
398 | ###############################################################################
399 | 


--------------------------------------------------------------------------------
/rnaprot/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/BackofenLab/RNAProt/6091c9882d0355e3457607f12ee43ddf82cbb11b/rnaprot/__init__.py


--------------------------------------------------------------------------------
/rnaprot/content/logo1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/BackofenLab/RNAProt/6091c9882d0355e3457607f12ee43ddf82cbb11b/rnaprot/content/logo1.png


--------------------------------------------------------------------------------
/rnaprot/content/logo2.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/BackofenLab/RNAProt/6091c9882d0355e3457607f12ee43ddf82cbb11b/rnaprot/content/logo2.png


--------------------------------------------------------------------------------
/rnaprot/content/sorttable.js:
--------------------------------------------------------------------------------
  1 | /*
  2 |   SortTable
  3 |   version 2
  4 |   7th April 2007
  5 |   Stuart Langridge, http://www.kryogenix.org/code/browser/sorttable/
  6 | 
  7 |   Instructions:
  8 |   Download this file
  9 |   Add <script src="sorttable.js"></script> to your HTML
 10 |   Add class="sortable" to any table you'd like to make sortable
 11 |   Click on the headers to sort
 12 | 
 13 |   Thanks to many, many people for contributions and suggestions.
 14 |   Licenced as X11: http://www.kryogenix.org/code/browser/licence.html
 15 |   This basically means: do what you want with it.
 16 | */
 17 | 
 18 | 
 19 | var stIsIE = /*@cc_on!@*/false;
 20 | 
 21 | sorttable = {
 22 |   init: function() {
 23 |     // quit if this function has already been called
 24 |     if (arguments.callee.done) return;
 25 |     // flag this function so we don't do the same thing twice
 26 |     arguments.callee.done = true;
 27 |     // kill the timer
 28 |     if (_timer) clearInterval(_timer);
 29 | 
 30 |     if (!document.createElement || !document.getElementsByTagName) return;
 31 | 
 32 |     sorttable.DATE_RE = /^(\d\d?)[\/\.-](\d\d?)[\/\.-]((\d\d)?\d\d)$/;
 33 | 
 34 |     forEach(document.getElementsByTagName('table'), function(table) {
 35 |       if (table.className.search(/\bsortable\b/) != -1) {
 36 |         sorttable.makeSortable(table);
 37 |       }
 38 |     });
 39 | 
 40 |   },
 41 | 
 42 |   makeSortable: function(table) {
 43 |     if (table.getElementsByTagName('thead').length == 0) {
 44 |       // table doesn't have a tHead. Since it should have, create one and
 45 |       // put the first table row in it.
 46 |       the = document.createElement('thead');
 47 |       the.appendChild(table.rows[0]);
 48 |       table.insertBefore(the,table.firstChild);
 49 |     }
 50 |     // Safari doesn't support table.tHead, sigh
 51 |     if (table.tHead == null) table.tHead = table.getElementsByTagName('thead')[0];
 52 | 
 53 |     if (table.tHead.rows.length != 1) return; // can't cope with two header rows
 54 | 
 55 |     // Sorttable v1 put rows with a class of "sortbottom" at the bottom (as
 56 |     // "total" rows, for example). This is B&R, since what you're supposed
 57 |     // to do is put them in a tfoot. So, if there are sortbottom rows,
 58 |     // for backwards compatibility, move them to tfoot (creating it if needed).
 59 |     sortbottomrows = [];
 60 |     for (var i=0; i<table.rows.length; i++) {
 61 |       if (table.rows[i].className.search(/\bsortbottom\b/) != -1) {
 62 |         sortbottomrows[sortbottomrows.length] = table.rows[i];
 63 |       }
 64 |     }
 65 |     if (sortbottomrows) {
 66 |       if (table.tFoot == null) {
 67 |         // table doesn't have a tfoot. Create one.
 68 |         tfo = document.createElement('tfoot');
 69 |         table.appendChild(tfo);
 70 |       }
 71 |       for (var i=0; i<sortbottomrows.length; i++) {
 72 |         tfo.appendChild(sortbottomrows[i]);
 73 |       }
 74 |       delete sortbottomrows;
 75 |     }
 76 | 
 77 |     // work through each column and calculate its type
 78 |     headrow = table.tHead.rows[0].cells;
 79 |     for (var i=0; i<headrow.length; i++) {
 80 |       // manually override the type with a sorttable_type attribute
 81 |       if (!headrow[i].className.match(/\bsorttable_nosort\b/)) { // skip this col
 82 |         mtch = headrow[i].className.match(/\bsorttable_([a-z0-9]+)\b/);
 83 |         if (mtch) { override = mtch[1]; }
 84 | 	      if (mtch && typeof sorttable["sort_"+override] == 'function') {
 85 | 	        headrow[i].sorttable_sortfunction = sorttable["sort_"+override];
 86 | 	      } else {
 87 | 	        headrow[i].sorttable_sortfunction = sorttable.guessType(table,i);
 88 | 	      }
 89 | 	      // make it clickable to sort
 90 | 	      headrow[i].sorttable_columnindex = i;
 91 | 	      headrow[i].sorttable_tbody = table.tBodies[0];
 92 | 	      dean_addEvent(headrow[i],"click", sorttable.innerSortFunction = function(e) {
 93 | 
 94 |           if (this.className.search(/\bsorttable_sorted\b/) != -1) {
 95 |             // if we're already sorted by this column, just
 96 |             // reverse the table, which is quicker
 97 |             sorttable.reverse(this.sorttable_tbody);
 98 |             this.className = this.className.replace('sorttable_sorted',
 99 |                                                     'sorttable_sorted_reverse');
100 |             this.removeChild(document.getElementById('sorttable_sortfwdind'));
101 |             sortrevind = document.createElement('span');
102 |             sortrevind.id = "sorttable_sortrevind";
103 |             sortrevind.innerHTML = stIsIE ? '&nbsp<font face="webdings">5</font>' : '&nbsp;&#x25B4;';
104 |             this.appendChild(sortrevind);
105 |             return;
106 |           }
107 |           if (this.className.search(/\bsorttable_sorted_reverse\b/) != -1) {
108 |             // if we're already sorted by this column in reverse, just
109 |             // re-reverse the table, which is quicker
110 |             sorttable.reverse(this.sorttable_tbody);
111 |             this.className = this.className.replace('sorttable_sorted_reverse',
112 |                                                     'sorttable_sorted');
113 |             this.removeChild(document.getElementById('sorttable_sortrevind'));
114 |             sortfwdind = document.createElement('span');
115 |             sortfwdind.id = "sorttable_sortfwdind";
116 |             sortfwdind.innerHTML = stIsIE ? '&nbsp<font face="webdings">6</font>' : '&nbsp;&#x25BE;';
117 |             this.appendChild(sortfwdind);
118 |             return;
119 |           }
120 | 
121 |           // remove sorttable_sorted classes
122 |           theadrow = this.parentNode;
123 |           forEach(theadrow.childNodes, function(cell) {
124 |             if (cell.nodeType == 1) { // an element
125 |               cell.className = cell.className.replace('sorttable_sorted_reverse','');
126 |               cell.className = cell.className.replace('sorttable_sorted','');
127 |             }
128 |           });
129 |           sortfwdind = document.getElementById('sorttable_sortfwdind');
130 |           if (sortfwdind) { sortfwdind.parentNode.removeChild(sortfwdind); }
131 |           sortrevind = document.getElementById('sorttable_sortrevind');
132 |           if (sortrevind) { sortrevind.parentNode.removeChild(sortrevind); }
133 | 
134 |           this.className += ' sorttable_sorted';
135 |           sortfwdind = document.createElement('span');
136 |           sortfwdind.id = "sorttable_sortfwdind";
137 |           sortfwdind.innerHTML = stIsIE ? '&nbsp<font face="webdings">6</font>' : '&nbsp;&#x25BE;';
138 |           this.appendChild(sortfwdind);
139 | 
140 | 	        // build an array to sort. This is a Schwartzian transform thing,
141 | 	        // i.e., we "decorate" each row with the actual sort key,
142 | 	        // sort based on the sort keys, and then put the rows back in order
143 | 	        // which is a lot faster because you only do getInnerText once per row
144 | 	        row_array = [];
145 | 	        col = this.sorttable_columnindex;
146 | 	        rows = this.sorttable_tbody.rows;
147 | 	        for (var j=0; j<rows.length; j++) {
148 | 	          row_array[row_array.length] = [sorttable.getInnerText(rows[j].cells[col]), rows[j]];
149 | 	        }
150 | 	        /* If you want a stable sort, uncomment the following line */
151 | 	        //sorttable.shaker_sort(row_array, this.sorttable_sortfunction);
152 | 	        /* and comment out this one */
153 | 	        row_array.sort(this.sorttable_sortfunction);
154 | 
155 | 	        tb = this.sorttable_tbody;
156 | 	        for (var j=0; j<row_array.length; j++) {
157 | 	          tb.appendChild(row_array[j][1]);
158 | 	        }
159 | 
160 | 	        delete row_array;
161 | 	      });
162 | 	    }
163 |     }
164 |   },
165 | 
166 |   guessType: function(table, column) {
167 |     // guess the type of a column based on its first non-blank row
168 |     sortfn = sorttable.sort_alpha;
169 |     for (var i=0; i<table.tBodies[0].rows.length; i++) {
170 |       text = sorttable.getInnerText(table.tBodies[0].rows[i].cells[column]);
171 |       if (text != '') {
172 |         if (text.match(/^-?[Ł$¤]?[\d,.]+%?$/)) {
173 |           return sorttable.sort_numeric;
174 |         }
175 |         // check for a date: dd/mm/yyyy or dd/mm/yy
176 |         // can have / or . or - as separator
177 |         // can be mm/dd as well
178 |         possdate = text.match(sorttable.DATE_RE)
179 |         if (possdate) {
180 |           // looks like a date
181 |           first = parseInt(possdate[1]);
182 |           second = parseInt(possdate[2]);
183 |           if (first > 12) {
184 |             // definitely dd/mm
185 |             return sorttable.sort_ddmm;
186 |           } else if (second > 12) {
187 |             return sorttable.sort_mmdd;
188 |           } else {
189 |             // looks like a date, but we can't tell which, so assume
190 |             // that it's dd/mm (English imperialism!) and keep looking
191 |             sortfn = sorttable.sort_ddmm;
192 |           }
193 |         }
194 |       }
195 |     }
196 |     return sortfn;
197 |   },
198 | 
199 |   getInnerText: function(node) {
200 |     // gets the text we want to use for sorting for a cell.
201 |     // strips leading and trailing whitespace.
202 |     // this is *not* a generic getInnerText function; it's special to sorttable.
203 |     // for example, you can override the cell text with a customkey attribute.
204 |     // it also gets .value for <input> fields.
205 | 
206 |     if (!node) return "";
207 | 
208 |     hasInputs = (typeof node.getElementsByTagName == 'function') &&
209 |                  node.getElementsByTagName('input').length;
210 | 
211 |     if (node.getAttribute("sorttable_customkey") != null) {
212 |       return node.getAttribute("sorttable_customkey");
213 |     }
214 |     else if (typeof node.textContent != 'undefined' && !hasInputs) {
215 |       return node.textContent.replace(/^\s+|\s+$/g, '');
216 |     }
217 |     else if (typeof node.innerText != 'undefined' && !hasInputs) {
218 |       return node.innerText.replace(/^\s+|\s+$/g, '');
219 |     }
220 |     else if (typeof node.text != 'undefined' && !hasInputs) {
221 |       return node.text.replace(/^\s+|\s+$/g, '');
222 |     }
223 |     else {
224 |       switch (node.nodeType) {
225 |         case 3:
226 |           if (node.nodeName.toLowerCase() == 'input') {
227 |             return node.value.replace(/^\s+|\s+$/g, '');
228 |           }
229 |         case 4:
230 |           return node.nodeValue.replace(/^\s+|\s+$/g, '');
231 |           break;
232 |         case 1:
233 |         case 11:
234 |           var innerText = '';
235 |           for (var i = 0; i < node.childNodes.length; i++) {
236 |             innerText += sorttable.getInnerText(node.childNodes[i]);
237 |           }
238 |           return innerText.replace(/^\s+|\s+$/g, '');
239 |           break;
240 |         default:
241 |           return '';
242 |       }
243 |     }
244 |   },
245 | 
246 |   reverse: function(tbody) {
247 |     // reverse the rows in a tbody
248 |     newrows = [];
249 |     for (var i=0; i<tbody.rows.length; i++) {
250 |       newrows[newrows.length] = tbody.rows[i];
251 |     }
252 |     for (var i=newrows.length-1; i>=0; i--) {
253 |        tbody.appendChild(newrows[i]);
254 |     }
255 |     delete newrows;
256 |   },
257 | 
258 |   /* sort functions
259 |      each sort function takes two parameters, a and b
260 |      you are comparing a[0] and b[0] */
261 |   sort_numeric: function(a,b) {
262 |     aa = parseFloat(a[0].replace(/[^0-9.-]/g,''));
263 |     if (isNaN(aa)) aa = 0;
264 |     bb = parseFloat(b[0].replace(/[^0-9.-]/g,''));
265 |     if (isNaN(bb)) bb = 0;
266 |     return aa-bb;
267 |   },
268 |   sort_alpha: function(a,b) {
269 |     if (a[0]==b[0]) return 0;
270 |     if (a[0]<b[0]) return -1;
271 |     return 1;
272 |   },
273 |   sort_ddmm: function(a,b) {
274 |     mtch = a[0].match(sorttable.DATE_RE);
275 |     y = mtch[3]; m = mtch[2]; d = mtch[1];
276 |     if (m.length == 1) m = '0'+m;
277 |     if (d.length == 1) d = '0'+d;
278 |     dt1 = y+m+d;
279 |     mtch = b[0].match(sorttable.DATE_RE);
280 |     y = mtch[3]; m = mtch[2]; d = mtch[1];
281 |     if (m.length == 1) m = '0'+m;
282 |     if (d.length == 1) d = '0'+d;
283 |     dt2 = y+m+d;
284 |     if (dt1==dt2) return 0;
285 |     if (dt1<dt2) return -1;
286 |     return 1;
287 |   },
288 |   sort_mmdd: function(a,b) {
289 |     mtch = a[0].match(sorttable.DATE_RE);
290 |     y = mtch[3]; d = mtch[2]; m = mtch[1];
291 |     if (m.length == 1) m = '0'+m;
292 |     if (d.length == 1) d = '0'+d;
293 |     dt1 = y+m+d;
294 |     mtch = b[0].match(sorttable.DATE_RE);
295 |     y = mtch[3]; d = mtch[2]; m = mtch[1];
296 |     if (m.length == 1) m = '0'+m;
297 |     if (d.length == 1) d = '0'+d;
298 |     dt2 = y+m+d;
299 |     if (dt1==dt2) return 0;
300 |     if (dt1<dt2) return -1;
301 |     return 1;
302 |   },
303 | 
304 |   shaker_sort: function(list, comp_func) {
305 |     // A stable sort function to allow multi-level sorting of data
306 |     // see: http://en.wikipedia.org/wiki/Cocktail_sort
307 |     // thanks to Joseph Nahmias
308 |     var b = 0;
309 |     var t = list.length - 1;
310 |     var swap = true;
311 | 
312 |     while(swap) {
313 |         swap = false;
314 |         for(var i = b; i < t; ++i) {
315 |             if ( comp_func(list[i], list[i+1]) > 0 ) {
316 |                 var q = list[i]; list[i] = list[i+1]; list[i+1] = q;
317 |                 swap = true;
318 |             }
319 |         } // for
320 |         t--;
321 | 
322 |         if (!swap) break;
323 | 
324 |         for(var i = t; i > b; --i) {
325 |             if ( comp_func(list[i], list[i-1]) < 0 ) {
326 |                 var q = list[i]; list[i] = list[i-1]; list[i-1] = q;
327 |                 swap = true;
328 |             }
329 |         } // for
330 |         b++;
331 | 
332 |     } // while(swap)
333 |   }
334 | }
335 | 
336 | /* ******************************************************************
337 |    Supporting functions: bundled here to avoid depending on a library
338 |    ****************************************************************** */
339 | 
340 | // Dean Edwards/Matthias Miller/John Resig
341 | 
342 | /* for Mozilla/Opera9 */
343 | if (document.addEventListener) {
344 |     document.addEventListener("DOMContentLoaded", sorttable.init, false);
345 | }
346 | 
347 | /* for Internet Explorer */
348 | /*@cc_on @*/
349 | /*@if (@_win32)
350 |     document.write("<script id=__ie_onload defer src=javascript:void(0)><\/script>");
351 |     var script = document.getElementById("__ie_onload");
352 |     script.onreadystatechange = function() {
353 |         if (this.readyState == "complete") {
354 |             sorttable.init(); // call the onload handler
355 |         }
356 |     };
357 | /*@end @*/
358 | 
359 | /* for Safari */
360 | if (/WebKit/i.test(navigator.userAgent)) { // sniff
361 |     var _timer = setInterval(function() {
362 |         if (/loaded|complete/.test(document.readyState)) {
363 |             sorttable.init(); // call the onload handler
364 |         }
365 |     }, 10);
366 | }
367 | 
368 | /* for other browsers */
369 | window.onload = sorttable.init;
370 | 
371 | // written by Dean Edwards, 2005
372 | // with input from Tino Zijdel, Matthias Miller, Diego Perini
373 | 
374 | // http://dean.edwards.name/weblog/2005/10/add-event/
375 | 
376 | function dean_addEvent(element, type, handler) {
377 | 	if (element.addEventListener) {
378 | 		element.addEventListener(type, handler, false);
379 | 	} else {
380 | 		// assign each event handler a unique ID
381 | 		if (!handler.$$guid) handler.$$guid = dean_addEvent.guid++;
382 | 		// create a hash table of event types for the element
383 | 		if (!element.events) element.events = {};
384 | 		// create a hash table of event handlers for each element/event pair
385 | 		var handlers = element.events[type];
386 | 		if (!handlers) {
387 | 			handlers = element.events[type] = {};
388 | 			// store the existing event handler (if there is one)
389 | 			if (element["on" + type]) {
390 | 				handlers[0] = element["on" + type];
391 | 			}
392 | 		}
393 | 		// store the event handler in the hash table
394 | 		handlers[handler.$$guid] = handler;
395 | 		// assign a global event handler to do all the work
396 | 		element["on" + type] = handleEvent;
397 | 	}
398 | };
399 | // a counter used to create unique IDs
400 | dean_addEvent.guid = 1;
401 | 
402 | function removeEvent(element, type, handler) {
403 | 	if (element.removeEventListener) {
404 | 		element.removeEventListener(type, handler, false);
405 | 	} else {
406 | 		// delete the event handler from the hash table
407 | 		if (element.events && element.events[type]) {
408 | 			delete element.events[type][handler.$$guid];
409 | 		}
410 | 	}
411 | };
412 | 
413 | function handleEvent(event) {
414 | 	var returnValue = true;
415 | 	// grab the event object (IE uses a global event object)
416 | 	event = event || fixEvent(((this.ownerDocument || this.document || this).parentWindow || window).event);
417 | 	// get a reference to the hash table of event handlers
418 | 	var handlers = this.events[event.type];
419 | 	// execute each event handler
420 | 	for (var i in handlers) {
421 | 		this.$$handleEvent = handlers[i];
422 | 		if (this.$$handleEvent(event) === false) {
423 | 			returnValue = false;
424 | 		}
425 | 	}
426 | 	return returnValue;
427 | };
428 | 
429 | function fixEvent(event) {
430 | 	// add W3C standard event methods
431 | 	event.preventDefault = fixEvent.preventDefault;
432 | 	event.stopPropagation = fixEvent.stopPropagation;
433 | 	return event;
434 | };
435 | fixEvent.preventDefault = function() {
436 | 	this.returnValue = false;
437 | };
438 | fixEvent.stopPropagation = function() {
439 |   this.cancelBubble = true;
440 | }
441 | 
442 | // Dean's forEach: http://dean.edwards.name/base/forEach.js
443 | /*
444 | 	forEach, version 1.0
445 | 	Copyright 2006, Dean Edwards
446 | 	License: http://www.opensource.org/licenses/mit-license.php
447 | */
448 | 
449 | // array-like enumeration
450 | if (!Array.forEach) { // mozilla already supports this
451 | 	Array.forEach = function(array, block, context) {
452 | 		for (var i = 0; i < array.length; i++) {
453 | 			block.call(context, array[i], i, array);
454 | 		}
455 | 	};
456 | }
457 | 
458 | // generic enumeration
459 | Function.prototype.forEach = function(object, block, context) {
460 | 	for (var key in object) {
461 | 		if (typeof this.prototype[key] == "undefined") {
462 | 			block.call(context, object[key], key, object);
463 | 		}
464 | 	}
465 | };
466 | 
467 | // character enumeration
468 | String.forEach = function(string, block, context) {
469 | 	Array.forEach(string.split(""), function(chr, index) {
470 | 		block.call(context, chr, index, string);
471 | 	});
472 | };
473 | 
474 | // globally resolve forEach enumeration
475 | var forEach = function(object, block, context) {
476 | 	if (object) {
477 | 		var resolve = Object; // default
478 | 		if (object instanceof Function) {
479 | 			// functions have a "length" property
480 | 			resolve = Function;
481 | 		} else if (object.forEach instanceof Function) {
482 | 			// the object implements a custom forEach method so use that
483 | 			object.forEach(block, context);
484 | 			return;
485 | 		} else if (typeof object == "string") {
486 | 			// the object is a string
487 | 			resolve = String;
488 | 		} else if (typeof object.length == "number") {
489 | 			// the object is array-like
490 | 			resolve = Array;
491 | 		}
492 | 		resolve.forEach(object, block, context);
493 | 	}
494 | };
495 | 
496 | 
497 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/empty_file:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/BackofenLab/RNAProt/6091c9882d0355e3457607f12ee43ddf82cbb11b/rnaprot/test_data/empty_file


--------------------------------------------------------------------------------
/rnaprot/test_data/feat_666.bed:
--------------------------------------------------------------------------------
1 | chr1	1015	1020	r1	1.1	+
2 | chr2	1015	1020	r2	2.2	+
3 | chr3	1015	1020	r3	3.3	-
4 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/feat_666_1.exp.out:
--------------------------------------------------------------------------------
 1 | >s1
 2 | 0
 3 | 0
 4 | 0
 5 | 0
 6 | 0
 7 | 0
 8 | 0
 9 | 0
10 | 0
11 | 0
12 | 0
13 | 0
14 | 0
15 | 0
16 | 0
17 | 1.1
18 | 1.1
19 | 1.1
20 | 1.1
21 | 1.1
22 | >s2
23 | 0
24 | 0
25 | 0
26 | 0
27 | 0
28 | 0
29 | 0
30 | 0
31 | 0
32 | 0
33 | 0
34 | 0
35 | 0
36 | 0
37 | 0
38 | 2.2
39 | 2.2
40 | 2.2
41 | 2.2
42 | 2.2
43 | >s3
44 | 0
45 | 0
46 | 0
47 | 0
48 | 0
49 | 0
50 | 0
51 | 0
52 | 0
53 | 0
54 | 0
55 | 0
56 | 0
57 | 0
58 | 0
59 | 3.3
60 | 3.3
61 | 3.3
62 | 3.3
63 | 3.3
64 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/feat_666_2.exp.out:
--------------------------------------------------------------------------------
 1 | >s1
 2 | 0
 3 | 0
 4 | 0
 5 | 0
 6 | 0
 7 | 0
 8 | 0
 9 | 0
10 | 0
11 | 0
12 | 0
13 | 0
14 | 0
15 | 0
16 | 0
17 | 1.1
18 | 1.1
19 | 1.1
20 | 1.1
21 | 1.1
22 | >s2
23 | 0
24 | 0
25 | 0
26 | 0
27 | 0
28 | 0
29 | 0
30 | 0
31 | 0
32 | 0
33 | 0
34 | 0
35 | 0
36 | 0
37 | 0
38 | 0
39 | 0
40 | 0
41 | 0
42 | 0
43 | >s3
44 | 3.3
45 | 3.3
46 | 3.3
47 | 3.3
48 | 3.3
49 | 0
50 | 0
51 | 0
52 | 0
53 | 0
54 | 0
55 | 0
56 | 0
57 | 0
58 | 0
59 | 0
60 | 0
61 | 0
62 | 0
63 | 0
64 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/feat_in.bed:
--------------------------------------------------------------------------------
1 | chr1	1000	1020	s1	0	+
2 | chr2	1000	1020	s2	0	-
3 | chr3	1000	1020	s3	0	-
4 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/feat_old_nick.bed:
--------------------------------------------------------------------------------
1 | chr1	1015	1020	r1	10	+
2 | chr2	1015	1020	r2	20	+
3 | chr3	1015	1020	r3	30	-
4 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/feat_old_nick_1.exp.out:
--------------------------------------------------------------------------------
1 | >s1
2 | 00000000000000011111
3 | >s2
4 | 00000000000000011111
5 | >s3
6 | 00000000000000011111
7 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/feat_old_nick_2.exp.out:
--------------------------------------------------------------------------------
1 | >s1
2 | 00000000000000011111
3 | >s2
4 | 00000000000000000000
5 | >s3
6 | 11111000000000000000
7 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/file1:
--------------------------------------------------------------------------------
 1 | Open for business
 2 | Pain don't hurt
 3 | I love the smell of napalm in the morning
 4 | What are you gonna do? Bleed on me?
 5 | There's no crying in baseball
 6 | Nice night for a walk
 7 | I'll beat you like a bad stepchild
 8 | There's always barber college
 9 | 
10 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/file2:
--------------------------------------------------------------------------------
 1 | Open for business
 2 | Pain don't hurt
 3 | I love the smell of napalm in the morning
 4 | What are you gonna do? Bleed on me?
 5 | There's no crying in baseball
 6 | Nice night for a walk
 7 | I'll beat you like a bad stepchild
 8 | There's always barber college
 9 | 
10 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/gene_test_in.gtf:
--------------------------------------------------------------------------------
1 | 1	havana	gene	30001	40000	.	+	.	gene_id "ENSG01"; gene_version "1"; gene_name "ABC1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene";
2 | 1	havana	transcript	30001	40000	.	+	.	gene_id "ENSG01"; gene_version "1"; transcript_id "ENST01"; transcript_version "1"; gene_name "ABC1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "ABC1-202"; transcript_source "havana"; transcript_biotype "lncRNA"; tag "basic"; transcript_support_level "1";
3 | X	havana	gene	50001	60000	.	-	.	gene_id "ENSG02"; gene_version "1"; gene_name "ABC2"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene";
4 | X	havana	transcript	50001	60000	.	-	.	gene_id "ENSG02"; gene_version "1"; transcript_id "ENST02"; transcript_version "1"; gene_name "ABC2"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "ABC2-202"; transcript_source "havana"; transcript_biotype "lncRNA"; tag "basic"; transcript_support_level "1";
5 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/gtf_exon_out.bed:
--------------------------------------------------------------------------------
1 | chr1	1000	2000	ENST001_e1	0	+
2 | chr1	3000	4000	ENST001_e2	0	+
3 | chr1	8000	9000	ENST002_e1	0	-
4 | chr1	6000	7000	ENST002_e2	0	-
5 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/gtf_exon_out_exp.bed:
--------------------------------------------------------------------------------
1 | chr1	1000	2000	ENST001_e1	0	+
2 | chr1	3000	4000	ENST001_e2	0	+
3 | chr1	8000	9000	ENST002_e1	0	-
4 | chr1	6000	7000	ENST002_e2	0	-
5 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/gtf_gene_out.exp.bed:
--------------------------------------------------------------------------------
1 | chr1	30000	40000	ENSG01	0	+
2 | chrX	50000	60000	ENSG02	0	-
3 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/gtf_intron_out.bed:
--------------------------------------------------------------------------------
1 | chr1	2000	3000	ENST001_i1	0	+
2 | chr1	7000	8000	ENST002_i1	0	-
3 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/gtf_intron_out_exp.bed:
--------------------------------------------------------------------------------
1 | chr1	2000	3000	ENST001_i1	0	+
2 | chr1	7000	8000	ENST002_i1	0	-
3 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/gtf_transcript_out.exp.bed:
--------------------------------------------------------------------------------
1 | chr1	30000	40000	ENST01	0	+
2 | chrX	50000	60000	ENST02	0	-
3 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/map_test_in.bed:
--------------------------------------------------------------------------------
1 | chr1	1300	1400	site01	2.5571	+
2 | chr1	2950	3100	site02	3.1543	+
3 | chr1	6800	6900	site03	1	-
4 | chr1	7950	8100	site04	0	-
5 | chr1	2600	2700	site666	666.666	-
6 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/map_test_in.gtf:
--------------------------------------------------------------------------------
1 | 1	havana	exon	1001	2000	.	+	.	gene_id "ENSG001"; gene_version "1"; transcript_id "ENST001"; transcript_version "1"; exon_number "1"; gene_name "ABC1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "ABC1-101"; transcript_source "havana"; transcript_biotype "lncRNA"; exon_id "ENSE001"; exon_version "1"; tag "basic"; transcript_support_level "1";
2 | 1	havana	exon	3001	4000	.	+	.	gene_id "ENSG001"; gene_version "1"; transcript_id "ENST001"; transcript_version "1"; exon_number "2"; gene_name "ABC1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "ABC1-101"; transcript_source "havana"; transcript_biotype "lncRNA"; exon_id "ENSE002"; exon_version "1"; tag "basic"; transcript_support_level "1";
3 | 1	havana	exon	8001	9000	.	-	.	gene_id "ENSG002"; gene_version "1"; transcript_id "ENST002"; transcript_version "1"; exon_number "1"; gene_name "DEF1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "DEF1-101"; transcript_source "havana"; transcript_biotype "lncRNA"; exon_id "ENSE003"; exon_version "1"; tag "basic"; transcript_support_level "1";
4 | 1	havana	exon	6001	7000	.	-	.	gene_id "ENSG002"; gene_version "1"; transcript_id "ENST002"; transcript_version "1"; exon_number "2"; gene_name "DEF1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "DEF1-101"; transcript_source "havana"; transcript_biotype "lncRNA"; exon_id "ENSE004"; exon_version "1"; tag "basic"; transcript_support_level "1";
5 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/map_test_out_all_unique.bed:
--------------------------------------------------------------------------------
1 | ENST001	300	400	site01	2.5571	+
2 | ENST001	1000	1100	site02	3.1543	+
3 | ENST002	1100	1200	site03	1	+
4 | ENST002	900	1000	site04	0	+
5 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/map_test_out_transcript_stats.out:
--------------------------------------------------------------------------------
1 | tr_id	chr	gen_s	gen_e	pol	gene_id	gene_name	gene_biotype	tr_len	comp_hits	all_hits	uniq_comp_hits	uniq_all_hits
2 | ENST001	chr1	1000	4000	+	ENSG001	ABC1	transcribed_unprocessed_pseudogene	2000	1	2	1	2
3 | ENST002	chr1	6000	9000	-	ENSG002	DEF1	transcribed_unprocessed_pseudogene	2000	1	2	1	2
4 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/negatives.bed:
--------------------------------------------------------------------------------
1 | chr10	6218908	6219269	random_negative_0000006	0	+
2 | chr10	6222953	6223314	random_negative_0000007	0	+
3 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/negatives.bpp:
--------------------------------------------------------------------------------
   1 | >random_negative_0000006
   2 | 1	84	0.1682
   3 | 2	24	0.1126
   4 | 2	60	0.3590
   5 | 2	83	0.1275
   6 | 3	59	0.2967
   7 | 3	82	0.1041
   8 | 4	23	0.1551
   9 | 4	58	0.2575
  10 | 4	61	0.7446
  11 | 5	22	0.1743
  12 | 5	57	0.2285
  13 | 5	60	0.6799
  14 | 6	21	0.1593
  15 | 6	55	0.1155
  16 | 6	59	0.6113
  17 | 7	20	0.1457
  18 | 7	54	0.1096
  19 | 8	57	0.5452
  20 | 8	66	0.1142
  21 | 9	56	0.5157
  22 | 9	65	0.1187
  23 | 10	55	0.4824
  24 | 10	64	0.1134
  25 | 11	50	0.1027
  26 | 12	51	0.1208
  27 | 12	62	0.1045
  28 | 13	48	0.1194
  29 | 13	50	0.1195
  30 | 13	61	0.1002
  31 | 14	47	0.1112
  32 | 18	69	0.4701
  33 | 19	47	0.3931
  34 | 19	48	0.1933
  35 | 19	57	0.1482
  36 | 19	67	0.4710
  37 | 19	68	0.5435
  38 | 20	46	0.4117
  39 | 20	47	0.1781
  40 | 20	56	0.1446
  41 | 20	66	0.4938
  42 | 20	67	0.5404
  43 | 21	45	0.4181
  44 | 21	46	0.1513
  45 | 21	65	0.4974
  46 | 21	66	0.4926
  47 | 21	80	0.1120
  48 | 22	44	0.4129
  49 | 22	64	0.4059
  50 | 22	79	0.1139
  51 | 23	44	0.1430
  52 | 23	63	0.2929
  53 | 23	64	0.7521
  54 | 24	42	0.3492
  55 | 24	63	0.7880
  56 | 24	77	0.1456
  57 | 25	41	0.3175
  58 | 25	51	0.3215
  59 | 25	62	0.8130
  60 | 25	76	0.1438
  61 | 26	40	0.2208
  62 | 26	41	0.2781
  63 | 26	49	0.1535
  64 | 26	50	0.3477
  65 | 26	61	0.7966
  66 | 26	75	0.1417
  67 | 27	40	0.3631
  68 | 27	48	0.1549
  69 | 27	49	0.3420
  70 | 27	60	0.7772
  71 | 27	74	0.1392
  72 | 28	39	0.4170
  73 | 28	73	0.1360
  74 | 29	38	0.4094
  75 | 29	45	0.8351
  76 | 29	56	0.1254
  77 | 30	37	0.3963
  78 | 30	44	0.8630
  79 | 30	55	0.1201
  80 | 31	36	0.3394
  81 | 31	43	0.8916
  82 | 31	54	0.1018
  83 | 32	42	0.8876
  84 | 33	41	0.8737
  85 | 34	40	0.8586
  86 | 34	48	0.3040
  87 | 35	47	0.3044
  88 | 36	46	0.3016
  89 | 37	45	0.2973
  90 | 38	44	0.2905
  91 | 41	59	0.1451
  92 | 42	58	0.1544
  93 | 44	56	0.1721
  94 | 45	55	0.1810
  95 | 46	54	0.1881
  96 | 47	53	0.1764
  97 | 47	73	0.1053
  98 | 48	72	0.3901
  99 | 48	73	0.1571
 100 | 49	64	0.1514
 101 | 49	71	0.3901
 102 | 49	72	0.2291
 103 | 50	63	0.1510
 104 | 50	70	0.3866
 105 | 50	71	0.2317
 106 | 51	70	0.2291
 107 | 52	69	0.2192
 108 | 53	67	0.4534
 109 | 54	66	0.4676
 110 | 54	67	0.2114
 111 | 55	65	0.4612
 112 | 55	66	0.2110
 113 | 56	64	0.3724
 114 | 57	63	0.3647
 115 | 57	64	0.4174
 116 | 58	63	0.4159
 117 | 58	105	0.3076
 118 | 59	104	0.3079
 119 | 60	72	0.1940
 120 | 60	103	0.3034
 121 | 60	157	0.1796
 122 | 61	71	0.1931
 123 | 61	142	0.2007
 124 | 61	156	0.1770
 125 | 61	157	0.1215
 126 | 61	159	0.2435
 127 | 62	70	0.1907
 128 | 62	141	0.2193
 129 | 62	156	0.1181
 130 | 62	158	0.2379
 131 | 63	69	0.1861
 132 | 63	101	0.3152
 133 | 63	122	0.1004
 134 | 63	140	0.2548
 135 | 63	155	0.1030
 136 | 64	68	0.1813
 137 | 64	100	0.3129
 138 | 64	139	0.2528
 139 | 64	163	0.1567
 140 | 65	99	0.3102
 141 | 65	120	0.1028
 142 | 65	138	0.2507
 143 | 65	156	0.1125
 144 | 65	162	0.1554
 145 | 66	98	0.3070
 146 | 66	119	0.1031
 147 | 66	137	0.2486
 148 | 66	161	0.1533
 149 | 67	97	0.2904
 150 | 67	118	0.1034
 151 | 67	136	0.2467
 152 | 67	160	0.1508
 153 | 68	95	0.3022
 154 | 68	117	0.1029
 155 | 68	135	0.2449
 156 | 68	153	0.7101
 157 | 68	159	0.1375
 158 | 69	94	0.2988
 159 | 69	116	0.1012
 160 | 69	134	0.2347
 161 | 69	152	0.7364
 162 | 69	158	0.1146
 163 | 70	93	0.2925
 164 | 70	151	0.7768
 165 | 71	83	0.1230
 166 | 71	92	0.2943
 167 | 71	150	0.7804
 168 | 72	81	0.2242
 169 | 72	113	0.1007
 170 | 72	149	0.7758
 171 | 73	80	0.2237
 172 | 73	90	0.2919
 173 | 73	112	0.1004
 174 | 73	143	0.4592
 175 | 73	148	0.7727
 176 | 74	79	0.2213
 177 | 74	89	0.2901
 178 | 74	142	0.4687
 179 | 74	147	0.5444
 180 | 75	88	0.2880
 181 | 75	141	0.4663
 182 | 75	147	0.5592
 183 | 76	87	0.2785
 184 | 76	146	0.7740
 185 | 77	86	0.1992
 186 | 77	139	0.4600
 187 | 77	145	0.7780
 188 | 78	85	0.1131
 189 | 78	138	0.4362
 190 | 78	144	0.7766
 191 | 79	86	0.1317
 192 | 79	139	0.1029
 193 | 79	143	0.7737
 194 | 80	85	0.1352
 195 | 80	136	0.4811
 196 | 80	138	0.1019
 197 | 80	142	0.7685
 198 | 81	105	0.1374
 199 | 81	135	0.4812
 200 | 81	141	0.7615
 201 | 82	104	0.1455
 202 | 83	103	0.1444
 203 | 83	135	0.1931
 204 | 83	136	0.1879
 205 | 83	138	0.5397
 206 | 84	132	0.7810
 207 | 84	134	0.1318
 208 | 84	135	0.1325
 209 | 84	137	0.3828
 210 | 85	131	0.9077
 211 | 86	103	0.1514
 212 | 86	130	0.9006
 213 | 87	102	0.2914
 214 | 87	129	0.8970
 215 | 88	101	0.3118
 216 | 88	128	0.8956
 217 | 89	100	0.3103
 218 | 89	127	0.8905
 219 | 89	145	0.1198
 220 | 90	99	0.3077
 221 | 90	144	0.1643
 222 | 91	126	0.8726
 223 | 91	143	0.2053
 224 | 92	97	0.2158
 225 | 92	124	0.1357
 226 | 92	125	0.8672
 227 | 92	142	0.2047
 228 | 93	123	0.1387
 229 | 93	124	0.8558
 230 | 93	141	0.2040
 231 | 94	122	0.1412
 232 | 94	140	0.2046
 233 | 95	122	0.8533
 234 | 95	139	0.2035
 235 | 96	120	0.1220
 236 | 96	121	0.8348
 237 | 96	138	0.2011
 238 | 100	117	0.8697
 239 | 100	136	0.1972
 240 | 101	116	0.8669
 241 | 101	135	0.1963
 242 | 102	115	0.8603
 243 | 102	134	0.1880
 244 | 102	146	0.1401
 245 | 103	113	0.1658
 246 | 103	114	0.8188
 247 | 103	145	0.1643
 248 | 104	132	0.1821
 249 | 104	144	0.1636
 250 | 105	112	0.8390
 251 | 105	131	0.1886
 252 | 105	143	0.1629
 253 | 106	111	0.8220
 254 | 106	130	0.1860
 255 | 106	142	0.1619
 256 | 107	141	0.1592
 257 | 107	206	0.1336
 258 | 108	126	0.1161
 259 | 108	140	0.1530
 260 | 108	205	0.1748
 261 | 109	124	0.2080
 262 | 109	204	0.4210
 263 | 110	123	0.2198
 264 | 110	203	0.6017
 265 | 111	122	0.2385
 266 | 111	202	0.6433
 267 | 112	121	0.2365
 268 | 112	201	0.6360
 269 | 113	119	0.1857
 270 | 113	200	0.6263
 271 | 114	118	0.1666
 272 | 114	199	0.6082
 273 | 115	197	0.5619
 274 | 116	196	0.5583
 275 | 117	195	0.5487
 276 | 117	198	0.1817
 277 | 118	197	0.1819
 278 | 119	196	0.1792
 279 | 121	143	0.5599
 280 | 122	141	0.1617
 281 | 122	142	0.5520
 282 | 123	140	0.1941
 283 | 125	139	0.6029
 284 | 125	212	0.1533
 285 | 126	138	0.6009
 286 | 126	211	0.1720
 287 | 127	136	0.6122
 288 | 127	210	0.1734
 289 | 128	135	0.6106
 290 | 128	204	0.1039
 291 | 128	209	0.1713
 292 | 129	134	0.6022
 293 | 129	203	0.1055
 294 | 129	208	0.1684
 295 | 130	202	0.1050
 296 | 131	201	0.1036
 297 | 131	206	0.1660
 298 | 132	205	0.1612
 299 | 135	140	0.1313
 300 | 136	198	0.1076
 301 | 137	197	0.1059
 302 | 138	202	0.3998
 303 | 138	233	0.1509
 304 | 139	201	0.3980
 305 | 139	232	0.1521
 306 | 140	200	0.3933
 307 | 140	231	0.1494
 308 | 141	196	0.3756
 309 | 141	198	0.1719
 310 | 141	234	0.1069
 311 | 142	195	0.3761
 312 | 142	197	0.1611
 313 | 142	233	0.1058
 314 | 143	194	0.3506
 315 | 143	232	0.1039
 316 | 144	193	0.2362
 317 | 145	194	0.8354
 318 | 146	193	0.9126
 319 | 147	192	0.9740
 320 | 148	191	0.9773
 321 | 149	190	0.9778
 322 | 150	189	0.9727
 323 | 151	188	0.9644
 324 | 152	187	0.9616
 325 | 153	163	0.1028
 326 | 153	186	0.9547
 327 | 154	162	0.1029
 328 | 154	165	0.1085
 329 | 154	185	0.7107
 330 | 155	161	0.1015
 331 | 155	164	0.1453
 332 | 155	172	0.1502
 333 | 155	183	0.1708
 334 | 155	185	0.6237
 335 | 156	163	0.1507
 336 | 156	171	0.1769
 337 | 156	182	0.1702
 338 | 156	184	0.8713
 339 | 157	170	0.1754
 340 | 157	182	0.2342
 341 | 157	184	0.1721
 342 | 158	181	0.1735
 343 | 159	182	0.8391
 344 | 160	167	0.1498
 345 | 160	181	0.6891
 346 | 161	166	0.1421
 347 | 161	181	0.5867
 348 | 163	179	0.9707
 349 | 163	188	0.1745
 350 | 164	178	0.9668
 351 | 164	187	0.1834
 352 | 165	177	0.9607
 353 | 165	186	0.1836
 354 | 166	176	0.9510
 355 | 166	185	0.1766
 356 | 167	175	0.9252
 357 | 169	181	0.2651
 358 | 170	180	0.2800
 359 | 171	179	0.2782
 360 | 172	178	0.2556
 361 | 177	275	0.2584
 362 | 178	274	0.2655
 363 | 179	253	0.1076
 364 | 179	273	0.2721
 365 | 180	252	0.1270
 366 | 180	272	0.2674
 367 | 181	251	0.1205
 368 | 181	271	0.2492
 369 | 182	213	0.1657
 370 | 183	212	0.1650
 371 | 184	211	0.1628
 372 | 184	213	0.1796
 373 | 184	249	0.1354
 374 | 185	212	0.1787
 375 | 186	210	0.1494
 376 | 186	211	0.1767
 377 | 186	248	0.3744
 378 | 186	269	0.2612
 379 | 187	209	0.1482
 380 | 187	210	0.1737
 381 | 187	247	0.3752
 382 | 187	268	0.2605
 383 | 188	246	0.3911
 384 | 188	266	0.1089
 385 | 188	267	0.2517
 386 | 188	282	0.4340
 387 | 188	283	0.1223
 388 | 189	245	0.4033
 389 | 189	265	0.1376
 390 | 189	266	0.2451
 391 | 189	281	0.4592
 392 | 189	282	0.1262
 393 | 190	244	0.4027
 394 | 190	264	0.1360
 395 | 190	265	0.2423
 396 | 190	280	0.4834
 397 | 191	205	0.2719
 398 | 191	243	0.4012
 399 | 191	264	0.2386
 400 | 191	279	0.4765
 401 | 192	204	0.2908
 402 | 192	278	0.4692
 403 | 193	203	0.3059
 404 | 193	241	0.4620
 405 | 193	261	0.2439
 406 | 193	277	0.4617
 407 | 194	202	0.3210
 408 | 194	240	0.5320
 409 | 194	260	0.2534
 410 | 194	276	0.4545
 411 | 195	201	0.3222
 412 | 195	209	0.3554
 413 | 195	217	0.1528
 414 | 195	239	0.5453
 415 | 195	259	0.1782
 416 | 195	275	0.4217
 417 | 196	200	0.3177
 418 | 196	208	0.3661
 419 | 196	216	0.1521
 420 | 196	238	0.5492
 421 | 196	259	0.3624
 422 | 196	275	0.1430
 423 | 197	207	0.3642
 424 | 197	215	0.1509
 425 | 197	237	0.5449
 426 | 197	258	0.4025
 427 | 197	274	0.1845
 428 | 198	206	0.3646
 429 | 198	214	0.1490
 430 | 198	236	0.5382
 431 | 198	257	0.3989
 432 | 199	205	0.3554
 433 | 199	256	0.3945
 434 | 199	281	0.1462
 435 | 200	234	0.5316
 436 | 200	255	0.3903
 437 | 200	273	0.4516
 438 | 200	280	0.1845
 439 | 201	212	0.1126
 440 | 201	233	0.5280
 441 | 201	254	0.3861
 442 | 201	272	0.4466
 443 | 201	279	0.1828
 444 | 202	211	0.1128
 445 | 202	232	0.5234
 446 | 202	278	0.1800
 447 | 203	253	0.3733
 448 | 204	226	0.1396
 449 | 204	228	0.2766
 450 | 204	252	0.3706
 451 | 204	276	0.1678
 452 | 204	285	0.1142
 453 | 204	290	0.1108
 454 | 204	292	0.1590
 455 | 205	225	0.1394
 456 | 205	227	0.2753
 457 | 205	229	0.4336
 458 | 205	235	0.1298
 459 | 205	251	0.3546
 460 | 205	257	0.1201
 461 | 205	268	0.4697
 462 | 205	274	0.1466
 463 | 205	275	0.1294
 464 | 205	289	0.1066
 465 | 205	291	0.1569
 466 | 206	224	0.1389
 467 | 206	226	0.2705
 468 | 206	228	0.4310
 469 | 206	234	0.1527
 470 | 206	255	0.1088
 471 | 206	256	0.2131
 472 | 206	266	0.1189
 473 | 206	267	0.4808
 474 | 206	273	0.1655
 475 | 206	283	0.3211
 476 | 206	287	0.1589
 477 | 206	290	0.1545
 478 | 207	223	0.1377
 479 | 207	224	0.1298
 480 | 207	226	0.1387
 481 | 207	233	0.1515
 482 | 207	254	0.1134
 483 | 207	255	0.2275
 484 | 207	265	0.1263
 485 | 207	266	0.4820
 486 | 207	272	0.1630
 487 | 207	282	0.3239
 488 | 207	286	0.1574
 489 | 207	287	0.1023
 490 | 208	223	0.1288
 491 | 208	224	0.2038
 492 | 208	226	0.1829
 493 | 208	228	0.1407
 494 | 208	253	0.1124
 495 | 208	254	0.2278
 496 | 208	264	0.1250
 497 | 208	265	0.4800
 498 | 208	266	0.1060
 499 | 208	267	0.1275
 500 | 208	281	0.3198
 501 | 208	285	0.1552
 502 | 208	286	0.1000
 503 | 208	287	0.1113
 504 | 209	223	0.2051
 505 | 209	224	0.1324
 506 | 209	226	0.1098
 507 | 209	228	0.2073
 508 | 209	252	0.1114
 509 | 209	253	0.2250
 510 | 209	264	0.4745
 511 | 209	265	0.1086
 512 | 209	266	0.1499
 513 | 209	280	0.3168
 514 | 209	284	0.1527
 515 | 209	286	0.1107
 516 | 209	287	0.1831
 517 | 210	223	0.1308
 518 | 210	224	0.4083
 519 | 210	228	0.2346
 520 | 210	252	0.2227
 521 | 210	264	0.1077
 522 | 210	265	0.1656
 523 | 210	279	0.3128
 524 | 210	283	0.1511
 525 | 210	285	0.1098
 526 | 210	286	0.1847
 527 | 211	223	0.4073
 528 | 211	226	0.5456
 529 | 211	228	0.2629
 530 | 211	260	0.2894
 531 | 211	262	0.3056
 532 | 211	264	0.1638
 533 | 211	282	0.1472
 534 | 211	284	0.1030
 535 | 211	285	0.1822
 536 | 211	287	0.1138
 537 | 212	220	0.1517
 538 | 212	222	0.4009
 539 | 212	225	0.5491
 540 | 212	227	0.2618
 541 | 212	259	0.2864
 542 | 212	261	0.4063
 543 | 212	263	0.1592
 544 | 212	277	0.3055
 545 | 213	224	0.5492
 546 | 213	226	0.2614
 547 | 213	260	0.4035
 548 | 213	262	0.1379
 549 | 213	276	0.3059
 550 | 213	280	0.1439
 551 | 213	283	0.2342
 552 | 213	286	0.1800
 553 | 214	223	0.5466
 554 | 214	260	0.1147
 555 | 214	279	0.1428
 556 | 214	282	0.2363
 557 | 214	285	0.1880
 558 | 214	312	0.2296
 559 | 215	256	0.5160
 560 | 215	281	0.2354
 561 | 215	284	0.1935
 562 | 215	311	0.2282
 563 | 216	223	0.1776
 564 | 216	224	0.1972
 565 | 216	255	0.5354
 566 | 216	273	0.2991
 567 | 216	280	0.2340
 568 | 216	283	0.1925
 569 | 216	310	0.2262
 570 | 217	223	0.1962
 571 | 217	254	0.5340
 572 | 217	272	0.2958
 573 | 217	279	0.2317
 574 | 217	282	0.1913
 575 | 217	309	0.2240
 576 | 218	253	0.5313
 577 | 218	281	0.1900
 578 | 218	308	0.2071
 579 | 219	252	0.5258
 580 | 219	280	0.1880
 581 | 223	232	0.5677
 582 | 223	248	0.1347
 583 | 224	231	0.5677
 584 | 224	247	0.1340
 585 | 225	246	0.1288
 586 | 232	240	0.1363
 587 | 233	239	0.1360
 588 | 233	248	0.8730
 589 | 234	238	0.1344
 590 | 234	247	0.8738
 591 | 235	246	0.8708
 592 | 236	245	0.8674
 593 | 237	244	0.8633
 594 | 238	243	0.8558
 595 | 243	259	0.1502
 596 | 244	258	0.1510
 597 | 244	342	0.2503
 598 | 245	257	0.1496
 599 | 245	341	0.3918
 600 | 246	337	0.1014
 601 | 246	340	0.4018
 602 | 247	255	0.1084
 603 | 247	256	0.1006
 604 | 247	336	0.1622
 605 | 247	339	0.4053
 606 | 248	254	0.1083
 607 | 248	255	0.1079
 608 | 248	338	0.3965
 609 | 249	254	0.1286
 610 | 249	333	0.7397
 611 | 250	332	0.7635
 612 | 251	331	0.7933
 613 | 252	330	0.8029
 614 | 253	329	0.7921
 615 | 254	328	0.7751
 616 | 255	269	0.5011
 617 | 255	325	0.8065
 618 | 256	268	0.5082
 619 | 256	324	0.8120
 620 | 257	267	0.5093
 621 | 257	323	0.8189
 622 | 258	266	0.5070
 623 | 258	322	0.8088
 624 | 259	265	0.4998
 625 | 259	321	0.7992
 626 | 260	320	0.7886
 627 | 262	317	0.6497
 628 | 262	318	0.1102
 629 | 262	319	0.1079
 630 | 263	316	0.6542
 631 | 264	315	0.6463
 632 | 264	318	0.2207
 633 | 265	317	0.2183
 634 | 266	313	0.2650
 635 | 268	311	0.3833
 636 | 269	309	0.5636
 637 | 269	310	0.3371
 638 | 269	333	0.1025
 639 | 270	308	0.5861
 640 | 270	332	0.1035
 641 | 271	308	0.1773
 642 | 271	331	0.1032
 643 | 272	306	0.7614
 644 | 272	330	0.1014
 645 | 272	350	0.4069
 646 | 273	305	0.7534
 647 | 273	306	0.1029
 648 | 273	349	0.4382
 649 | 274	348	0.4446
 650 | 275	304	0.7845
 651 | 275	346	0.4002
 652 | 275	347	0.4295
 653 | 276	303	0.7789
 654 | 276	328	0.1699
 655 | 276	345	0.5967
 656 | 277	302	0.7596
 657 | 277	327	0.1701
 658 | 277	344	0.5801
 659 | 278	299	0.2289
 660 | 278	301	0.6480
 661 | 278	304	0.1465
 662 | 278	326	0.1911
 663 | 278	343	0.5648
 664 | 279	298	0.1697
 665 | 279	303	0.1452
 666 | 279	325	0.1924
 667 | 279	342	0.5505
 668 | 280	298	0.4567
 669 | 280	324	0.1897
 670 | 280	341	0.5369
 671 | 281	297	0.4785
 672 | 281	300	0.2383
 673 | 281	340	0.4895
 674 | 282	296	0.4719
 675 | 283	295	0.4491
 676 | 283	298	0.7616
 677 | 284	294	0.3242
 678 | 284	296	0.1493
 679 | 284	297	0.7833
 680 | 285	293	0.3178
 681 | 285	294	0.2807
 682 | 285	295	0.4053
 683 | 285	296	0.7816
 684 | 286	293	0.2766
 685 | 286	294	0.4257
 686 | 286	295	0.7753
 687 | 287	293	0.4277
 688 | 287	294	0.7686
 689 | 288	292	0.4010
 690 | 288	339	0.1274
 691 | 289	338	0.1248
 692 | 290	337	0.1195
 693 | 293	312	0.1206
 694 | 294	311	0.1272
 695 | 295	310	0.1356
 696 | 296	309	0.1346
 697 | 296	323	0.4252
 698 | 297	308	0.1277
 699 | 297	322	0.4286
 700 | 298	321	0.4327
 701 | 299	320	0.4296
 702 | 299	355	0.1221
 703 | 300	354	0.1151
 704 | 301	318	0.4143
 705 | 301	353	0.1085
 706 | 302	317	0.4381
 707 | 302	352	0.1027
 708 | 303	316	0.4972
 709 | 303	346	0.1045
 710 | 304	315	0.4990
 711 | 304	345	0.1160
 712 | 304	349	0.1176
 713 | 305	314	0.4944
 714 | 305	344	0.1135
 715 | 305	348	0.1511
 716 | 306	312	0.2306
 717 | 306	343	0.1094
 718 | 306	347	0.1533
 719 | 307	311	0.1989
 720 | 307	346	0.1484
 721 | 308	319	0.3517
 722 | 308	345	0.1334
 723 | 309	318	0.3787
 724 | 309	342	0.1844
 725 | 310	317	0.3751
 726 | 310	341	0.1826
 727 | 311	340	0.1765
 728 | 314	337	0.3574
 729 | 315	336	0.3722
 730 | 316	335	0.3481
 731 | 318	333	0.4139
 732 | 319	332	0.4116
 733 | 320	331	0.4065
 734 | 321	330	0.4006
 735 | 322	329	0.3944
 736 | 323	328	0.3879
 737 | 324	338	0.1120
 738 | 324	339	0.1421
 739 | 325	336	0.2851
 740 | 325	338	0.1371
 741 | 326	335	0.2816
 742 | 326	337	0.1237
 743 | 326	361	0.5303
 744 | 327	334	0.2908
 745 | 327	360	0.8144
 746 | 328	333	0.2867
 747 | 328	359	0.9562
 748 | 329	358	0.8340
 749 | 330	357	0.7477
 750 | 331	356	0.4859
 751 | 332	356	0.6229
 752 | 333	355	0.8273
 753 | 334	344	0.2314
 754 | 334	354	0.9081
 755 | 335	343	0.2364
 756 | 336	342	0.2301
 757 | 336	352	0.9760
 758 | 337	351	0.9476
 759 | 338	350	0.9075
 760 | 339	349	0.8719
 761 | 340	348	0.8399
 762 | 341	347	0.8105
 763 | 342	346	0.5083
 764 | >random_negative_0000007
 765 | 1	48	0.2871
 766 | 1	50	0.1565
 767 | 2	34	0.6613
 768 | 2	48	0.1957
 769 | 3	33	0.7668
 770 | 3	46	0.5185
 771 | 3	47	0.2206
 772 | 4	24	0.1691
 773 | 4	32	0.7385
 774 | 4	45	0.5601
 775 | 4	69	0.1430
 776 | 5	23	0.1543
 777 | 5	31	0.6638
 778 | 5	44	0.5033
 779 | 5	68	0.1298
 780 | 5	75	0.2024
 781 | 6	22	0.1419
 782 | 6	30	0.6090
 783 | 6	34	0.3284
 784 | 6	43	0.4664
 785 | 6	67	0.1191
 786 | 6	74	0.2150
 787 | 7	21	0.1311
 788 | 7	29	0.5655
 789 | 7	33	0.3670
 790 | 7	42	0.4425
 791 | 8	19	0.1378
 792 | 8	28	0.5263
 793 | 8	32	0.3489
 794 | 8	41	0.4141
 795 | 8	65	0.1068
 796 | 8	72	0.2141
 797 | 9	18	0.1301
 798 | 9	26	0.4329
 799 | 9	31	0.3288
 800 | 9	40	0.3903
 801 | 9	64	0.1007
 802 | 9	71	0.2021
 803 | 10	25	0.4082
 804 | 10	28	0.1129
 805 | 10	30	0.2826
 806 | 10	39	0.3577
 807 | 10	70	0.1625
 808 | 11	27	0.2824
 809 | 12	24	0.3466
 810 | 12	26	0.2834
 811 | 12	28	0.1758
 812 | 12	68	0.1485
 813 | 12	69	0.1159
 814 | 13	23	0.3297
 815 | 13	25	0.2506
 816 | 13	26	0.1294
 817 | 13	34	0.1803
 818 | 13	67	0.1430
 819 | 13	68	0.1113
 820 | 14	20	0.1287
 821 | 14	22	0.2860
 822 | 14	24	0.1832
 823 | 14	25	0.1626
 824 | 14	34	0.1690
 825 | 14	66	0.1366
 826 | 14	67	0.1066
 827 | 15	19	0.1297
 828 | 15	24	0.1716
 829 | 15	32	0.8503
 830 | 15	65	0.1241
 831 | 15	66	0.1011
 832 | 16	24	0.2191
 833 | 16	31	0.8325
 834 | 16	64	0.1158
 835 | 17	23	0.2214
 836 | 17	30	0.8103
 837 | 17	63	0.1037
 838 | 18	29	0.7910
 839 | 20	27	0.7376
 840 | 21	26	0.6954
 841 | 24	38	0.1553
 842 | 24	84	0.1167
 843 | 24	121	0.1023
 844 | 25	37	0.1525
 845 | 25	83	0.1149
 846 | 25	122	0.2455
 847 | 26	36	0.1418
 848 | 26	82	0.1128
 849 | 26	120	0.1431
 850 | 26	121	0.2565
 851 | 27	81	0.1107
 852 | 28	35	0.1102
 853 | 28	80	0.1087
 854 | 28	119	0.6346
 855 | 29	118	0.6358
 856 | 30	117	0.6319
 857 | 31	116	0.6234
 858 | 32	115	0.6121
 859 | 33	113	0.1040
 860 | 33	114	0.4142
 861 | 33	125	0.1331
 862 | 34	112	0.1447
 863 | 34	124	0.1762
 864 | 34	126	0.1152
 865 | 35	111	0.1458
 866 | 35	113	0.1192
 867 | 35	114	0.5179
 868 | 35	123	0.1779
 869 | 35	125	0.1291
 870 | 36	113	0.5301
 871 | 36	114	0.1446
 872 | 36	123	0.1102
 873 | 37	113	0.1552
 874 | 38	111	0.5214
 875 | 38	113	0.1251
 876 | 38	123	0.1142
 877 | 39	54	0.1149
 878 | 39	110	0.4215
 879 | 39	112	0.1110
 880 | 39	121	0.6885
 881 | 40	53	0.1223
 882 | 40	109	0.2945
 883 | 40	110	0.5300
 884 | 40	120	0.6939
 885 | 41	52	0.1269
 886 | 41	109	0.6045
 887 | 41	119	0.6995
 888 | 42	51	0.1277
 889 | 42	108	0.6685
 890 | 42	118	0.6950
 891 | 43	107	0.6728
 892 | 43	117	0.6909
 893 | 44	99	0.1552
 894 | 44	106	0.6682
 895 | 44	116	0.6860
 896 | 45	98	0.1540
 897 | 45	105	0.6608
 898 | 45	115	0.6785
 899 | 46	97	0.1326
 900 | 46	104	0.6534
 901 | 46	114	0.6709
 902 | 47	103	0.6459
 903 | 47	113	0.6637
 904 | 48	101	0.6178
 905 | 48	112	0.6230
 906 | 49	96	0.1494
 907 | 49	100	0.6132
 908 | 49	111	0.6167
 909 | 50	95	0.1594
 910 | 50	99	0.6065
 911 | 50	110	0.6436
 912 | 51	94	0.1598
 913 | 51	98	0.5982
 914 | 51	109	0.6372
 915 | 51	146	0.3532
 916 | 52	66	0.1233
 917 | 52	68	0.1046
 918 | 52	74	0.4655
 919 | 52	93	0.1716
 920 | 52	97	0.3238
 921 | 52	108	0.6278
 922 | 52	145	0.3821
 923 | 53	65	0.1280
 924 | 53	66	0.7055
 925 | 53	73	0.4675
 926 | 53	90	0.1159
 927 | 53	91	0.1262
 928 | 53	92	0.1841
 929 | 53	93	0.1126
 930 | 53	144	0.3824
 931 | 54	64	0.1264
 932 | 54	65	0.7036
 933 | 54	72	0.4632
 934 | 54	89	0.1151
 935 | 54	90	0.1257
 936 | 54	91	0.1818
 937 | 54	92	0.1116
 938 | 54	143	0.3835
 939 | 55	62	0.1258
 940 | 55	64	0.6976
 941 | 55	71	0.4589
 942 | 55	88	0.1144
 943 | 55	89	0.1251
 944 | 55	90	0.1794
 945 | 55	91	0.1104
 946 | 55	118	0.1282
 947 | 55	142	0.3791
 948 | 56	87	0.1130
 949 | 56	117	0.1603
 950 | 56	139	0.2753
 951 | 56	141	0.2380
 952 | 57	87	0.1188
 953 | 57	116	0.1640
 954 | 57	138	0.2765
 955 | 57	139	0.2476
 956 | 58	87	0.1334
 957 | 58	115	0.1626
 958 | 58	138	0.2455
 959 | 59	136	0.3467
 960 | 59	141	0.1500
 961 | 60	65	0.1006
 962 | 60	67	0.2119
 963 | 60	86	0.1912
 964 | 60	114	0.1377
 965 | 60	135	0.3420
 966 | 60	140	0.1689
 967 | 61	133	0.1140
 968 | 61	134	0.3292
 969 | 61	139	0.1697
 970 | 62	84	0.2507
 971 | 62	112	0.1346
 972 | 62	133	0.3265
 973 | 62	138	0.1681
 974 | 63	83	0.2493
 975 | 63	131	0.2607
 976 | 63	136	0.1068
 977 | 64	82	0.2468
 978 | 64	110	0.1790
 979 | 64	130	0.2591
 980 | 64	131	0.1865
 981 | 65	80	0.1466
 982 | 65	109	0.1778
 983 | 65	130	0.2019
 984 | 65	134	0.1062
 985 | 66	127	0.2015
 986 | 66	133	0.1056
 987 | 67	77	0.1280
 988 | 67	107	0.5640
 989 | 67	126	0.2059
 990 | 67	127	0.1268
 991 | 67	134	0.1019
 992 | 68	76	0.1344
 993 | 68	77	0.1273
 994 | 68	106	0.5736
 995 | 68	124	0.1578
 996 | 68	126	0.1346
 997 | 68	133	0.1019
 998 | 69	76	0.1282
 999 | 69	105	0.5691
1000 | 69	124	0.1626
1001 | 70	77	0.1948
1002 | 70	122	0.1879
1003 | 70	124	0.1242
1004 | 71	76	0.2032
1005 | 71	101	0.5758
1006 | 71	121	0.1875
1007 | 71	122	0.2585
1008 | 72	120	0.1857
1009 | 72	121	0.2628
1010 | 72	122	0.1062
1011 | 72	127	0.1238
1012 | 72	139	0.4362
1013 | 73	99	0.5817
1014 | 73	119	0.1838
1015 | 73	120	0.2614
1016 | 73	121	0.1059
1017 | 73	126	0.1358
1018 | 73	138	0.4358
1019 | 74	98	0.5778
1020 | 74	119	0.2598
1021 | 74	120	0.1019
1022 | 75	117	0.1101
1023 | 75	124	0.1483
1024 | 75	136	0.4344
1025 | 76	97	0.6945
1026 | 76	118	0.2614
1027 | 76	123	0.1481
1028 | 76	135	0.4299
1029 | 76	151	0.2476
1030 | 77	96	0.7091
1031 | 77	150	0.2540
1032 | 78	95	0.7156
1033 | 78	116	0.3284
1034 | 78	120	0.1584
1035 | 78	134	0.4314
1036 | 78	149	0.2550
1037 | 79	94	0.7106
1038 | 79	115	0.3272
1039 | 79	119	0.1610
1040 | 79	133	0.4653
1041 | 79	148	0.2606
1042 | 80	93	0.7019
1043 | 80	114	0.3230
1044 | 80	118	0.1616
1045 | 80	132	0.4633
1046 | 80	147	0.2644
1047 | 81	117	0.1592
1048 | 81	131	0.4583
1049 | 81	146	0.2628
1050 | 82	91	0.5120
1051 | 82	92	0.4677
1052 | 82	113	0.3003
1053 | 82	129	0.1087
1054 | 82	145	0.2609
1055 | 83	90	0.5109
1056 | 83	91	0.4643
1057 | 83	129	0.4236
1058 | 83	144	0.2584
1059 | 84	89	0.5082
1060 | 84	90	0.4613
1061 | 84	111	0.2951
1062 | 84	114	0.2287
1063 | 84	128	0.4649
1064 | 84	143	0.2554
1065 | 85	110	0.2948
1066 | 85	127	0.4784
1067 | 85	139	0.1019
1068 | 86	109	0.2931
1069 | 86	112	0.3084
1070 | 86	126	0.5099
1071 | 86	138	0.1014
1072 | 87	108	0.2913
1073 | 87	111	0.3302
1074 | 87	125	0.5117
1075 | 87	137	0.1008
1076 | 88	107	0.2795
1077 | 88	110	0.3390
1078 | 88	124	0.5079
1079 | 89	106	0.2750
1080 | 89	109	0.3371
1081 | 90	105	0.2699
1082 | 90	122	0.5050
1083 | 90	176	0.1051
1084 | 91	99	0.1372
1085 | 91	107	0.3420
1086 | 91	121	0.5033
1087 | 91	175	0.1036
1088 | 91	176	0.1925
1089 | 92	98	0.1365
1090 | 92	106	0.3467
1091 | 92	120	0.5007
1092 | 92	174	0.1020
1093 | 92	175	0.1935
1094 | 93	101	0.1637
1095 | 93	105	0.3458
1096 | 93	119	0.4982
1097 | 93	174	0.1904
1098 | 94	100	0.1515
1099 | 94	104	0.3458
1100 | 94	118	0.3743
1101 | 95	103	0.3438
1102 | 95	118	0.3205
1103 | 96	117	0.3241
1104 | 96	173	0.2835
1105 | 97	115	0.4339
1106 | 97	116	0.2281
1107 | 97	172	0.3163
1108 | 97	189	0.1005
1109 | 98	114	0.4879
1110 | 98	171	0.3131
1111 | 98	188	0.1064
1112 | 99	113	0.4854
1113 | 99	170	0.3093
1114 | 99	187	0.1048
1115 | 100	109	0.1064
1116 | 100	112	0.4763
1117 | 100	119	0.1120
1118 | 100	169	0.3060
1119 | 101	108	0.1068
1120 | 101	111	0.4734
1121 | 101	118	0.1124
1122 | 102	117	0.1118
1123 | 102	168	0.2937
1124 | 103	109	0.2952
1125 | 103	110	0.2142
1126 | 103	116	0.1109
1127 | 103	190	0.3068
1128 | 104	166	0.2970
1129 | 104	189	0.3166
1130 | 105	114	0.1106
1131 | 105	165	0.2965
1132 | 105	188	0.3172
1133 | 106	113	0.1104
1134 | 106	164	0.2929
1135 | 106	187	0.3126
1136 | 107	161	0.1779
1137 | 107	163	0.2195
1138 | 107	186	0.3061
1139 | 108	160	0.2561
1140 | 108	162	0.1231
1141 | 108	172	0.1656
1142 | 108	179	0.3427
1143 | 108	185	0.1714
1144 | 109	159	0.2686
1145 | 109	171	0.1643
1146 | 109	178	0.3672
1147 | 110	158	0.2658
1148 | 110	170	0.1625
1149 | 110	177	0.3632
1150 | 111	169	0.1601
1151 | 111	176	0.3541
1152 | 111	182	0.1207
1153 | 112	156	0.2060
1154 | 112	181	0.1191
1155 | 113	149	0.1140
1156 | 113	173	0.3291
1157 | 113	174	0.2203
1158 | 113	180	0.1169
1159 | 114	148	0.1208
1160 | 114	166	0.1535
1161 | 114	172	0.4468
1162 | 114	179	0.1160
1163 | 115	147	0.1207
1164 | 115	152	0.3288
1165 | 115	165	0.1529
1166 | 115	171	0.4461
1167 | 115	178	0.1146
1168 | 116	151	0.3287
1169 | 116	164	0.1512
1170 | 116	170	0.4411
1171 | 116	177	0.1125
1172 | 117	147	0.1677
1173 | 117	150	0.3177
1174 | 117	163	0.1100
1175 | 118	146	0.4206
1176 | 118	149	0.1503
1177 | 118	160	0.1393
1178 | 118	168	0.4308
1179 | 119	145	0.4600
1180 | 119	147	0.1252
1181 | 119	159	0.1463
1182 | 119	167	0.4343
1183 | 120	144	0.4613
1184 | 120	145	0.1449
1185 | 120	158	0.1451
1186 | 120	165	0.5310
1187 | 121	143	0.4595
1188 | 121	144	0.1458
1189 | 121	157	0.1438
1190 | 121	164	0.5339
1191 | 122	142	0.4477
1192 | 122	143	0.1441
1193 | 122	156	0.1273
1194 | 122	163	0.5548
1195 | 123	141	0.4031
1196 | 123	160	0.1103
1197 | 123	162	0.5630
1198 | 123	174	0.1393
1199 | 124	140	0.2889
1200 | 124	153	0.1068
1201 | 124	159	0.1090
1202 | 124	161	0.5586
1203 | 125	139	0.1647
1204 | 125	141	0.1333
1205 | 125	160	0.5546
1206 | 125	172	0.3168
1207 | 125	179	0.1156
1208 | 126	151	0.1273
1209 | 126	158	0.2329
1210 | 126	159	0.4977
1211 | 126	171	0.3150
1212 | 126	178	0.1147
1213 | 127	140	0.4593
1214 | 127	150	0.1279
1215 | 127	157	0.3280
1216 | 127	158	0.3677
1217 | 127	170	0.3138
1218 | 127	177	0.1135
1219 | 128	139	0.5605
1220 | 128	149	0.1273
1221 | 128	169	0.3157
1222 | 128	176	0.1126
1223 | 129	138	0.5748
1224 | 129	148	0.1257
1225 | 129	168	0.3129
1226 | 129	175	0.1111
1227 | 130	137	0.5726
1228 | 130	147	0.1251
1229 | 130	154	0.5520
1230 | 130	167	0.3098
1231 | 131	153	0.5478
1232 | 132	172	0.1079
1233 | 132	229	0.1457
1234 | 133	151	0.5424
1235 | 133	164	0.3068
1236 | 133	171	0.1069
1237 | 133	228	0.1434
1238 | 134	150	0.5363
1239 | 134	163	0.3061
1240 | 134	170	0.1058
1241 | 135	149	0.5076
1242 | 135	162	0.3042
1243 | 135	169	0.1046
1244 | 135	216	0.1706
1245 | 136	147	0.1484
1246 | 136	161	0.3017
1247 | 136	215	0.1692
1248 | 136	224	0.1863
1249 | 137	146	0.5306
1250 | 137	160	0.2994
1251 | 137	216	0.1178
1252 | 138	145	0.5333
1253 | 138	159	0.2968
1254 | 138	215	0.1162
1255 | 138	222	0.2836
1256 | 138	223	0.1522
1257 | 139	144	0.5304
1258 | 139	158	0.2939
1259 | 139	212	0.2619
1260 | 139	221	0.2808
1261 | 139	222	0.1509
1262 | 140	211	0.2607
1263 | 140	220	0.2623
1264 | 141	156	0.1084
1265 | 141	186	0.1395
1266 | 142	185	0.1671
1267 | 142	205	0.1316
1268 | 142	208	0.3210
1269 | 142	209	0.3339
1270 | 142	218	0.1400
1271 | 142	219	0.3603
1272 | 143	184	0.1657
1273 | 143	207	0.3307
1274 | 143	208	0.3297
1275 | 143	217	0.1376
1276 | 143	218	0.3909
1277 | 144	183	0.1650
1278 | 144	203	0.2565
1279 | 144	206	0.4099
1280 | 144	207	0.2287
1281 | 144	217	0.3864
1282 | 145	182	0.1639
1283 | 145	203	0.1210
1284 | 145	205	0.4723
1285 | 145	216	0.3794
1286 | 146	151	0.1177
1287 | 146	153	0.1062
1288 | 146	181	0.1568
1289 | 146	201	0.2832
1290 | 146	202	0.1134
1291 | 146	204	0.4691
1292 | 146	215	0.3673
1293 | 147	179	0.1604
1294 | 147	200	0.2968
1295 | 147	203	0.4747
1296 | 148	178	0.1590
1297 | 148	202	0.4671
1298 | 148	213	0.3398
1299 | 149	177	0.1477
1300 | 149	201	0.3894
1301 | 149	212	0.3618
1302 | 150	211	0.3587
1303 | 151	175	0.1801
1304 | 151	196	0.6200
1305 | 151	199	0.1162
1306 | 151	200	0.3184
1307 | 151	210	0.3549
1308 | 152	174	0.1791
1309 | 152	195	0.6904
1310 | 152	199	0.3138
1311 | 152	209	0.3512
1312 | 153	173	0.1778
1313 | 153	194	0.6929
1314 | 153	196	0.2034
1315 | 153	198	0.2782
1316 | 154	172	0.1755
1317 | 154	193	0.6915
1318 | 154	195	0.2665
1319 | 154	208	0.3456
1320 | 155	192	0.4842
1321 | 155	194	0.2623
1322 | 155	196	0.1938
1323 | 155	207	0.3421
1324 | 156	192	0.6015
1325 | 156	206	0.3387
1326 | 157	191	0.7738
1327 | 157	205	0.3355
1328 | 158	169	0.1676
1329 | 158	190	0.7677
1330 | 159	168	0.1758
1331 | 159	189	0.7607
1332 | 159	203	0.3285
1333 | 160	167	0.1811
1334 | 160	188	0.7529
1335 | 160	202	0.3252
1336 | 161	166	0.1497
1337 | 161	198	0.1899
1338 | 162	187	0.3181
1339 | 162	197	0.1905
1340 | 163	183	0.1495
1341 | 163	184	0.5989
1342 | 163	196	0.1880
1343 | 163	219	0.1215
1344 | 164	182	0.1541
1345 | 164	183	0.7380
1346 | 164	185	0.1024
1347 | 164	195	0.1845
1348 | 164	218	0.1321
1349 | 165	182	0.7455
1350 | 165	194	0.1450
1351 | 165	217	0.1302
1352 | 166	181	0.7139
1353 | 167	179	0.8026
1354 | 167	182	0.1128
1355 | 167	193	0.1110
1356 | 168	178	0.7983
1357 | 169	177	0.8074
1358 | 169	181	0.1363
1359 | 170	176	0.8033
1360 | 170	180	0.1536
1361 | 170	190	0.1009
1362 | 170	238	0.1431
1363 | 171	175	0.7850
1364 | 171	179	0.1571
1365 | 171	189	0.1000
1366 | 171	237	0.1433
1367 | 172	178	0.1560
1368 | 172	236	0.1424
1369 | 173	177	0.1396
1370 | 173	224	0.2727
1371 | 173	235	0.1435
1372 | 173	254	0.1671
1373 | 174	223	0.3027
1374 | 174	234	0.1451
1375 | 174	242	0.1214
1376 | 174	253	0.2516
1377 | 175	222	0.3000
1378 | 175	233	0.1435
1379 | 175	241	0.1209
1380 | 175	252	0.2490
1381 | 176	221	0.2970
1382 | 176	231	0.1408
1383 | 176	251	0.2460
1384 | 177	220	0.2734
1385 | 177	230	0.1393
1386 | 177	238	0.2123
1387 | 177	239	0.1151
1388 | 177	250	0.2431
1389 | 178	203	0.3104
1390 | 178	219	0.2258
1391 | 178	229	0.1379
1392 | 178	237	0.2118
1393 | 178	238	0.1115
1394 | 178	249	0.2394
1395 | 179	202	0.3089
1396 | 179	228	0.1362
1397 | 179	236	0.2105
1398 | 179	248	0.2349
1399 | 180	201	0.3075
1400 | 180	235	0.2070
1401 | 181	200	0.3029
1402 | 181	203	0.1793
1403 | 181	216	0.3632
1404 | 181	237	0.1430
1405 | 181	249	0.1122
1406 | 182	202	0.1782
1407 | 182	215	0.3618
1408 | 182	233	0.1489
1409 | 182	234	0.1267
1410 | 182	236	0.1447
1411 | 182	248	0.1135
1412 | 183	201	0.1716
1413 | 183	214	0.3586
1414 | 183	233	0.1215
1415 | 183	235	0.1432
1416 | 184	213	0.3558
1417 | 184	234	0.1415
1418 | 184	246	0.2093
1419 | 184	283	0.2396
1420 | 185	197	0.4218
1421 | 185	212	0.3530
1422 | 185	231	0.1636
1423 | 185	233	0.1390
1424 | 185	245	0.2203
1425 | 185	282	0.2684
1426 | 186	196	0.4218
1427 | 186	210	0.1597
1428 | 186	211	0.3100
1429 | 186	230	0.1618
1430 | 186	232	0.1301
1431 | 186	244	0.2146
1432 | 186	281	0.2637
1433 | 187	195	0.4183
1434 | 187	200	0.1512
1435 | 187	209	0.2247
1436 | 187	210	0.2589
1437 | 187	229	0.1590
1438 | 187	243	0.1714
1439 | 187	280	0.2585
1440 | 188	193	0.2029
1441 | 188	194	0.3135
1442 | 188	199	0.1504
1443 | 188	208	0.2233
1444 | 188	209	0.2547
1445 | 188	279	0.2529
1446 | 190	197	0.1260
1447 | 190	242	0.2188
1448 | 191	204	0.1230
1449 | 191	241	0.2221
1450 | 192	224	0.1170
1451 | 192	240	0.2163
1452 | 193	202	0.1557
1453 | 193	204	0.1970
1454 | 193	223	0.1185
1455 | 193	236	0.3054
1456 | 194	201	0.1464
1457 | 194	235	0.3090
1458 | 195	202	0.2334
1459 | 195	234	0.3070
1460 | 195	275	0.2058
1461 | 196	201	0.2172
1462 | 196	233	0.3000
1463 | 196	274	0.2045
1464 | 197	232	0.1605
1465 | 197	273	0.2023
1466 | 197	286	0.1209
1467 | 198	223	0.3534
1468 | 198	224	0.1411
1469 | 198	234	0.1091
1470 | 198	235	0.1085
1471 | 198	272	0.1818
1472 | 198	285	0.1196
1473 | 199	222	0.5192
1474 | 199	223	0.1465
1475 | 199	233	0.1624
1476 | 199	234	0.1159
1477 | 199	284	0.1172
1478 | 199	296	0.1045
1479 | 200	221	0.5176
1480 | 200	222	0.1410
1481 | 200	231	0.4396
1482 | 200	233	0.1107
1483 | 200	282	0.1046
1484 | 200	295	0.1086
1485 | 201	219	0.3408
1486 | 201	220	0.4170
1487 | 201	230	0.4496
1488 | 201	294	0.1062
1489 | 202	217	0.1233
1490 | 202	218	0.4528
1491 | 202	219	0.2542
1492 | 202	229	0.4516
1493 | 203	228	0.4480
1494 | 204	216	0.7217
1495 | 204	227	0.4295
1496 | 205	215	0.7231
1497 | 206	214	0.7182
1498 | 206	225	0.4314
1499 | 207	213	0.7127
1500 | 207	224	0.4415
1501 | 208	212	0.7021
1502 | 208	223	0.4390
1503 | 209	222	0.4355
1504 | 210	221	0.4225
1505 | 211	268	0.1036
1506 | 212	218	0.1843
1507 | 212	219	0.1274
1508 | 212	267	0.1110
1509 | 213	266	0.1104
1510 | 214	265	0.1093
1511 | 215	264	0.1066
1512 | 215	276	0.1065
1513 | 215	314	0.3524
1514 | 216	263	0.1046
1515 | 216	275	0.1057
1516 | 216	313	0.3669
1517 | 217	312	0.3730
1518 | 217	313	0.7038
1519 | 218	284	0.3374
1520 | 218	311	0.3707
1521 | 218	312	0.7164
1522 | 219	283	0.3371
1523 | 219	310	0.2590
1524 | 219	311	0.7159
1525 | 220	282	0.3175
1526 | 220	310	0.7707
1527 | 221	280	0.3772
1528 | 221	281	0.1793
1529 | 221	288	0.1059
1530 | 221	309	0.8200
1531 | 222	279	0.3768
1532 | 222	280	0.1773
1533 | 222	287	0.1053
1534 | 222	308	0.8162
1535 | 223	267	0.3326
1536 | 223	278	0.3754
1537 | 223	279	0.1742
1538 | 223	286	0.1033
1539 | 223	307	0.8083
1540 | 224	266	0.3267
1541 | 224	277	0.3689
1542 | 224	306	0.6990
1543 | 225	265	0.2750
1544 | 225	266	0.1339
1545 | 226	265	0.1443
1546 | 226	266	0.1036
1547 | 226	306	0.3855
1548 | 227	274	0.1013
1549 | 227	305	0.7796
1550 | 228	264	0.6012
1551 | 228	276	0.3596
1552 | 228	304	0.8098
1553 | 229	263	0.6038
1554 | 229	275	0.3577
1555 | 230	274	0.3553
1556 | 230	303	0.8424
1557 | 231	261	0.5963
1558 | 231	273	0.3432
1559 | 231	302	0.8622
1560 | 232	260	0.6746
1561 | 232	272	0.2552
1562 | 232	301	0.8635
1563 | 233	259	0.7194
1564 | 233	300	0.8687
1565 | 234	258	0.7172
1566 | 234	299	0.8695
1567 | 235	257	0.7147
1568 | 235	298	0.8633
1569 | 236	256	0.7116
1570 | 236	297	0.8570
1571 | 237	253	0.1012
1572 | 237	254	0.7077
1573 | 237	296	0.7300
1574 | 238	252	0.1392
1575 | 238	253	0.7060
1576 | 238	295	0.5804
1577 | 238	296	0.4374
1578 | 239	251	0.1418
1579 | 239	252	0.7001
1580 | 239	295	0.6132
1581 | 240	294	0.7445
1582 | 241	250	0.7222
1583 | 241	291	0.2807
1584 | 241	292	0.2633
1585 | 241	293	0.7336
1586 | 242	249	0.7216
1587 | 242	290	0.2847
1588 | 242	291	0.2682
1589 | 242	292	0.7224
1590 | 243	248	0.7068
1591 | 243	289	0.2787
1592 | 244	289	0.3753
1593 | 245	287	0.2345
1594 | 245	288	0.3995
1595 | 245	290	0.1370
1596 | 245	291	0.1283
1597 | 247	285	0.2553
1598 | 248	286	0.2761
1599 | 248	290	0.3232
1600 | 248	291	0.2572
1601 | 249	284	0.5532
1602 | 249	289	0.2371
1603 | 250	282	0.6463
1604 | 250	289	0.3677
1605 | 251	281	0.6438
1606 | 251	288	0.4249
1607 | 252	280	0.6405
1608 | 252	287	0.4216
1609 | 253	279	0.6366
1610 | 253	286	0.4181
1611 | 254	278	0.6328
1612 | 255	277	0.6243
1613 | 256	275	0.3163
1614 | 256	284	0.3283
1615 | 257	274	0.3028
1616 | 257	283	0.2965
1617 | 257	284	0.1909
1618 | 258	282	0.2512
1619 | 258	283	0.2638
1620 | 259	282	0.2962
1621 | 260	281	0.2863
1622 | 261	271	0.1366
1623 | 261	272	0.1911
1624 | 262	268	0.1582
1625 | 262	270	0.1462
1626 | 262	271	0.2000
1627 | 263	267	0.1596
1628 | 263	269	0.1361
1629 | 263	276	0.6568
1630 | 264	275	0.6534
1631 | 265	274	0.6400
1632 | 273	282	0.1468
1633 | 273	335	0.6157
1634 | 274	281	0.1465
1635 | 274	334	0.6094
1636 | 275	280	0.1433
1637 | 275	333	0.5995
1638 | 276	284	0.1333
1639 | 276	332	0.5890
1640 | 277	283	0.1334
1641 | 277	331	0.5620
1642 | 278	282	0.1317
1643 | 278	330	0.5196
1644 | 278	331	0.1353
1645 | 279	325	0.1020
1646 | 279	329	0.5071
1647 | 279	330	0.1297
1648 | 280	324	0.1056
1649 | 280	328	0.4620
1650 | 280	329	0.1240
1651 | 281	301	0.1064
1652 | 281	323	0.1176
1653 | 282	299	0.1415
1654 | 282	300	0.1167
1655 | 282	322	0.1215
1656 | 283	298	0.1432
1657 | 283	321	0.1214
1658 | 283	334	0.1016
1659 | 284	297	0.1415
1660 | 284	299	0.1278
1661 | 284	320	0.1200
1662 | 284	333	0.1090
1663 | 285	298	0.1252
1664 | 285	327	0.2552
1665 | 286	296	0.1304
1666 | 286	319	0.1155
1667 | 286	325	0.2484
1668 | 286	326	0.2545
1669 | 286	330	0.3956
1670 | 287	295	0.1279
1671 | 287	296	0.1435
1672 | 287	318	0.1137
1673 | 287	324	0.2456
1674 | 287	325	0.2505
1675 | 287	329	0.3983
1676 | 288	295	0.1456
1677 | 288	323	0.2419
1678 | 288	324	0.2464
1679 | 288	328	0.3978
1680 | 289	297	0.1938
1681 | 289	320	0.2945
1682 | 289	327	0.4273
1683 | 289	333	0.1118
1684 | 290	296	0.1935
1685 | 290	319	0.2922
1686 | 290	326	0.4220
1687 | 290	332	0.1102
1688 | 291	295	0.1907
1689 | 291	313	0.2398
1690 | 291	318	0.2153
1691 | 291	325	0.4163
1692 | 291	331	0.1084
1693 | 292	312	0.2991
1694 | 292	324	0.4108
1695 | 292	330	0.1066
1696 | 293	311	0.2976
1697 | 293	323	0.4052
1698 | 293	329	0.1047
1699 | 294	310	0.2960
1700 | 295	309	0.2930
1701 | 295	315	0.1261
1702 | 295	321	0.3726
1703 | 296	308	0.2881
1704 | 296	314	0.1254
1705 | 296	320	0.3898
1706 | 297	313	0.1249
1707 | 297	319	0.3815
1708 | 298	318	0.3469
1709 | 299	312	0.1338
1710 | 299	313	0.2171
1711 | 300	311	0.1326
1712 | 300	312	0.2148
1713 | 301	314	0.1297
1714 | 302	311	0.1859
1715 | 302	313	0.1297
1716 | 303	314	0.1376
1717 | 304	311	0.1224
1718 | 304	313	0.1393
1719 | 304	328	0.3365
1720 | 305	314	0.1395
1721 | 305	327	0.3851
1722 | 306	313	0.1423
1723 | 306	326	0.3836
1724 | 307	312	0.1439
1725 | 307	325	0.3848
1726 | 308	324	0.3797
1727 | 309	323	0.3749
1728 | 310	322	0.3692
1729 | 311	321	0.3629
1730 | 312	320	0.3574
1731 | 313	333	0.1203
1732 | 314	318	0.1717
1733 | 314	325	0.1287
1734 | 314	332	0.1308
1735 | 314	360	0.1642
1736 | 314	361	0.1117
1737 | 315	324	0.1787
1738 | 315	325	0.1203
1739 | 315	331	0.1438
1740 | 315	359	0.3188
1741 | 315	360	0.1704
1742 | 316	323	0.1741
1743 | 316	324	0.1180
1744 | 316	330	0.1431
1745 | 316	358	0.2783
1746 | 316	359	0.1317
1747 | 317	323	0.1073
1748 | 317	329	0.1521
1749 | 317	347	0.1382
1750 | 317	357	0.2457
1751 | 317	358	0.1106
1752 | 318	346	0.1480
1753 | 318	352	0.8467
1754 | 318	356	0.1126
1755 | 319	327	0.1655
1756 | 319	345	0.1331
1757 | 319	349	0.2986
1758 | 319	351	0.8553
1759 | 320	326	0.1649
1760 | 320	348	0.3067
1761 | 320	350	0.8228
1762 | 320	359	0.8351
1763 | 320	360	0.2136
1764 | 321	325	0.1466
1765 | 321	347	0.2132
1766 | 321	348	0.7454
1767 | 321	358	0.7329
1768 | 321	359	0.1722
1769 | 322	347	0.8369
1770 | 322	357	0.6568
1771 | 322	358	0.1452
1772 | 323	341	0.1904
1773 | 323	346	0.8504
1774 | 323	356	0.5942
1775 | 324	340	0.1868
1776 | 324	345	0.8227
1777 | 324	355	0.5450
1778 | 324	356	0.1602
1779 | 325	339	0.1842
1780 | 325	344	0.8007
1781 | 325	354	0.4420
1782 | 325	355	0.1701
1783 | 325	356	0.1542
1784 | 326	338	0.1816
1785 | 326	343	0.7795
1786 | 326	353	0.2311
1787 | 326	354	0.1626
1788 | 326	355	0.1514
1789 | 327	337	0.1779
1790 | 327	357	0.1084
1791 | 328	336	0.1740
1792 | 328	341	0.7238
1793 | 328	342	0.1505
1794 | 328	352	0.1145
1795 | 328	353	0.4690
1796 | 328	356	0.1139
1797 | 329	340	0.7109
1798 | 329	341	0.1722
1799 | 329	352	0.4832
1800 | 329	355	0.1226
1801 | 330	339	0.6976
1802 | 330	340	0.1672
1803 | 330	351	0.4641
1804 | 330	354	0.1147
1805 | 331	338	0.6838
1806 | 331	339	0.1633
1807 | 331	353	0.1085
1808 | 332	338	0.1600
1809 | 332	349	0.4339
1810 | 332	352	0.1024
1811 | 333	348	0.4216
1812 | 334	347	0.4071
1813 | 335	346	0.3920
1814 | 335	351	0.1463
1815 | 336	350	0.1461
1816 | 337	344	0.2062
1817 | 337	345	0.1108
1818 | 337	349	0.1432
1819 | 338	348	0.1382
1820 | 339	347	0.1285
1821 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/negatives.con:
--------------------------------------------------------------------------------
  1 | >random_negative_0000006
  2 | 1	0	-0.934
  3 | 2	0	-1.134
  4 | 3	0.001	1.137
  5 | 4	0	-0.982
  6 | 5	0	0.128
  7 | 6	0	-0.268
  8 | 7	0	-0.46
  9 | 8	0	-0.33
 10 | 9	0	-0.779
 11 | 10	0	-1.213
 12 | 11	0.003	0.486
 13 | 12	0	-0.416
 14 | 13	0	-0.373
 15 | 14	0	-0.563
 16 | 15	0	-0.347
 17 | 16	0	-1.541
 18 | 17	0	-1.181
 19 | 18	0.002	0.845
 20 | 19	0.003	0.902
 21 | 20	0	-1.233
 22 | 21	0.001	0.137
 23 | 22	0	-0.029
 24 | 23	0	-0.374
 25 | 24	0.001	0.562
 26 | 25	0	-1.439
 27 | 26	0	0.04
 28 | 27	0	-0.076
 29 | 28	0	0.103
 30 | 29	0	-0.234
 31 | 30	0	-0.343
 32 | 31	0	-1.085
 33 | 32	0	0.11
 34 | 33	0	0.405
 35 | 34	0	-0.367
 36 | 35	0	-0.042
 37 | 36	0	-0.213
 38 | 37	0	-1.304
 39 | 38	0	-0.328
 40 | 39	0	-0.189
 41 | 40	0.001	0.632
 42 | 41	0	-0.656
 43 | 42	0	0.542
 44 | 43	0	-0.05
 45 | 44	0.001	0.064
 46 | 45	0.006	0.642
 47 | 46	0.005	0.669
 48 | 47	0	-0.746
 49 | 48	0	0.66
 50 | 49	0	-0.217
 51 | 50	0	0.237
 52 | 51	0	-0.776
 53 | 52	0	-1.372
 54 | 53	0	-1.446
 55 | 54	0	-0.311
 56 | 55	0	-0.245
 57 | 56	0	-0.743
 58 | 57	0.001	1.222
 59 | 58	0	-0.185
 60 | 59	0	-0.032
 61 | 60	0	0.026
 62 | 61	0	-0.457
 63 | 62	0	-0.264
 64 | 63	0.004	0.581
 65 | 64	0.005	0.857
 66 | 65	0.001	0.239
 67 | 66	0	-0.469
 68 | 67	0	-1.842
 69 | 68	0.019	1.187
 70 | 69	0.008	0.286
 71 | 70	0	-0.439
 72 | 71	0	-0.392
 73 | 72	0.006	1.798
 74 | 73	0	-0.448
 75 | 74	0	-0.329
 76 | 75	0	-0.455
 77 | 76	0	0.027
 78 | 77	0	-2.761
 79 | 78	0	-1.319
 80 | 79	0	-0.452
 81 | 80	0	-0.555
 82 | 81	0	-1.617
 83 | 82	0	-0.357
 84 | 83	0	-0.009
 85 | 84	0	-3.352
 86 | 85	0	-0.804
 87 | 86	0	-1.119
 88 | 87	0.001	-0.548
 89 | 88	0.011	2.212
 90 | 89	0.007	0.43
 91 | 90	0	-1.988
 92 | 91	0	0.4
 93 | 92	0	-0.311
 94 | 93	0	-0.431
 95 | 94	0.012	0.916
 96 | 95	0.012	1.022
 97 | 96	0	-1.408
 98 | 97	0	-1.07
 99 | 98	0	0.122
100 | 99	0	-1.032
101 | 100	0	-0.094
102 | 101	0	0.161
103 | 102	0	-3.281
104 | 103	0	-0.465
105 | 104	0	-0.242
106 | 105	0	0.421
107 | 106	0	-1.009
108 | 107	0	-0.474
109 | 108	0	-1.896
110 | 109	0.001	0.218
111 | 110	0.001	0.187
112 | 111	0.002	-0.224
113 | 112	0	-0.258
114 | 113	0	-0.001
115 | 114	0	-0.779
116 | 115	0	-0.994
117 | 116	0	-0.901
118 | 117	0	0.515
119 | 118	0	0.056
120 | 119	0	-0.466
121 | 120	0	-0.266
122 | 121	0	0.251
123 | 122	0	-0.516
124 | 123	0	-2.153
125 | 124	0.001	0.45
126 | 125	0	-0.869
127 | 126	0	0.006
128 | 127	0.002	1.22
129 | 128	0.001	-0.112
130 | 129	0.001	0.469
131 | 130	0	-0.153
132 | 131	0	-0.186
133 | 132	0	-0.202
134 | 133	0	-0.052
135 | 134	0	-0.223
136 | 135	0.008	1.759
137 | 136	0.003	0.225
138 | 137	0	-0.336
139 | 138	0	-0.811
140 | 139	0	-3.179
141 | 140	0	-1.523
142 | 141	0.006	1.497
143 | 142	0	-1.195
144 | 143	0	-1.039
145 | 144	0	-0.309
146 | 145	0	-0.459
147 | 146	0	-0.032
148 | 147	0.001	0.62
149 | 148	0	-0.327
150 | 149	0	-0.354
151 | 150	0.001	1.102
152 | 151	0	-0.078
153 | 152	0	-1.746
154 | 153	0	0.277
155 | 154	0	-0.279
156 | 155	0	-0.567
157 | 156	0.005	0.093
158 | 157	0.03	1.403
159 | 158	0.03	-0.104
160 | 159	0.076	0.639
161 | 160	0.094	0.56
162 | 161	0.108	2.418
163 | 162	0.09	0.866
164 | 163	0.006	-0.186
165 | 164	0	-1.303
166 | 165	0.001	0.695
167 | 166	0	-0.656
168 | 167	0	-0.361
169 | 168	0	-1.204
170 | 169	0	-2.943
171 | 170	0	-2.337
172 | 171	0	-2.127
173 | 172	0	-0.457
174 | 173	0	-0.126
175 | 174	0	0.462
176 | 175	0	0.283
177 | 176	0	-1.369
178 | 177	0.002	0.662
179 | 178	0	-3.353
180 | 179	0	-2.931
181 | 180	0	-0.374
182 | 181	0	-0.515
183 | 182	0	-1.876
184 | 183	0	-0.117
185 | 184	0	-0.188
186 | 185	0	-0.289
187 | 186	0	0.04
188 | 187	0	-1.621
189 | 188	0	-0.554
190 | 189	0	-2.337
191 | 190	0.001	0.531
192 | 191	0	-0.057
193 | 192	0	-0.3
194 | 193	0	0.196
195 | 194	0	0.408
196 | 195	0	-1.372
197 | 196	0	0.169
198 | 197	0	-0.001
199 | 198	0	-1.395
200 | 199	0	-1.335
201 | 200	0	0.151
202 | 201	0	0.011
203 | 202	0	-0.844
204 | 203	0	-0.568
205 | 204	0	0.212
206 | 205	0	-0.55
207 | 206	0	-0.132
208 | 207	0	-1.414
209 | 208	0	-4.093
210 | 209	0	-1.022
211 | 210	0	0.249
212 | 211	0	-1.744
213 | 212	0	-0.221
214 | 213	0	0.061
215 | 214	0	0.008
216 | 215	0	-1.047
217 | 216	0	0.03
218 | 217	0	-0.606
219 | 218	0	-0.43
220 | 219	0.001	0.663
221 | 220	0	-0.532
222 | 221	0	-2.558
223 | 222	0	-1.882
224 | 223	0	-0.689
225 | 224	0.003	0.067
226 | 225	0	-0.478
227 | 226	0	0.18
228 | 227	0	-3.046
229 | 228	0	-0.453
230 | 229	0	0.031
231 | 230	0	-0.091
232 | 231	0	0.05
233 | 232	0	-1.401
234 | 233	0	-1.191
235 | 234	0	-0.122
236 | 235	0	-0.535
237 | 236	0.003	0.255
238 | 237	0.008	1.281
239 | 238	0.001	-0.263
240 | 239	0.002	0.733
241 | 240	0.001	0.357
242 | 241	0	-1.322
243 | 242	0	-1.706
244 | 243	0	-0.033
245 | 244	0	-2.53
246 | 245	0	-0.304
247 | 246	0	-1.069
248 | 247	0.001	0.165
249 | 248	0	0.249
250 | 249	0	-0.486
251 | 250	0	-0.494
252 | 251	0	-1.212
253 | 252	0	0.236
254 | 253	0	-2.176
255 | 254	0	-0.428
256 | 255	0	-0.124
257 | 256	0	-3.4
258 | 257	0	0.491
259 | 258	0	-0.046
260 | 259	0	-0.089
261 | 260	0	-1.52
262 | 261	0	0.079
263 | 262	0	-0.868
264 | 263	0	-0.55
265 | 264	0.001	-0.045
266 | 265	0.019	0.95
267 | 266	0.035	1.734
268 | 267	0.011	0.198
269 | 268	0	-1.089
270 | 269	0	-0.276
271 | 270	0	-0.983
272 | 271	0	-0.2
273 | 272	0	0.319
274 | 273	0	-0.865
275 | 274	0	-1.316
276 | 275	0	-1.617
277 | 276	0	-0.985
278 | 277	0	-0.897
279 | 278	0	-1.451
280 | 279	0	-0.115
281 | 280	0	0.031
282 | 281	0	0.303
283 | 282	0	-1.636
284 | 283	0	-0.058
285 | 284	0	-0.167
286 | 285	0	-1.31
287 | 286	0	0.044
288 | 287	0	-2.007
289 | 288	0	-1.181
290 | 289	0	-0.035
291 | 290	0	-1.026
292 | 291	0	-0.519
293 | 292	0	-0.855
294 | 293	0	0.513
295 | 294	0	-0.13
296 | 295	0	0.123
297 | 296	0	0.023
298 | 297	0	0.526
299 | 298	0	-1.656
300 | 299	0	-0.198
301 | 300	0	-2.877
302 | 301	0	-0.841
303 | 302	0	-0.513
304 | 303	0	-0.49
305 | 304	0	-0.093
306 | 305	0	-2.105
307 | 306	0	-0.046
308 | 307	0	-1.562
309 | 308	0	-0.503
310 | 309	0.001	0.652
311 | 310	0.001	0.263
312 | 311	0	-1.102
313 | 312	0	-1.721
314 | 313	0	-0.923
315 | 314	0	-1.887
316 | 315	0	-0.497
317 | 316	0	-0.35
318 | 317	0	-0.174
319 | 318	0	-0.478
320 | 319	0	0.443
321 | 320	0	-1.876
322 | 321	0	-0.15
323 | 322	0	-0.346
324 | 323	0	-5.685
325 | 324	0	-1.431
326 | 325	0.003	0.606
327 | 326	0	-1.784
328 | 327	0	0.142
329 | 328	0	0.489
330 | 329	0	0.205
331 | 330	0	-2.665
332 | 331	0	-0.86
333 | 332	0	-0.27
334 | 333	0.003	-0.067
335 | 334	0.035	1.6
336 | 335	0.036	1.121
337 | 336	0.018	0.411
338 | 337	0.001	-0.002
339 | 338	0	-0.266
340 | 339	0	-0.768
341 | 340	0.001	0.251
342 | 341	0.004	0.264
343 | 342	0.004	0.928
344 | 343	0	-0.178
345 | 344	0	0.209
346 | 345	0	0.047
347 | 346	0	-0.048
348 | 347	0.001	0.003
349 | 348	0.009	1.13
350 | 349	0.008	0.574
351 | 350	0.005	0.485
352 | 351	0	-2.3
353 | 352	0	0.265
354 | 353	0	0.141
355 | 354	0	0.305
356 | 355	0	0.433
357 | 356	0	0.186
358 | 357	0	0.108
359 | 358	0	-0.016
360 | 359	0	-0.586
361 | 360	0	0.254
362 | 361	0	0.123
363 | >random_negative_0000007
364 | 1	1	4.741
365 | 2	1	7.738
366 | 3	0.672	-0.155
367 | 4	0.994	2.553
368 | 5	1	7.738
369 | 6	0.998	0.362
370 | 7	1	7.653
371 | 8	1	7.63
372 | 9	0.372	-0.27
373 | 10	1	7.738
374 | 11	1	8.994
375 | 12	1	1.542
376 | 13	1	7.738
377 | 14	1	7.738
378 | 15	1	3.911
379 | 16	1	1.897
380 | 17	1	7.738
381 | 18	0.869	-0.121
382 | 19	1	9.645
383 | 20	1	8.994
384 | 21	0.978	0.166
385 | 22	1	8.994
386 | 23	1	8.994
387 | 24	1	1.597
388 | 25	1	5.64
389 | 26	1	6.319
390 | 27	0.546	-0.265
391 | 28	1	7.644
392 | 29	1	7.63
393 | 30	1	3.311
394 | 31	1	9.645
395 | 32	1	9.645
396 | 33	1	7.738
397 | 34	0.891	1.592
398 | 35	0.05	-0.114
399 | 36	0.002	-0.845
400 | 37	0	-1.852
401 | 38	0	-1.831
402 | 39	0	-1.715
403 | 40	0	-0.322
404 | 41	0	-1.255
405 | 42	0	0.066
406 | 43	0	-0.711
407 | 44	0	-1.37
408 | 45	0	-0.74
409 | 46	0	-0.455
410 | 47	0	-1.282
411 | 48	0	-1.263
412 | 49	0	-4.136
413 | 50	0	-1.183
414 | 51	0	0.347
415 | 52	0	-1.057
416 | 53	0	-1.012
417 | 54	0	-0.639
418 | 55	0	-1.568
419 | 56	0	-0.703
420 | 57	0	0.149
421 | 58	0.002	0.974
422 | 59	0	-1.155
423 | 60	0	-0.344
424 | 61	0	-0.229
425 | 62	0.005	0.483
426 | 63	0	-0.591
427 | 64	0	-0.308
428 | 65	0	0.505
429 | 66	0	-0.475
430 | 67	0.002	0.151
431 | 68	0.003	0.561
432 | 69	0.002	0.495
433 | 70	0	-0.996
434 | 71	0	-0.284
435 | 72	0.001	0.872
436 | 73	0	-0.282
437 | 74	0	-0.186
438 | 75	0	-0.555
439 | 76	0	-2.747
440 | 77	0	-0.387
441 | 78	0.004	0.871
442 | 79	0.004	0.819
443 | 80	0	-0.164
444 | 81	0	-0.529
445 | 82	0	-0.403
446 | 83	0	-0.219
447 | 84	0	-3.12
448 | 85	0.352	3.282
449 | 86	0.002	0.026
450 | 87	0	-0.156
451 | 88	0	-0.806
452 | 89	0	-0.975
453 | 90	0	-0.992
454 | 91	0	-1.232
455 | 92	0	-0.006
456 | 93	0	-1.514
457 | 94	0	-1.513
458 | 95	0	-1.038
459 | 96	0	-0.267
460 | 97	0	-0.958
461 | 98	0	0.015
462 | 99	0	-3.53
463 | 100	0	-1.703
464 | 101	0	-1.314
465 | 102	0	-1.585
466 | 103	0	-0.681
467 | 104	0	-0.258
468 | 105	0	-0.797
469 | 106	0	0.367
470 | 107	0	-3.151
471 | 108	0	-1.113
472 | 109	0	-1.852
473 | 110	0	-2.164
474 | 111	0	-0.326
475 | 112	0	-0.897
476 | 113	0	-0.77
477 | 114	0	-0.191
478 | 115	0	0.388
479 | 116	0	-0.285
480 | 117	0	-0.775
481 | 118	0.002	0.227
482 | 119	0.003	0.177
483 | 120	0.004	-1.251
484 | 121	0.027	0.177
485 | 122	0.056	1.121
486 | 123	0.242	-0.517
487 | 124	0.398	0.308
488 | 125	0.529	1.873
489 | 126	0.538	0.407
490 | 127	0.54	0.03
491 | 128	0.554	-0.029
492 | 129	0.004	0.002
493 | 130	0	-1.86
494 | 131	0	-2.005
495 | 132	0	-0.499
496 | 133	0	-0.748
497 | 134	0	-1.444
498 | 135	0	-0.559
499 | 136	0	-0.089
500 | 137	0.002	1.061
501 | 138	0	-0.193
502 | 139	0	-2.042
503 | 140	0	-0.538
504 | 141	0	-0.487
505 | 142	0	-2.767
506 | 143	0	-0.52
507 | 144	0	-2.57
508 | 145	0	-0.329
509 | 146	0	-3.038
510 | 147	0.002	0.722
511 | 148	0	-1.576
512 | 149	0	-1.81
513 | 150	0	-0.05
514 | 151	0.019	0.787
515 | 152	0.009	0.401
516 | 153	0.001	-0.093
517 | 154	0	-1.052
518 | 155	0	-0.638
519 | 156	0	-1.114
520 | 157	0.001	0.328
521 | 158	0.002	0.85
522 | 159	0	0.015
523 | 160	0	-0.214
524 | 161	0	-3.294
525 | 162	0	-0.561
526 | 163	0	-0.353
527 | 164	0.001	0.087
528 | 165	0.005	1.249
529 | 166	0	-1.536
530 | 167	0	-0.691
531 | 168	0	-0.571
532 | 169	0	-0.506
533 | 170	0	-0.615
534 | 171	0	-0.46
535 | 172	0	0.389
536 | 173	0	-0.051
537 | 174	0	0.178
538 | 175	0	-0.537
539 | 176	0	-0.072
540 | 177	0	-2.113
541 | 178	0.03	1.518
542 | 179	0.033	0.329
543 | 180	0.035	0.155
544 | 181	0.038	0.285
545 | 182	0.038	0.558
546 | 183	0.035	0.211
547 | 184	0.001	-0.242
548 | 185	0	-0.287
549 | 186	0	-0.936
550 | 187	0	-0.44
551 | 188	0	-0.193
552 | 189	0	-0.935
553 | 190	0	-0.367
554 | 191	0	-0.877
555 | 192	0	-0.406
556 | 193	0	0.362
557 | 194	0	0.165
558 | 195	0	-0.007
559 | 196	0	-0.96
560 | 197	0	-0.082
561 | 198	0	-1.369
562 | 199	0	0.237
563 | 200	0	-0.72
564 | 201	0	-1.339
565 | 202	0	0.53
566 | 203	0	-3.478
567 | 204	0	-0.589
568 | 205	0	-0.199
569 | 206	0	-1.846
570 | 207	0	-1.508
571 | 208	0	0.248
572 | 209	0	-0.443
573 | 210	0	-1.648
574 | 211	0.003	-0.418
575 | 212	0.013	1.182
576 | 213	0	-0.451
577 | 214	0	-1.688
578 | 215	0	-0.982
579 | 216	0	-0.826
580 | 217	0	-0.088
581 | 218	0.003	1.034
582 | 219	0.001	0.007
583 | 220	0	-2.304
584 | 221	0	-2.823
585 | 222	0.003	0.179
586 | 223	0.006	1.257
587 | 224	0	-0.057
588 | 225	0	0.375
589 | 226	0	-0.567
590 | 227	0	-2.227
591 | 228	0	-3.638
592 | 229	0	-0.579
593 | 230	0	-1.112
594 | 231	0	-1.558
595 | 232	0	-1.19
596 | 233	0	0.035
597 | 234	0.001	0.501
598 | 235	0	0.369
599 | 236	0	0.17
600 | 237	0	0.135
601 | 238	0	-0.373
602 | 239	0.001	1.177
603 | 240	0	-1.032
604 | 241	0	-0.866
605 | 242	0	-1.502
606 | 243	0	-2.802
607 | 244	0.001	0.666
608 | 245	0.001	0.524
609 | 246	0	-1.144
610 | 247	0	-0.141
611 | 248	0	0.271
612 | 249	0	-0.127
613 | 250	0	-2.917
614 | 251	0	-0.396
615 | 252	0	-0.001
616 | 253	0	0.267
617 | 254	0	0.134
618 | 255	0	-0.446
619 | 256	0	-0.811
620 | 257	0	-0.6
621 | 258	0	0.118
622 | 259	0	-1.767
623 | 260	0	-0.658
624 | 261	0	-5.149
625 | 262	0	-0.753
626 | 263	0	-1.086
627 | 264	0	-0.631
628 | 265	0	-0.558
629 | 266	0.005	1.869
630 | 267	0	-2.425
631 | 268	0	-2.308
632 | 269	0	-2.158
633 | 270	0	-2.543
634 | 271	0	-0.054
635 | 272	0	-0.919
636 | 273	0	-0.446
637 | 274	0	0.498
638 | 275	0	0.187
639 | 276	0	0.597
640 | 277	0	-0.749
641 | 278	0	-0.229
642 | 279	0	-0.757
643 | 280	0	-0.103
644 | 281	0	-2.708
645 | 282	0	-2.213
646 | 283	0	-0.65
647 | 284	0	-1.115
648 | 285	0	0.756
649 | 286	0	-0.578
650 | 287	0.001	-0.136
651 | 288	0	-1.681
652 | 289	0	-0.433
653 | 290	0	-0.055
654 | 291	0	-0.152
655 | 292	0	-1.37
656 | 293	0	-0.812
657 | 294	0	-2.211
658 | 295	0.001	0.479
659 | 296	0	-0.928
660 | 297	0	-0.191
661 | 298	0	-0.462
662 | 299	0	-0.974
663 | 300	0	-0.314
664 | 301	0	-0.644
665 | 302	0	0.001
666 | 303	0.001	0.594
667 | 304	0	-0.1
668 | 305	0	-0.217
669 | 306	0.006	1.11
670 | 307	0.005	0.989
671 | 308	0	-0.697
672 | 309	0	-1.983
673 | 310	0	-0.749
674 | 311	0.994	3.804
675 | 312	0.99	2.3
676 | 313	0.704	0.479
677 | 314	0.312	0.309
678 | 315	0.033	-0.023
679 | 316	0.013	-0.47
680 | 317	0.024	0.197
681 | 318	0.012	-0.175
682 | 319	0.008	0.089
683 | 320	0	-3.365
684 | 321	0	-0.34
685 | 322	0	-0.961
686 | 323	0	-0.961
687 | 324	0	-0.167
688 | 325	0.001	0.655
689 | 326	0	-1.865
690 | 327	0	-1.417
691 | 328	0	-3.232
692 | 329	0	0.174
693 | 330	0	-0.194
694 | 331	0	-0.61
695 | 332	0	-0.134
696 | 333	0	-0.634
697 | 334	0	-0.931
698 | 335	0.001	0.395
699 | 336	0	-0.372
700 | 337	0	-1.13
701 | 338	0	-0.567
702 | 339	0	-0.102
703 | 340	0	-0.685
704 | 341	0	-0.123
705 | 342	0	-0.307
706 | 343	0	0.403
707 | 344	0	-0.315
708 | 345	0	0.15
709 | 346	0	-0.161
710 | 347	0	0.383
711 | 348	0	-0.134
712 | 349	0	-0.983
713 | 350	0	-1.686
714 | 351	0	0.503
715 | 352	0	-0.299
716 | 353	0	-0.148
717 | 354	0	-0.011
718 | 355	0	-1.134
719 | 356	0	-0.332
720 | 357	0	-0.686
721 | 358	0	0.4
722 | 359	0	-0.058
723 | 360	0	-0.004
724 | 361	0	0.369
725 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/negatives.entr:
--------------------------------------------------------------------------------
1 | id	avg_rbpc	avg_cov	entr
2 | random_negative_0000006	0.0134529147982063	5.75115718116062	2.48005746419808
3 | random_negative_0000007	0.00448430493273543	5.31656373048278	0.984863381237782
4 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/negatives.fa:
--------------------------------------------------------------------------------
1 | >random_negative_0000006
2 | agtggttgatgagaaaaagagcccaggcattcagaaatgctgagtttccctaaaatccacctggtttctggggcctgtgccactgtgggtgttggtagacctgtgttgttgcctaggagagcgagccctgcaaaggagccggcacagcccTAGTTGGAGAAGCAGTTAACCACGGACTGGTCACACTGGGGCTGCCTCAGGCAGTGGGGGGtggaggagaaaccacacaaggccagaggcatctctgggaactcctgagcataccttagaaccagcagcctcctcccggcacggggagcattgcggatcctcacgtggagctcggttgagttcagcgccaggctgtctggcggtgactcgg
3 | >random_negative_0000007
4 | ctgcttgcctacttcctggataagagtgcaggtacctcgggcaggtcgtggccccgggatggagggaggaggggactggcactcggcggggggtcagccgcagacctgccgtggcctgccctgtgttggctgctgtgccatggggtgttaGGAGAAGGGCACAGGTGTCGGCTCCCGGCTGCTTCAGGTCCTCTCTGTCCAGCGCTTCCTTgaagcccttgggaaatgctgtggagcccaggttgatgccggggacttcattgcttcataaacagctccctgagacccgcccctggctccacacatcccagggtcttggcttggggtgggggctgcacttctcttcagtgccctctaagga
5 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/negatives.sf:
--------------------------------------------------------------------------------
1 | id	a	c	g	t	at	ags	cts	gcs	gts	ks	ps	cpg	ce	cz	lct1	lct2	lct3
2 | random_negative_0000006	0.213114754098361	0.213114754098361	0.39344262295082	0.180327868852459	0.39344262295082	-0.297297297297297	0.0833333333333333	-0.297297297297297	0.371428571428571	0.147540983606557	0.213114754098361	0.0327868852459016	0.962874566371718	0.491935483870968	1	0.9375	0.587923728813559
3 | random_negative_0000007	0.114754098360656	0.327868852459016	0.311475409836066	0.245901639344262	0.360655737704918	-0.461538461538462	0.142857142857143	0.0256410256410256	0.117647058823529	0.114754098360656	-0.147540983606557	0.0983606557377049	0.953860242210079	0.495934959349593	1	0.875	0.504237288135593
4 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/negatives.up:
--------------------------------------------------------------------------------
  1 | >random_negative_0000006
  2 | 1	0.8045005
  3 | 2	0.7965494
  4 | 3	0.5237976
  5 | 4	0.4356786
  6 | 5	0.326144
  7 | 6	0.4210623
  8 | 7	0.5164613
  9 | 8	0.5783532
 10 | 9	0.6605661
 11 | 10	0.6806464
 12 | 11	0.6969015
 13 | 12	0.9307567
 14 | 13	0.9218976
 15 | 14	0.9264632
 16 | 15	0.951554
 17 | 16	0.9602861
 18 | 17	0.7525081
 19 | 18	0.241737
 20 | 19	0.1830237
 21 | 20	0.1550704
 22 | 21	0.1794611
 23 | 22	0.05766676
 24 | 23	0.05539158
 25 | 24	0.06018393
 26 | 25	0.008949741
 27 | 26	0.00212008
 28 | 27	0.004245089
 29 | 28	0.006527958
 30 | 29	0.04591808
 31 | 30	0.01357164
 32 | 31	0.01548421
 33 | 32	0.05866676
 34 | 33	0.1560326
 35 | 34	0.1534002
 36 | 35	0.05105736
 37 | 36	0.7590621
 38 | 37	0.7611632
 39 | 38	0.7584375
 40 | 39	0.1039711
 41 | 40	0.1971915
 42 | 41	0.2049485
 43 | 42	0.2251599
 44 | 43	0.1659119
 45 | 44	0.195826
 46 | 45	0.2533546
 47 | 46	0.3125552
 48 | 47	0.6069677
 49 | 48	0.5219663
 50 | 49	0.6058368
 51 | 50	0.6686608
 52 | 51	0.6753846
 53 | 52	0.6436672
 54 | 53	0.64785
 55 | 54	0.6053708
 56 | 55	0.6048192
 57 | 56	0.5653313
 58 | 57	0.5143609
 59 | 58	0.5196907
 60 | 59	0.320317
 61 | 60	0.4075165
 62 | 61	0.4017324
 63 | 62	0.07910998
 64 | 63	0.1196113
 65 | 64	0.1641057
 66 | 65	0.1786152
 67 | 66	0.3513861
 68 | 67	0.05682528
 69 | 68	0.03633049
 70 | 69	0.02093711
 71 | 70	0.0276642
 72 | 71	0.03951051
 73 | 72	0.0006084589
 74 | 73	0.002253847
 75 | 74	0.003829605
 76 | 75	0.006780767
 77 | 76	0.06480873
 78 | 77	0.07240157
 79 | 78	0.03186711
 80 | 79	0.05070159
 81 | 80	0.05704437
 82 | 81	0.06135101
 83 | 82	0.0822921
 84 | 83	0.1266565
 85 | 84	0.07914751
 86 | 85	0.07038777
 87 | 86	0.0113458
 88 | 87	0.004188675
 89 | 88	0.004502307
 90 | 89	0.003227862
 91 | 90	0.002112233
 92 | 91	0.002426754
 93 | 92	0.05292769
 94 | 93	0.05696556
 95 | 94	0.1071998
 96 | 95	0.1150047
 97 | 96	0.08449807
 98 | 97	0.1227557
 99 | 98	0.8330273
100 | 99	0.02618613
101 | 100	0.02700783
102 | 101	0.02115877
103 | 102	0.02998677
104 | 103	0.05449174
105 | 104	0.08688428
106 | 105	0.1117611
107 | 106	0.1213275
108 | 107	0.2073719
109 | 108	0.8197392
110 | 109	0.7291323
111 | 110	0.03958015
112 | 111	0.01272241
113 | 112	0.01757719
114 | 113	0.01750331
115 | 114	0.04780123
116 | 115	0.06787285
117 | 116	0.0954858
118 | 117	0.07556337
119 | 118	0.07701575
120 | 119	0.8953619
121 | 120	0.04133392
122 | 121	0.01187627
123 | 122	0.01134411
124 | 123	0.01315351
125 | 124	0.0134942
126 | 125	0.00960766
127 | 126	0.02103262
128 | 127	0.0150951
129 | 128	0.02651223
130 | 129	0.002739031
131 | 130	0.01701143
132 | 131	0.3930088
133 | 132	0.3985805
134 | 133	0.1835688
135 | 134	0.3711216
136 | 135	0.3516948
137 | 136	0.2693318
138 | 137	0.147302
139 | 138	0.181068
140 | 139	0.1608913
141 | 140	0.01248105
142 | 141	0.01741742
143 | 142	0.05212106
144 | 143	0.07973796
145 | 144	0.00816568
146 | 145	0.0330964
147 | 146	0.004328893
148 | 147	0.003388542
149 | 148	0.0005716955
150 | 149	0.0004020285
151 | 150	0.0005914331
152 | 151	0.001458218
153 | 152	0.006349486
154 | 153	0.03058726
155 | 154	0.04331328
156 | 155	0.1705344
157 | 156	0.192559
158 | 157	0.1772049
159 | 158	0.2533946
160 | 159	0.2972715
161 | 160	0.2008057
162 | 161	0.2283781
163 | 162	0.06043827
164 | 163	0.07239127
165 | 164	0.06736494
166 | 165	0.05895939
167 | 166	0.06297494
168 | 167	0.07680842
169 | 168	0.09186378
170 | 169	0.890476
171 | 170	0.8837314
172 | 171	0.8786695
173 | 172	0.8908285
174 | 173	0.8968776
175 | 174	0.1509466
176 | 175	0.1261007
177 | 176	0.1021313
178 | 177	0.03506413
179 | 178	0.01598596
180 | 179	0.01645549
181 | 180	0.01759298
182 | 181	0.09371377
183 | 182	0.1149163
184 | 183	0.158531
185 | 184	0.1580046
186 | 185	0.063128
187 | 186	0.06642784
188 | 187	0.005041325
189 | 188	0.002599941
190 | 189	0.04977397
191 | 190	0.001069134
192 | 191	0.001063352
193 | 192	0.001022511
194 | 193	0.004081941
195 | 194	0.003096826
196 | 195	0.001687589
197 | 196	0.06194885
198 | 197	0.1137941
199 | 198	0.292319
200 | 199	0.03479639
201 | 200	0.04092427
202 | 201	0.1534192
203 | 202	0.1630089
204 | 203	0.27111
205 | 204	0.1324639
206 | 205	0.0942085
207 | 206	0.1004501
208 | 207	0.2236932
209 | 208	0.2864985
210 | 209	0.1707997
211 | 210	0.03887879
212 | 211	0.07384451
213 | 212	0.08143408
214 | 213	0.08271797
215 | 214	0.2704568
216 | 215	0.2780137
217 | 216	0.5629498
218 | 217	0.5561523
219 | 218	0.5879131
220 | 219	0.708748
221 | 220	0.7263083
222 | 221	0.8097305
223 | 222	0.05389168
224 | 223	0.04173523
225 | 224	0.04133542
226 | 225	0.03753037
227 | 226	0.4606856
228 | 227	0.3764401
229 | 228	0.5524829
230 | 229	0.5507681
231 | 230	0.4657325
232 | 231	0.3675306
233 | 232	0.005838435
234 | 233	0.002308272
235 | 234	0.002661299
236 | 235	0.001654011
237 | 236	0.0212544
238 | 237	0.0004339124
239 | 238	0.0006365723
240 | 239	0.007104493
241 | 240	0.7279955
242 | 241	0.7413813
243 | 242	0.06968443
244 | 243	0.0765839
245 | 244	0.04727249
246 | 245	0.0225098
247 | 246	0.01306432
248 | 247	0.01324242
249 | 248	0.002678439
250 | 249	0.006896697
251 | 250	0.6474939
252 | 251	0.301368
253 | 252	0.2726656
254 | 253	0.2287666
255 | 254	0.01020379
256 | 255	0.004894878
257 | 256	0.003270761
258 | 257	0.03209667
259 | 258	0.2195228
260 | 259	0.04478639
261 | 260	0.04553042
262 | 261	0.3801218
263 | 262	0.528581
264 | 263	0.4110496
265 | 264	0.1595274
266 | 265	0.1491807
267 | 266	0.3114287
268 | 267	0.297762
269 | 268	0.1750348
270 | 269	0.2089766
271 | 270	0.407166
272 | 271	0.2316675
273 | 272	0.21027
274 | 273	0.2082136
275 | 274	0.1479687
276 | 275	0.1317916
277 | 276	0.1340037
278 | 277	0.1319477
279 | 278	0.07319466
280 | 279	0.07798805
281 | 280	0.2345714
282 | 281	0.2515698
283 | 282	0.04159971
284 | 283	0.06365128
285 | 284	0.005522925
286 | 285	0.01351702
287 | 286	0.009501284
288 | 287	0.09962714
289 | 288	0.1819932
290 | 289	0.7733538
291 | 290	0.9415662
292 | 291	0.788303
293 | 292	0.6005098
294 | 293	0.01066886
295 | 294	0.009202485
296 | 295	0.001441901
297 | 296	0.000343805
298 | 297	0.003030425
299 | 298	0.00845628
300 | 299	0.02735181
301 | 300	0.3474116
302 | 301	0.2539845
303 | 302	0.1490804
304 | 303	0.1255131
305 | 304	0.1002597
306 | 305	0.07469623
307 | 306	0.1219815
308 | 307	0.2635297
309 | 308	0.3638694
310 | 309	0.3372252
311 | 310	0.2834837
312 | 311	0.5336662
313 | 312	0.6502065
314 | 313	0.5349202
315 | 314	0.2218864
316 | 315	0.2165984
317 | 316	0.02294002
318 | 317	0.01188527
319 | 318	0.0248123
320 | 319	0.004982607
321 | 320	0.00392065
322 | 321	0.004796817
323 | 322	0.001703939
324 | 323	0.00148708
325 | 324	0.00193589
326 | 325	0.1891293
327 | 326	0.1950051
328 | 327	0.04831658
329 | 328	0.02885702
330 | 329	0.01297451
331 | 330	0.09224716
332 | 331	0.09035788
333 | 332	0.006632563
334 | 333	0.008050099
335 | 334	0.009562738
336 | 335	0.3175288
337 | 336	0.2772236
338 | 337	0.104032
339 | 338	0.2024917
340 | 339	0.1011668
341 | 340	0.05248498
342 | 341	0.001428227
343 | 342	0.002763183
344 | 343	0.3268537
345 | 344	0.5935454
346 | 345	0.3599645
347 | 346	0.002662405
348 | 347	0.005635061
349 | 348	0.02027441
350 | 349	4.65708e-05
351 | 350	4.796388e-05
352 | 351	0.000277683
353 | 352	0.01984732
354 | 353	0.01604657
355 | 354	0.1142193
356 | 355	0.09697888
357 | 356	0.2091211
358 | 357	0.2137206
359 | 358	0.08153932
360 | 359	0.03777337
361 | 360	0.006631213
362 | 361	0.006631213
363 | >random_negative_0000007
364 | 1	0.4173879
365 | 2	0.04984191
366 | 3	0.01067232
367 | 4	0.01211746
368 | 5	0.03368978
369 | 6	0.1041132
370 | 7	0.1560105
371 | 8	0.2418138
372 | 9	0.3253289
373 | 10	0.4095799
374 | 11	0.4830219
375 | 12	0.6400796
376 | 13	0.6337771
377 | 14	0.04670987
378 | 15	0.04092687
379 | 16	0.1439117
380 | 17	0.2054315
381 | 18	0.2375857
382 | 19	0.342103
383 | 20	0.3978016
384 | 21	0.3730041
385 | 22	0.3952238
386 | 23	0.8376572
387 | 24	0.7895843
388 | 25	0.3316347
389 | 26	0.3172471
390 | 27	0.04136804
391 | 28	0.04081242
392 | 29	0.03880806
393 | 30	0.07288706
394 | 31	0.09182257
395 | 32	0.1133961
396 | 33	0.1461702
397 | 34	0.3758243
398 | 35	0.4845423
399 | 36	0.5206386
400 | 37	0.5313158
401 | 38	0.167869
402 | 39	0.004020537
403 | 40	0.002336783
404 | 41	0.001516157
405 | 42	0.001028192
406 | 43	0.001783906
407 | 44	0.01755732
408 | 45	0.0228072
409 | 46	0.03748758
410 | 47	0.05846068
411 | 48	0.08763962
412 | 49	0.1292914
413 | 50	0.04334172
414 | 51	0.01486012
415 | 52	0.001119701
416 | 53	0.0008524264
417 | 54	0.0006478087
418 | 55	0.001590612
419 | 56	0.004823614
420 | 57	0.7628976
421 | 58	0.7733184
422 | 59	0.6889866
423 | 60	0.6959632
424 | 61	0.656249
425 | 62	0.724683
426 | 63	0.2811956
427 | 64	0.2882803
428 | 65	0.2882961
429 | 66	0.3048636
430 | 67	0.3282829
431 | 68	0.4247961
432 | 69	0.4335486
433 | 70	0.2347243
434 | 71	0.09876458
435 | 72	0.0810653
436 | 73	0.1244217
437 | 74	0.1367579
438 | 75	0.05977902
439 | 76	0.04947451
440 | 77	0.009671654
441 | 78	0.009187212
442 | 79	0.03396771
443 | 80	0.0343344
444 | 81	0.01077103
445 | 82	0.03470364
446 | 83	0.01671631
447 | 84	0.02625582
448 | 85	0.003432831
449 | 86	0.4788869
450 | 87	0.4705938
451 | 88	0.2246046
452 | 89	0.02114104
453 | 90	0.006498656
454 | 91	0.008423613
455 | 92	0.02586742
456 | 93	0.03816264
457 | 94	0.07813084
458 | 95	0.09751052
459 | 96	0.08673645
460 | 97	0.1605891
461 | 98	0.1616348
462 | 99	0.1403937
463 | 100	0.1363819
464 | 101	0.1778392
465 | 102	0.05393567
466 | 103	0.3954354
467 | 104	0.1226154
468 | 105	0.2585693
469 | 106	0.2539118
470 | 107	0.219784
471 | 108	0.1460115
472 | 109	0.1038539
473 | 110	0.02644938
474 | 111	0.03876257
475 | 112	0.0655567
476 | 113	0.0367332
477 | 114	0.01296491
478 | 115	0.01305378
479 | 116	0.02643698
480 | 117	0.005766629
481 | 118	0.004655757
482 | 119	0.0009946836
483 | 120	0.001640854
484 | 121	0.01982032
485 | 122	0.02235984
486 | 123	0.1135367
487 | 124	0.1495853
488 | 125	0.209996
489 | 126	0.1184197
490 | 127	0.06871167
491 | 128	0.1030576
492 | 129	0.01129897
493 | 130	0.01618632
494 | 131	0.0214871
495 | 132	0.354414
496 | 133	0.3566591
497 | 134	0.3409645
498 | 135	0.3536073
499 | 136	0.04880659
500 | 137	0.01846311
501 | 138	0.01993212
502 | 139	0.01978669
503 | 140	0.02381044
504 | 141	0.409437
505 | 142	0.3862841
506 | 143	0.1048421
507 | 144	0.09771534
508 | 145	0.06748446
509 | 146	0.07512189
510 | 147	0.1232269
511 | 148	0.3058594
512 | 149	0.3317973
513 | 150	0.1185548
514 | 151	0.09220423
515 | 152	0.07564643
516 | 153	0.09385695
517 | 154	0.1588928
518 | 155	0.1102588
519 | 156	0.2757345
520 | 157	0.06195094
521 | 158	0.007684957
522 | 159	0.002036444
523 | 160	0.00908523
524 | 161	0.01134595
525 | 162	0.1828038
526 | 163	0.06264415
527 | 164	0.05851388
528 | 165	0.04660323
529 | 166	0.00890362
530 | 167	0.0539132
531 | 168	0.03607875
532 | 169	0.02060557
533 | 170	0.01457519
534 | 171	0.01547835
535 | 172	0.03514621
536 | 173	0.6499244
537 | 174	0.07916977
538 | 175	0.09092547
539 | 176	0.06569861
540 | 177	0.0244718
541 | 178	0.02366229
542 | 179	0.0366565
543 | 180	0.03321569
544 | 181	0.1232981
545 | 182	0.1305714
546 | 183	0.1996074
547 | 184	0.09935038
548 | 185	0.2504311
549 | 186	0.4118837
550 | 187	0.03286779
551 | 188	0.05030752
552 | 189	0.1024561
553 | 190	0.3613786
554 | 191	0.3679374
555 | 192	0.2968416
556 | 193	0.2046974
557 | 194	0.1794585
558 | 195	0.1657103
559 | 196	0.1814294
560 | 197	0.1834217
561 | 198	0.3754215
562 | 199	0.2756939
563 | 200	0.1722484
564 | 201	0.05358592
565 | 202	0.06739174
566 | 203	0.01845217
567 | 204	0.04306644
568 | 205	0.04567049
569 | 206	0.1061944
570 | 207	0.07052294
571 | 208	0.02612672
572 | 209	0.04212477
573 | 210	0.5630483
574 | 211	0.1039558
575 | 212	0.2057913
576 | 213	0.2007626
577 | 214	0.2227763
578 | 215	0.2204364
579 | 216	0.2034494
580 | 217	0.1505371
581 | 218	0.2001532
582 | 219	0.1810532
583 | 220	0.0295935
584 | 221	0.01635234
585 | 222	0.009722166
586 | 223	0.01170022
587 | 224	0.08998359
588 | 225	0.2472135
589 | 226	0.4473184
590 | 227	0.118505
591 | 228	0.08500485
592 | 229	0.05204338
593 | 230	0.01640822
594 | 231	0.01179083
595 | 232	0.01168766
596 | 233	0.01710676
597 | 234	0.006928466
598 | 235	0.008011825
599 | 236	0.009419332
600 | 237	0.01066345
601 | 238	0.06314589
602 | 239	0.0325258
603 | 240	0.02668003
604 | 241	0.01882418
605 | 242	0.01609013
606 | 243	0.01934906
607 | 244	0.2778813
608 | 245	0.7875471
609 | 246	0.7787651
610 | 247	0.2381922
611 | 248	0.05718649
612 | 249	0.003737494
613 | 250	0.001570287
614 | 251	0.0003821421
615 | 252	0.0003145447
616 | 253	0.0001853855
617 | 254	0.0008767174
618 | 255	0.06919843
619 | 256	0.05579326
620 | 257	0.2663288
621 | 258	0.2672718
622 | 259	0.3477807
623 | 260	0.3558472
624 | 261	0.3923915
625 | 262	0.1378924
626 | 263	0.1524827
627 | 264	0.1939237
628 | 265	0.2428481
629 | 266	0.4241419
630 | 267	0.8024368
631 | 268	0.8169269
632 | 269	0.9094103
633 | 270	0.9023822
634 | 271	0.8141098
635 | 272	0.6286796
636 | 273	0.1578328
637 | 274	0.1203025
638 | 275	0.09750424
639 | 276	0.0468704
640 | 277	0.09751196
641 | 278	0.2283254
642 | 279	0.2051839
643 | 280	0.1400232
644 | 281	0.05442292
645 | 282	0.1526671
646 | 283	0.1411971
647 | 284	0.2037099
648 | 285	0.123055
649 | 286	0.4424365
650 | 287	0.310446
651 | 288	0.2932906
652 | 289	0.2995934
653 | 290	0.3092895
654 | 291	0.1000001
655 | 292	0.0796641
656 | 293	0.1752671
657 | 294	0.0156846
658 | 295	0.004197521
659 | 296	0.002523927
660 | 297	0.007295207
661 | 298	0.07748193
662 | 299	0.09106142
663 | 300	0.1233584
664 | 301	0.1517805
665 | 302	0.1707966
666 | 303	0.1557512
667 | 304	0.1627757
668 | 305	0.1655172
669 | 306	0.1961876
670 | 307	0.1142969
671 | 308	0.1119482
672 | 309	0.1357501
673 | 310	0.06261084
674 | 311	0.02179204
675 | 312	0.002471347
676 | 313	0.00750325
677 | 314	0.1489486
678 | 315	0.6840299
679 | 316	0.8738751
680 | 317	0.5198179
681 | 318	0.4380113
682 | 319	0.2837388
683 | 320	0.2488342
684 | 321	0.2154421
685 | 322	0.1658171
686 | 323	0.09633061
687 | 324	0.05754844
688 | 325	0.0425779
689 | 326	0.05193632
690 | 327	0.01856617
691 | 328	0.02193152
692 | 329	0.01251739
693 | 330	0.03073182
694 | 331	0.03084144
695 | 332	0.07263584
696 | 333	0.4475989
697 | 334	0.4864844
698 | 335	0.4826007
699 | 336	0.5036459
700 | 337	0.4055419
701 | 338	0.3841531
702 | 339	0.3931467
703 | 340	0.3591366
704 | 341	0.3467658
705 | 342	0.3212869
706 | 343	0.2847191
707 | 344	0.2231225
708 | 345	0.08925117
709 | 346	0.03257923
710 | 347	0.01162068
711 | 348	0.01218422
712 | 349	0.01327667
713 | 350	0.003419736
714 | 351	0.0005278739
715 | 352	0.0006915505
716 | 353	0.005804031
717 | 354	0.6029826
718 | 355	0.5533533
719 | 356	0.4398371
720 | 357	0.3144344
721 | 358	0.1301804
722 | 359	0.1226221
723 | 360	0.126826
724 | 361	0.126826
725 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/new_format.eia:
--------------------------------------------------------------------------------
1 | >site1
2 | EEIIIIII
3 | IIIIIIII
4 | EEEE
5 | >site2
6 | EEEEIIII
7 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/positives.bed:
--------------------------------------------------------------------------------
1 | chr7	151090336	151090697	CLIP_0000001	0	+
2 | chr7	151087128	151087489	CLIP_0000002	0	+
3 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/positives.bpp:
--------------------------------------------------------------------------------
   1 | >CLIP_0000001
   2 | 1	17	0.7877
   3 | 2	16	0.5953
   4 | 2	26	0.6305
   5 | 2	37	0.1997
   6 | 3	15	0.5037
   7 | 3	24	0.3895
   8 | 3	25	0.6893
   9 | 3	36	0.2268
  10 | 3	81	0.1479
  11 | 4	14	0.4374
  12 | 4	23	0.3903
  13 | 4	24	0.5981
  14 | 4	25	0.2536
  15 | 4	28	0.1605
  16 | 4	35	0.1973
  17 | 4	39	0.1290
  18 | 4	80	0.3424
  19 | 5	13	0.3935
  20 | 5	22	0.5795
  21 | 5	23	0.3214
  22 | 5	24	0.2295
  23 | 5	27	0.1504
  24 | 5	34	0.1763
  25 | 5	38	0.1527
  26 | 5	79	0.4508
  27 | 6	12	0.3557
  28 | 6	16	0.1466
  29 | 6	26	0.1404
  30 | 6	37	0.1403
  31 | 6	78	0.4148
  32 | 7	11	0.2742
  33 | 7	15	0.1631
  34 | 7	20	0.6721
  35 | 7	22	0.1355
  36 | 7	25	0.1233
  37 | 7	31	0.1013
  38 | 7	36	0.1292
  39 | 7	77	0.3858
  40 | 8	14	0.1454
  41 | 8	19	0.6868
  42 | 8	21	0.1126
  43 | 8	76	0.3617
  44 | 9	18	0.6572
  45 | 9	75	0.3410
  46 | 10	17	0.6133
  47 | 10	74	0.3016
  48 | 11	16	0.4873
  49 | 12	19	0.1517
  50 | 12	30	0.2306
  51 | 13	18	0.1525
  52 | 13	29	0.2374
  53 | 17	25	0.7066
  54 | 17	28	0.1817
  55 | 18	24	0.6870
  56 | 18	27	0.1769
  57 | 19	26	0.1655
  58 | 29	38	0.1133
  59 | 29	44	0.1457
  60 | 30	37	0.1054
  61 | 30	43	0.1075
  62 | 34	42	0.1434
  63 | 34	43	0.8856
  64 | 35	41	0.1412
  65 | 35	42	0.8929
  66 | 36	41	0.8794
  67 | 39	136	0.1193
  68 | 40	134	0.3888
  69 | 40	135	0.1112
  70 | 41	133	0.4265
  71 | 41	139	0.1274
  72 | 41	140	0.1406
  73 | 42	95	0.1066
  74 | 42	132	0.4217
  75 | 42	138	0.1266
  76 | 42	139	0.1389
  77 | 43	86	0.1945
  78 | 43	94	0.1059
  79 | 43	131	0.4154
  80 | 43	137	0.1249
  81 | 43	138	0.1358
  82 | 44	85	0.1948
  83 | 44	93	0.1048
  84 | 45	84	0.1913
  85 | 46	83	0.1795
  86 | 58	71	0.1066
  87 | 59	70	0.1067
  88 | 59	72	0.1271
  89 | 60	71	0.1783
  90 | 61	70	0.1858
  91 | 61	71	0.1152
  92 | 61	72	0.1266
  93 | 62	70	0.1188
  94 | 62	71	0.1856
  95 | 63	70	0.1899
  96 | 63	71	0.1432
  97 | 63	72	0.1092
  98 | 64	70	0.1477
  99 | 64	71	0.1590
 100 | 65	70	0.1598
 101 | 72	128	0.7241
 102 | 73	127	0.7766
 103 | 74	126	0.7729
 104 | 75	86	0.1530
 105 | 75	125	0.7683
 106 | 76	85	0.1517
 107 | 76	124	0.7378
 108 | 77	84	0.1384
 109 | 78	122	0.3847
 110 | 82	96	0.1087
 111 | 83	95	0.1391
 112 | 83	121	0.9312
 113 | 83	123	0.1150
 114 | 84	120	0.9298
 115 | 84	122	0.1137
 116 | 85	94	0.1665
 117 | 85	119	0.9286
 118 | 85	121	0.1081
 119 | 86	93	0.1657
 120 | 86	118	0.9256
 121 | 88	116	0.9012
 122 | 89	115	0.9076
 123 | 90	114	0.8929
 124 | 90	177	0.1498
 125 | 91	114	0.1633
 126 | 91	176	0.1499
 127 | 91	181	0.1758
 128 | 92	175	0.1472
 129 | 92	180	0.1794
 130 | 93	112	0.9419
 131 | 93	174	0.1425
 132 | 93	179	0.1789
 133 | 93	186	0.1055
 134 | 94	111	0.9378
 135 | 94	178	0.1761
 136 | 94	185	0.1039
 137 | 95	177	0.1731
 138 | 95	184	0.1022
 139 | 96	109	0.9772
 140 | 97	108	0.9739
 141 | 97	186	0.1071
 142 | 98	107	0.9689
 143 | 98	185	0.1058
 144 | 99	106	0.9637
 145 | 99	111	0.1591
 146 | 99	184	0.1040
 147 | 100	110	0.1881
 148 | 101	109	0.1933
 149 | 101	180	0.1620
 150 | 102	108	0.1924
 151 | 102	179	0.1831
 152 | 103	107	0.1901
 153 | 103	178	0.1824
 154 | 104	177	0.1803
 155 | 105	130	0.1537
 156 | 105	176	0.1768
 157 | 106	129	0.1786
 158 | 106	175	0.1700
 159 | 107	128	0.1779
 160 | 107	174	0.1684
 161 | 108	127	0.1319
 162 | 109	127	0.1974
 163 | 110	126	0.2304
 164 | 111	125	0.2292
 165 | 111	128	0.2118
 166 | 111	172	0.3265
 167 | 112	127	0.2343
 168 | 112	171	0.3258
 169 | 113	122	0.1496
 170 | 113	126	0.2302
 171 | 113	170	0.3226
 172 | 114	121	0.1555
 173 | 114	123	0.3258
 174 | 114	125	0.2087
 175 | 114	129	0.1571
 176 | 114	135	0.1067
 177 | 114	169	0.3192
 178 | 115	120	0.1449
 179 | 115	122	0.3322
 180 | 115	126	0.1063
 181 | 115	128	0.1551
 182 | 115	134	0.1123
 183 | 116	121	0.3248
 184 | 116	123	0.1056
 185 | 116	125	0.1092
 186 | 116	133	0.1126
 187 | 116	168	0.3147
 188 | 117	167	0.3115
 189 | 118	123	0.1225
 190 | 118	125	0.1622
 191 | 118	131	0.1140
 192 | 118	166	0.2955
 193 | 119	124	0.1479
 194 | 119	130	0.1113
 195 | 120	164	0.3004
 196 | 121	127	0.1027
 197 | 121	163	0.2983
 198 | 122	162	0.2836
 199 | 123	222	0.1403
 200 | 124	157	0.2839
 201 | 124	221	0.1380
 202 | 125	156	0.2953
 203 | 125	219	0.1877
 204 | 126	155	0.2928
 205 | 126	195	0.3840
 206 | 126	218	0.1842
 207 | 127	154	0.2899
 208 | 127	194	0.4358
 209 | 128	193	0.4335
 210 | 128	216	0.1362
 211 | 129	192	0.4413
 212 | 129	217	0.1002
 213 | 130	191	0.4375
 214 | 130	213	0.1393
 215 | 130	229	0.2526
 216 | 131	190	0.4295
 217 | 131	205	0.1376
 218 | 131	212	0.1237
 219 | 131	228	0.2682
 220 | 132	189	0.4206
 221 | 132	204	0.1385
 222 | 132	212	0.4547
 223 | 132	227	0.2590
 224 | 133	203	0.1368
 225 | 133	211	0.4647
 226 | 133	226	0.2490
 227 | 134	202	0.1334
 228 | 134	210	0.4635
 229 | 134	225	0.2377
 230 | 135	201	0.1199
 231 | 135	209	0.4551
 232 | 135	224	0.2330
 233 | 136	187	0.1798
 234 | 136	208	0.4210
 235 | 136	223	0.2294
 236 | 136	229	0.1331
 237 | 137	185	0.1980
 238 | 137	205	0.3496
 239 | 137	222	0.2223
 240 | 137	226	0.1174
 241 | 137	227	0.8541
 242 | 137	228	0.1310
 243 | 138	184	0.1952
 244 | 138	185	0.3715
 245 | 138	204	0.3467
 246 | 138	205	0.2817
 247 | 138	225	0.1170
 248 | 138	226	0.9198
 249 | 138	227	0.1161
 250 | 139	183	0.1912
 251 | 139	184	0.3743
 252 | 139	203	0.3419
 253 | 139	204	0.2792
 254 | 139	224	0.1140
 255 | 139	225	0.9177
 256 | 139	226	0.1004
 257 | 140	181	0.1843
 258 | 140	183	0.3720
 259 | 140	203	0.2756
 260 | 140	222	0.1184
 261 | 140	224	0.9060
 262 | 141	180	0.1815
 263 | 141	182	0.3684
 264 | 141	221	0.1212
 265 | 141	223	0.8940
 266 | 142	178	0.1842
 267 | 142	181	0.3122
 268 | 142	219	0.2270
 269 | 142	222	0.8778
 270 | 142	226	0.2109
 271 | 143	177	0.1852
 272 | 143	193	0.1150
 273 | 143	218	0.2363
 274 | 143	220	0.8056
 275 | 143	225	0.2145
 276 | 144	176	0.1846
 277 | 144	192	0.1179
 278 | 144	217	0.2331
 279 | 144	219	0.8036
 280 | 144	224	0.2159
 281 | 145	157	0.1047
 282 | 145	175	0.1774
 283 | 145	191	0.1168
 284 | 145	213	0.2247
 285 | 145	223	0.2127
 286 | 146	156	0.1114
 287 | 146	177	0.1472
 288 | 146	190	0.1148
 289 | 146	212	0.2244
 290 | 146	217	0.7404
 291 | 146	219	0.1600
 292 | 146	222	0.2091
 293 | 147	155	0.1066
 294 | 147	176	0.1436
 295 | 147	195	0.1233
 296 | 147	211	0.2186
 297 | 147	216	0.7285
 298 | 147	218	0.1597
 299 | 147	220	0.1403
 300 | 148	210	0.1931
 301 | 148	215	0.6816
 302 | 148	217	0.1513
 303 | 148	219	0.1414
 304 | 149	193	0.7045
 305 | 149	209	0.1105
 306 | 149	214	0.4759
 307 | 149	218	0.1341
 308 | 150	167	0.1234
 309 | 150	171	0.2313
 310 | 150	192	0.8036
 311 | 150	212	0.2319
 312 | 150	217	0.1299
 313 | 151	166	0.1248
 314 | 151	170	0.2288
 315 | 151	191	0.7970
 316 | 151	213	0.1369
 317 | 152	190	0.7779
 318 | 152	210	0.1515
 319 | 152	211	0.2039
 320 | 152	212	0.1315
 321 | 153	164	0.1550
 322 | 153	189	0.7258
 323 | 153	190	0.1411
 324 | 153	209	0.1634
 325 | 153	210	0.2073
 326 | 153	211	0.1113
 327 | 154	163	0.1604
 328 | 154	167	0.2924
 329 | 154	181	0.2106
 330 | 154	189	0.2056
 331 | 155	166	0.2954
 332 | 155	180	0.2853
 333 | 155	187	0.7757
 334 | 155	188	0.1452
 335 | 155	208	0.3518
 336 | 156	165	0.2948
 337 | 156	179	0.2851
 338 | 156	186	0.7995
 339 | 156	207	0.3581
 340 | 157	164	0.2901
 341 | 157	178	0.2825
 342 | 157	185	0.7927
 343 | 157	206	0.3538
 344 | 157	226	0.2066
 345 | 158	163	0.2653
 346 | 158	177	0.2794
 347 | 158	184	0.7851
 348 | 158	205	0.3487
 349 | 158	225	0.2918
 350 | 159	176	0.2779
 351 | 159	183	0.7821
 352 | 159	204	0.3435
 353 | 159	224	0.3417
 354 | 160	175	0.2717
 355 | 160	182	0.7758
 356 | 160	223	0.3384
 357 | 161	171	0.2929
 358 | 161	181	0.7699
 359 | 161	203	0.1115
 360 | 161	222	0.3347
 361 | 162	170	0.2917
 362 | 162	180	0.7583
 363 | 162	199	0.1656
 364 | 162	221	0.3293
 365 | 163	169	0.2891
 366 | 163	179	0.4325
 367 | 163	197	0.2754
 368 | 163	198	0.1428
 369 | 164	196	0.2842
 370 | 165	178	0.1279
 371 | 165	193	0.2070
 372 | 165	195	0.2262
 373 | 165	215	0.2509
 374 | 165	218	0.1655
 375 | 166	192	0.2508
 376 | 166	214	0.2884
 377 | 166	217	0.1289
 378 | 167	179	0.6239
 379 | 167	191	0.3129
 380 | 167	213	0.3184
 381 | 168	177	0.2714
 382 | 168	178	0.6941
 383 | 168	190	0.3153
 384 | 168	212	0.3163
 385 | 168	266	0.2991
 386 | 168	267	0.3370
 387 | 169	176	0.2728
 388 | 169	177	0.6887
 389 | 169	189	0.3127
 390 | 169	211	0.3133
 391 | 169	265	0.2967
 392 | 169	266	0.3335
 393 | 170	176	0.6669
 394 | 170	210	0.2794
 395 | 170	264	0.2725
 396 | 170	265	0.3264
 397 | 171	175	0.3079
 398 | 171	186	0.3155
 399 | 171	207	0.2549
 400 | 172	185	0.3135
 401 | 172	205	0.2916
 402 | 172	262	0.2387
 403 | 172	267	0.2645
 404 | 173	184	0.3113
 405 | 173	204	0.2897
 406 | 173	262	0.2971
 407 | 173	266	0.2633
 408 | 174	183	0.3090
 409 | 174	203	0.2870
 410 | 174	256	0.1289
 411 | 174	260	0.4290
 412 | 174	265	0.2582
 413 | 175	200	0.1338
 414 | 175	202	0.2379
 415 | 175	255	0.1268
 416 | 175	259	0.4249
 417 | 175	264	0.2453
 418 | 176	199	0.2642
 419 | 176	254	0.1031
 420 | 176	258	0.4196
 421 | 177	198	0.2728
 422 | 177	254	0.4666
 423 | 178	197	0.2704
 424 | 178	253	0.4919
 425 | 179	252	0.4945
 426 | 179	260	0.2338
 427 | 180	195	0.2686
 428 | 180	251	0.4908
 429 | 180	259	0.2416
 430 | 181	194	0.2693
 431 | 181	250	0.4857
 432 | 181	258	0.2437
 433 | 182	193	0.2667
 434 | 182	257	0.2363
 435 | 183	249	0.4750
 436 | 184	191	0.2455
 437 | 184	248	0.5106
 438 | 184	254	0.2381
 439 | 185	247	0.5064
 440 | 185	253	0.2431
 441 | 186	211	0.1425
 442 | 186	246	0.5015
 443 | 186	252	0.2403
 444 | 187	210	0.1501
 445 | 187	245	0.4951
 446 | 187	251	0.2339
 447 | 188	209	0.1592
 448 | 188	244	0.4684
 449 | 189	208	0.1601
 450 | 189	243	0.4540
 451 | 189	248	0.2303
 452 | 190	207	0.1593
 453 | 190	242	0.3478
 454 | 190	247	0.2280
 455 | 191	206	0.1464
 456 | 191	225	0.1090
 457 | 191	241	0.1005
 458 | 191	244	0.1661
 459 | 191	246	0.2131
 460 | 192	243	0.2084
 461 | 193	223	0.1662
 462 | 193	242	0.2145
 463 | 194	203	0.1109
 464 | 194	222	0.1700
 465 | 194	239	0.1094
 466 | 194	241	0.2120
 467 | 194	293	0.2462
 468 | 195	221	0.1690
 469 | 195	238	0.1044
 470 | 195	242	0.2437
 471 | 195	292	0.2424
 472 | 196	205	0.1498
 473 | 196	206	0.5802
 474 | 196	220	0.1673
 475 | 196	241	0.2777
 476 | 196	291	0.2342
 477 | 197	204	0.2357
 478 | 197	205	0.6661
 479 | 197	212	0.1126
 480 | 197	219	0.1630
 481 | 197	240	0.2919
 482 | 197	241	0.2240
 483 | 197	290	0.2296
 484 | 198	203	0.2348
 485 | 198	204	0.6618
 486 | 198	211	0.1130
 487 | 198	217	0.1451
 488 | 198	239	0.2892
 489 | 198	240	0.2250
 490 | 198	289	0.2236
 491 | 199	203	0.5922
 492 | 199	210	0.1081
 493 | 199	216	0.1393
 494 | 199	239	0.2222
 495 | 200	238	0.2193
 496 | 201	234	0.3263
 497 | 201	237	0.1782
 498 | 202	233	0.3532
 499 | 202	236	0.1219
 500 | 203	232	0.3583
 501 | 204	231	0.3545
 502 | 205	230	0.3531
 503 | 205	243	0.2290
 504 | 205	288	0.2146
 505 | 206	213	0.2741
 506 | 206	229	0.3514
 507 | 206	242	0.2321
 508 | 206	287	0.2189
 509 | 207	212	0.3012
 510 | 207	228	0.3483
 511 | 207	240	0.3874
 512 | 207	241	0.2323
 513 | 207	286	0.2181
 514 | 208	227	0.3367
 515 | 208	239	0.3864
 516 | 208	240	0.2199
 517 | 208	285	0.2129
 518 | 209	238	0.3824
 519 | 210	223	0.1646
 520 | 210	237	0.3713
 521 | 210	238	0.1388
 522 | 211	236	0.3152
 523 | 211	237	0.1407
 524 | 211	282	0.2060
 525 | 212	221	0.2150
 526 | 212	223	0.1176
 527 | 212	236	0.1333
 528 | 212	281	0.2043
 529 | 213	220	0.2111
 530 | 213	222	0.1479
 531 | 213	224	0.1098
 532 | 213	280	0.1989
 533 | 214	221	0.1439
 534 | 214	223	0.1067
 535 | 215	234	0.4360
 536 | 216	233	0.4743
 537 | 216	278	0.1824
 538 | 217	232	0.4800
 539 | 217	300	0.1031
 540 | 218	231	0.4780
 541 | 218	276	0.2310
 542 | 218	299	0.1012
 543 | 219	230	0.4760
 544 | 219	275	0.2298
 545 | 220	229	0.4743
 546 | 221	228	0.4683
 547 | 221	273	0.2699
 548 | 222	272	0.3309
 549 | 223	271	0.3291
 550 | 224	270	0.3218
 551 | 225	269	0.3181
 552 | 225	272	0.1275
 553 | 226	272	0.1835
 554 | 227	270	0.5617
 555 | 228	269	0.6401
 556 | 229	263	0.1277
 557 | 229	265	0.3159
 558 | 229	268	0.6404
 559 | 230	262	0.1525
 560 | 230	264	0.3404
 561 | 230	267	0.6400
 562 | 231	257	0.1646
 563 | 231	261	0.1708
 564 | 231	263	0.3478
 565 | 231	266	0.6441
 566 | 232	239	0.1000
 567 | 232	246	0.1148
 568 | 232	256	0.1974
 569 | 232	260	0.1729
 570 | 232	262	0.3483
 571 | 232	265	0.6469
 572 | 233	245	0.1196
 573 | 233	255	0.1849
 574 | 233	259	0.1219
 575 | 233	260	0.1941
 576 | 233	261	0.2946
 577 | 233	264	0.6431
 578 | 234	244	0.1214
 579 | 234	259	0.3299
 580 | 234	260	0.1824
 581 | 234	263	0.6300
 582 | 235	243	0.1214
 583 | 235	247	0.1047
 584 | 235	253	0.2635
 585 | 235	258	0.3972
 586 | 236	246	0.1048
 587 | 236	252	0.2590
 588 | 236	257	0.3960
 589 | 236	261	0.6181
 590 | 237	245	0.1056
 591 | 237	251	0.2446
 592 | 237	256	0.3930
 593 | 237	260	0.6081
 594 | 237	261	0.1095
 595 | 237	262	0.1043
 596 | 238	244	0.1056
 597 | 238	251	0.1256
 598 | 238	255	0.3880
 599 | 238	259	0.5357
 600 | 238	260	0.1129
 601 | 238	261	0.1047
 602 | 239	243	0.1036
 603 | 239	249	0.2686
 604 | 239	250	0.1386
 605 | 239	254	0.3804
 606 | 239	258	0.3894
 607 | 240	248	0.2988
 608 | 240	253	0.3761
 609 | 241	247	0.2983
 610 | 241	258	0.5737
 611 | 242	246	0.2780
 612 | 242	251	0.3091
 613 | 242	255	0.1089
 614 | 242	257	0.6636
 615 | 243	256	0.6682
 616 | 245	254	0.6881
 617 | 246	253	0.7003
 618 | 246	269	0.1136
 619 | 247	252	0.6947
 620 | 247	268	0.1164
 621 | 248	267	0.1176
 622 | 249	266	0.1195
 623 | 250	265	0.1228
 624 | 253	262	0.1293
 625 | 254	261	0.1249
 626 | 257	351	0.5061
 627 | 258	324	0.1011
 628 | 258	350	0.5417
 629 | 259	349	0.5320
 630 | 260	300	0.2085
 631 | 260	348	0.5151
 632 | 261	299	0.2072
 633 | 261	349	0.1411
 634 | 262	298	0.2053
 635 | 262	347	0.4714
 636 | 262	348	0.1427
 637 | 265	345	0.2921
 638 | 265	357	0.1036
 639 | 266	343	0.6887
 640 | 267	329	0.5078
 641 | 267	342	0.6972
 642 | 268	292	0.2249
 643 | 268	295	0.5342
 644 | 268	328	0.5289
 645 | 268	341	0.6997
 646 | 269	291	0.2294
 647 | 269	294	0.5314
 648 | 269	327	0.5284
 649 | 269	340	0.6852
 650 | 270	279	0.2281
 651 | 270	290	0.2292
 652 | 270	293	0.5277
 653 | 270	326	0.5212
 654 | 270	339	0.6732
 655 | 271	278	0.2290
 656 | 271	292	0.5096
 657 | 271	325	0.5139
 658 | 271	338	0.6585
 659 | 272	277	0.2276
 660 | 272	283	0.1153
 661 | 272	289	0.4737
 662 | 272	291	0.4068
 663 | 272	324	0.5069
 664 | 272	337	0.6438
 665 | 273	282	0.1154
 666 | 273	288	0.5776
 667 | 273	299	0.6089
 668 | 273	323	0.4618
 669 | 274	281	0.1143
 670 | 274	287	0.6372
 671 | 274	298	0.6995
 672 | 274	319	0.3780
 673 | 274	321	0.1473
 674 | 275	286	0.6447
 675 | 275	297	0.7005
 676 | 275	318	0.3778
 677 | 275	320	0.1390
 678 | 276	285	0.6408
 679 | 276	296	0.6976
 680 | 276	317	0.3804
 681 | 277	284	0.6368
 682 | 277	295	0.6931
 683 | 277	316	0.3801
 684 | 277	341	0.1142
 685 | 278	283	0.6067
 686 | 278	294	0.6868
 687 | 278	315	0.3668
 688 | 278	340	0.1120
 689 | 280	292	0.6765
 690 | 280	311	0.1894
 691 | 280	338	0.1117
 692 | 281	291	0.6719
 693 | 281	302	0.1302
 694 | 281	308	0.2800
 695 | 281	310	0.1928
 696 | 281	337	0.1100
 697 | 282	290	0.6558
 698 | 282	301	0.1300
 699 | 282	307	0.2803
 700 | 282	309	0.1822
 701 | 282	336	0.1078
 702 | 283	300	0.1295
 703 | 283	335	0.1055
 704 | 284	289	0.2060
 705 | 284	305	0.2887
 706 | 285	299	0.1324
 707 | 286	298	0.1323
 708 | 286	360	0.1251
 709 | 287	297	0.1313
 710 | 287	302	0.3097
 711 | 287	359	0.1024
 712 | 288	296	0.1305
 713 | 288	301	0.3238
 714 | 289	295	0.1296
 715 | 289	300	0.3249
 716 | 290	299	0.3224
 717 | 290	329	0.1736
 718 | 290	348	0.1126
 719 | 291	298	0.3201
 720 | 291	328	0.1727
 721 | 291	347	0.1091
 722 | 292	297	0.3125
 723 | 292	327	0.1715
 724 | 292	346	0.1052
 725 | 294	321	0.1469
 726 | 294	325	0.1677
 727 | 295	320	0.1475
 728 | 295	324	0.1657
 729 | 296	319	0.1450
 730 | 296	323	0.1619
 731 | 297	311	0.5054
 732 | 297	321	0.1375
 733 | 298	308	0.2554
 734 | 298	310	0.5181
 735 | 298	317	0.1078
 736 | 298	320	0.1356
 737 | 299	307	0.2814
 738 | 299	309	0.5236
 739 | 299	315	0.1020
 740 | 300	305	0.1212
 741 | 300	306	0.2937
 742 | 300	308	0.5244
 743 | 300	314	0.1030
 744 | 300	350	0.1181
 745 | 301	349	0.1174
 746 | 302	348	0.1140
 747 | 302	360	0.1868
 748 | 303	349	0.1336
 749 | 304	347	0.1057
 750 | 304	348	0.1361
 751 | 304	357	0.9610
 752 | 305	347	0.1314
 753 | 305	356	0.8859
 754 | 305	357	0.1656
 755 | 306	345	0.1404
 756 | 306	355	0.8205
 757 | 306	356	0.1525
 758 | 307	338	0.1167
 759 | 307	354	0.7605
 760 | 308	343	0.1589
 761 | 308	355	0.1769
 762 | 309	342	0.1556
 763 | 309	354	0.1666
 764 | 310	316	0.1119
 765 | 310	321	0.2791
 766 | 310	335	0.6751
 767 | 310	341	0.1519
 768 | 311	320	0.2758
 769 | 311	334	0.6625
 770 | 311	340	0.1444
 771 | 312	319	0.2519
 772 | 312	333	0.6005
 773 | 313	333	0.2320
 774 | 315	325	0.1176
 775 | 315	338	0.1185
 776 | 315	351	0.7384
 777 | 316	324	0.1210
 778 | 316	330	0.6845
 779 | 316	337	0.1202
 780 | 316	350	0.7286
 781 | 317	323	0.1120
 782 | 317	329	0.6780
 783 | 317	348	0.2119
 784 | 317	349	0.6974
 785 | 318	328	0.6678
 786 | 318	335	0.1395
 787 | 318	347	0.2056
 788 | 318	348	0.6727
 789 | 319	327	0.6515
 790 | 319	334	0.1379
 791 | 319	346	0.1950
 792 | 320	333	0.1355
 793 | 320	345	0.1611
 794 | 320	347	0.6507
 795 | 321	326	0.1937
 796 | 321	332	0.1330
 797 | 321	346	0.6251
 798 | 323	330	0.1018
 799 | 323	344	0.3889
 800 | 323	346	0.1196
 801 | 324	329	0.1106
 802 | 324	343	0.3827
 803 | 324	345	0.4989
 804 | 325	344	0.4913
 805 | 326	342	0.3724
 806 | 326	343	0.4729
 807 | 327	341	0.5910
 808 | 328	340	0.5799
 809 | 329	339	0.5670
 810 | 330	335	0.1024
 811 | 330	338	0.5244
 812 | 330	355	0.1052
 813 | 330	356	0.3729
 814 | 330	357	0.1529
 815 | 331	355	0.3555
 816 | 331	356	0.1456
 817 | 332	354	0.3299
 818 | 332	355	0.1347
 819 | 333	352	0.2639
 820 | 333	353	0.2223
 821 | 334	351	0.3256
 822 | 335	350	0.3131
 823 | 336	349	0.2919
 824 | 337	347	0.1370
 825 | 337	348	0.1832
 826 | 338	346	0.1850
 827 | 339	345	0.1802
 828 | 339	348	0.2080
 829 | 340	347	0.2204
 830 | 341	346	0.2147
 831 | >CLIP_0000002
 832 | 1	52	0.1024
 833 | 2	33	0.1185
 834 | 2	35	0.9293
 835 | 3	34	0.8970
 836 | 4	33	0.9382
 837 | 5	17	0.1102
 838 | 5	27	0.2739
 839 | 5	32	0.8510
 840 | 5	66	0.1916
 841 | 5	71	0.1865
 842 | 6	16	0.1022
 843 | 6	26	0.2510
 844 | 6	31	0.7822
 845 | 6	65	0.1767
 846 | 6	70	0.1715
 847 | 7	25	0.2318
 848 | 7	30	0.7235
 849 | 7	69	0.1585
 850 | 8	28	0.1303
 851 | 8	64	0.6075
 852 | 8	68	0.1181
 853 | 9	63	0.6362
 854 | 9	106	0.2117
 855 | 10	25	0.1487
 856 | 10	62	0.6032
 857 | 10	105	0.2040
 858 | 12	24	0.6015
 859 | 12	30	0.3053
 860 | 12	60	0.5518
 861 | 12	81	0.1609
 862 | 13	23	0.5857
 863 | 13	29	0.2950
 864 | 13	59	0.5317
 865 | 13	80	0.2050
 866 | 14	22	0.5660
 867 | 14	27	0.5789
 868 | 14	58	0.5127
 869 | 14	79	0.2323
 870 | 15	21	0.5469
 871 | 15	26	0.6025
 872 | 15	57	0.4958
 873 | 15	78	0.2626
 874 | 16	20	0.5257
 875 | 16	25	0.5892
 876 | 16	56	0.3399
 877 | 16	77	0.2693
 878 | 17	24	0.5715
 879 | 17	30	0.1521
 880 | 17	56	0.3291
 881 | 17	74	0.1938
 882 | 17	76	0.2605
 883 | 18	23	0.3919
 884 | 18	29	0.1577
 885 | 18	33	0.1182
 886 | 18	55	0.4522
 887 | 18	73	0.2027
 888 | 19	28	0.1545
 889 | 19	54	0.4402
 890 | 19	72	0.1967
 891 | 19	74	0.2237
 892 | 20	27	0.1403
 893 | 20	31	0.1596
 894 | 20	53	0.4292
 895 | 20	70	0.1980
 896 | 20	71	0.1358
 897 | 20	73	0.2161
 898 | 20	78	0.1453
 899 | 21	30	0.1553
 900 | 21	52	0.4185
 901 | 21	69	0.2361
 902 | 21	77	0.1483
 903 | 22	68	0.2307
 904 | 22	76	0.1450
 905 | 23	67	0.2246
 906 | 23	72	0.3412
 907 | 23	118	0.1819
 908 | 24	32	0.1342
 909 | 24	49	0.3812
 910 | 24	66	0.2103
 911 | 24	71	0.5092
 912 | 24	117	0.2028
 913 | 25	31	0.1798
 914 | 25	48	0.3725
 915 | 25	65	0.1966
 916 | 25	70	0.5046
 917 | 25	116	0.1997
 918 | 26	30	0.1757
 919 | 26	46	0.1752
 920 | 26	63	0.1086
 921 | 26	69	0.4949
 922 | 26	115	0.1959
 923 | 27	45	0.1688
 924 | 27	62	0.1052
 925 | 27	68	0.4851
 926 | 29	109	0.1496
 927 | 30	47	0.2793
 928 | 30	108	0.1652
 929 | 30	111	0.2061
 930 | 31	46	0.2774
 931 | 31	107	0.1630
 932 | 31	110	0.2029
 933 | 32	45	0.2456
 934 | 32	106	0.1588
 935 | 32	109	0.1954
 936 | 33	44	0.2421
 937 | 33	45	0.1329
 938 | 33	46	0.3279
 939 | 33	105	0.1523
 940 | 34	43	0.2200
 941 | 34	44	0.1175
 942 | 34	45	0.3357
 943 | 34	133	0.4446
 944 | 35	42	0.2151
 945 | 35	43	0.1489
 946 | 35	44	0.7187
 947 | 35	45	0.1180
 948 | 35	46	0.1012
 949 | 35	132	0.4991
 950 | 36	42	0.1466
 951 | 36	43	0.7106
 952 | 36	44	0.1381
 953 | 36	45	0.1039
 954 | 36	107	0.3429
 955 | 36	131	0.4960
 956 | 37	42	0.6999
 957 | 37	43	0.1363
 958 | 37	44	0.1041
 959 | 37	106	0.3449
 960 | 37	130	0.4893
 961 | 38	42	0.1212
 962 | 38	43	0.1008
 963 | 38	105	0.3404
 964 | 38	109	0.1012
 965 | 38	129	0.4821
 966 | 39	73	0.1272
 967 | 39	104	0.3417
 968 | 39	108	0.1009
 969 | 39	128	0.4741
 970 | 40	72	0.1250
 971 | 40	75	0.2233
 972 | 40	103	0.3373
 973 | 41	74	0.2621
 974 | 41	102	0.3332
 975 | 41	125	0.4628
 976 | 42	71	0.2112
 977 | 42	73	0.2632
 978 | 42	101	0.3287
 979 | 42	124	0.4585
 980 | 43	70	0.2087
 981 | 43	71	0.2858
 982 | 43	100	0.3224
 983 | 43	123	0.4516
 984 | 44	70	0.2827
 985 | 44	83	0.1480
 986 | 44	122	0.4453
 987 | 45	66	0.8529
 988 | 45	82	0.1461
 989 | 45	83	0.2006
 990 | 46	65	0.8513
 991 | 46	82	0.1988
 992 | 47	64	0.8497
 993 | 47	81	0.1954
 994 | 48	63	0.8425
 995 | 48	77	0.3820
 996 | 49	62	0.8339
 997 | 49	76	0.4657
 998 | 50	61	0.8241
 999 | 50	75	0.4766
1000 | 51	60	0.8066
1001 | 51	74	0.4798
1002 | 52	59	0.4927
1003 | 52	73	0.4850
1004 | 53	74	0.1360
1005 | 54	71	0.4881
1006 | 54	73	0.1373
1007 | 56	70	0.5424
1008 | 57	69	0.5407
1009 | 57	76	0.1825
1010 | 58	68	0.5357
1011 | 58	75	0.2041
1012 | 59	67	0.5314
1013 | 59	74	0.2092
1014 | 60	66	0.5265
1015 | 60	73	0.2124
1016 | 62	71	0.2613
1017 | 63	70	0.2589
1018 | 65	147	0.2265
1019 | 66	146	0.2258
1020 | 67	80	0.2024
1021 | 67	145	0.2239
1022 | 68	79	0.2460
1023 | 68	117	0.5293
1024 | 68	144	0.2185
1025 | 69	78	0.2695
1026 | 69	108	0.1049
1027 | 69	116	0.5261
1028 | 70	77	0.2706
1029 | 70	107	0.1044
1030 | 70	115	0.5157
1031 | 70	142	0.2165
1032 | 71	76	0.2715
1033 | 71	106	0.1035
1034 | 71	141	0.2149
1035 | 72	113	0.2451
1036 | 72	126	0.2050
1037 | 73	115	0.1870
1038 | 73	125	0.2456
1039 | 73	140	0.2214
1040 | 74	111	0.4320
1041 | 74	113	0.1468
1042 | 74	114	0.2659
1043 | 74	124	0.2456
1044 | 74	139	0.2212
1045 | 75	112	0.1518
1046 | 75	113	0.2637
1047 | 75	123	0.2439
1048 | 75	138	0.2198
1049 | 76	111	0.1514
1050 | 76	112	0.2609
1051 | 76	122	0.2422
1052 | 76	137	0.2182
1053 | 77	108	0.7832
1054 | 77	111	0.2524
1055 | 77	121	0.2290
1056 | 77	136	0.2168
1057 | 78	107	0.7887
1058 | 78	110	0.2401
1059 | 78	120	0.2157
1060 | 78	135	0.2066
1061 | 79	106	0.8113
1062 | 79	109	0.1741
1063 | 79	133	0.1438
1064 | 80	105	0.8849
1065 | 80	132	0.1443
1066 | 81	104	0.9404
1067 | 82	103	0.9412
1068 | 82	130	0.1458
1069 | 83	102	0.9361
1070 | 83	129	0.1450
1071 | 84	100	0.1852
1072 | 84	101	0.9085
1073 | 84	128	0.1440
1074 | 85	127	0.1341
1075 | 86	98	0.9428
1076 | 86	99	0.1717
1077 | 87	97	0.9790
1078 | 88	96	0.9737
1079 | 89	95	0.9682
1080 | 89	108	0.1016
1081 | 90	94	0.9007
1082 | 91	100	0.1048
1083 | 91	111	0.1849
1084 | 92	99	0.1047
1085 | 92	110	0.1842
1086 | 93	98	0.1026
1087 | 93	109	0.1835
1088 | 94	104	0.1034
1089 | 94	108	0.1830
1090 | 95	103	0.1025
1091 | 95	107	0.1804
1092 | 97	104	0.1134
1093 | 100	195	0.1252
1094 | 100	196	0.1058
1095 | 100	197	0.3304
1096 | 100	198	0.2597
1097 | 100	199	0.1166
1098 | 101	190	0.1046
1099 | 101	194	0.1238
1100 | 101	195	0.1041
1101 | 101	196	0.3262
1102 | 101	197	0.2588
1103 | 101	198	0.1164
1104 | 102	117	0.1806
1105 | 102	189	0.1072
1106 | 102	192	0.1000
1107 | 103	116	0.1801
1108 | 103	188	0.1055
1109 | 103	191	0.1293
1110 | 104	115	0.1792
1111 | 104	187	0.1038
1112 | 104	190	0.1285
1113 | 104	194	0.4620
1114 | 105	114	0.1781
1115 | 105	189	0.1168
1116 | 105	193	0.4614
1117 | 106	113	0.1612
1118 | 106	117	0.2755
1119 | 106	159	0.1574
1120 | 106	192	0.4611
1121 | 106	202	0.1180
1122 | 107	112	0.1130
1123 | 107	116	0.2752
1124 | 107	158	0.1905
1125 | 107	191	0.4559
1126 | 107	201	0.1163
1127 | 108	115	0.2738
1128 | 108	157	0.1893
1129 | 108	184	0.1716
1130 | 108	190	0.4489
1131 | 108	194	0.2227
1132 | 108	200	0.1142
1133 | 109	156	0.1874
1134 | 109	183	0.1737
1135 | 109	192	0.6581
1136 | 109	193	0.1585
1137 | 110	155	0.1850
1138 | 110	188	0.3988
1139 | 110	189	0.1177
1140 | 110	191	0.7351
1141 | 111	181	0.1906
1142 | 111	187	0.3968
1143 | 111	190	0.7339
1144 | 112	180	0.1886
1145 | 113	150	0.1311
1146 | 113	179	0.1870
1147 | 113	185	0.3394
1148 | 114	149	0.1479
1149 | 114	150	0.1431
1150 | 114	178	0.1855
1151 | 114	184	0.3994
1152 | 114	187	0.8327
1153 | 115	177	0.1834
1154 | 115	183	0.3999
1155 | 115	186	0.8476
1156 | 116	147	0.1573
1157 | 116	148	0.1551
1158 | 116	176	0.1656
1159 | 116	182	0.4017
1160 | 116	185	0.8500
1161 | 117	146	0.1569
1162 | 117	147	0.1544
1163 | 117	181	0.3968
1164 | 117	184	0.8458
1165 | 118	145	0.1494
1166 | 118	183	0.8363
1167 | 119	180	0.1070
1168 | 119	182	0.8190
1169 | 120	144	0.2127
1170 | 120	183	0.1131
1171 | 121	133	0.1570
1172 | 121	143	0.2162
1173 | 121	179	0.9459
1174 | 121	182	0.1170
1175 | 122	132	0.1685
1176 | 122	142	0.2159
1177 | 122	178	0.9610
1178 | 122	181	0.1248
1179 | 123	131	0.1677
1180 | 123	141	0.2146
1181 | 123	180	0.1154
1182 | 124	130	0.1672
1183 | 124	140	0.2135
1184 | 124	176	0.9731
1185 | 125	139	0.2022
1186 | 125	175	0.9889
1187 | 126	174	0.9789
1188 | 127	173	0.9695
1189 | 128	172	0.9518
1190 | 129	137	0.1207
1191 | 129	138	0.1307
1192 | 130	136	0.1239
1193 | 130	137	0.1369
1194 | 130	170	0.9857
1195 | 131	136	0.1380
1196 | 131	169	0.9856
1197 | 132	168	0.9790
1198 | 133	167	0.9764
1199 | 134	166	0.9728
1200 | 135	165	0.9630
1201 | 136	164	0.9544
1202 | 136	174	0.1412
1203 | 137	173	0.1410
1204 | 138	172	0.1425
1205 | 139	166	0.1094
1206 | 139	171	0.1434
1207 | 140	165	0.2178
1208 | 140	170	0.1429
1209 | 141	169	0.1417
1210 | 142	163	0.9717
1211 | 143	162	0.9832
1212 | 144	161	0.9789
1213 | 145	160	0.9681
1214 | 146	159	0.9631
1215 | 147	158	0.9603
1216 | 149	156	0.9417
1217 | 150	155	0.9347
1218 | 153	250	0.2587
1219 | 154	249	0.3125
1220 | 155	248	0.3243
1221 | 156	247	0.3189
1222 | 157	241	0.2409
1223 | 157	246	0.3138
1224 | 158	240	0.2377
1225 | 158	245	0.3082
1226 | 158	248	0.1629
1227 | 159	239	0.2336
1228 | 159	244	0.3003
1229 | 159	247	0.1689
1230 | 160	243	0.2847
1231 | 160	246	0.1697
1232 | 161	237	0.2295
1233 | 162	210	0.2253
1234 | 162	236	0.2266
1235 | 162	239	0.1364
1236 | 162	242	0.1417
1237 | 162	245	0.1732
1238 | 163	209	0.2270
1239 | 163	235	0.2187
1240 | 163	238	0.1346
1241 | 163	244	0.1743
1242 | 164	208	0.2268
1243 | 164	237	0.1090
1244 | 164	241	0.1379
1245 | 164	243	0.1843
1246 | 165	236	0.1326
1247 | 165	240	0.1355
1248 | 165	242	0.1834
1249 | 166	207	0.2262
1250 | 166	241	0.1809
1251 | 167	197	0.2671
1252 | 167	206	0.2240
1253 | 167	234	0.2306
1254 | 167	238	0.1196
1255 | 167	240	0.1460
1256 | 168	196	0.3459
1257 | 168	205	0.2211
1258 | 168	232	0.1011
1259 | 168	233	0.2346
1260 | 168	240	0.1036
1261 | 169	195	0.3887
1262 | 169	196	0.1023
1263 | 169	204	0.2202
1264 | 169	231	0.1013
1265 | 169	232	0.2331
1266 | 169	236	0.1297
1267 | 169	239	0.1471
1268 | 170	194	0.3884
1269 | 170	203	0.2175
1270 | 170	230	0.1002
1271 | 170	231	0.2291
1272 | 170	235	0.1285
1273 | 170	238	0.1459
1274 | 171	192	0.1944
1275 | 171	193	0.3437
1276 | 171	237	0.1292
1277 | 172	191	0.2590
1278 | 172	192	0.2813
1279 | 172	202	0.2003
1280 | 172	255	0.1208
1281 | 173	189	0.3642
1282 | 173	191	0.2523
1283 | 173	201	0.1984
1284 | 173	202	0.1684
1285 | 173	228	0.2128
1286 | 173	254	0.1950
1287 | 174	188	0.4029
1288 | 174	189	0.1729
1289 | 174	201	0.1689
1290 | 174	227	0.2108
1291 | 174	253	0.2353
1292 | 175	187	0.4381
1293 | 175	190	0.1014
1294 | 175	199	0.1935
1295 | 175	200	0.1679
1296 | 175	226	0.2080
1297 | 175	252	0.2354
1298 | 176	186	0.4349
1299 | 176	191	0.1633
1300 | 176	253	0.1626
1301 | 177	185	0.4318
1302 | 177	190	0.1637
1303 | 177	197	0.1895
1304 | 177	198	0.1635
1305 | 177	250	0.2333
1306 | 177	252	0.1624
1307 | 178	189	0.1627
1308 | 178	256	0.1791
1309 | 179	183	0.1848
1310 | 179	188	0.1572
1311 | 179	255	0.1770
1312 | 180	193	0.2597
1313 | 180	214	0.1290
1314 | 180	254	0.1745
1315 | 181	192	0.2706
1316 | 181	213	0.1335
1317 | 181	253	0.1718
1318 | 182	191	0.2713
1319 | 182	212	0.1224
1320 | 182	246	0.4185
1321 | 183	190	0.2701
1322 | 183	209	0.2285
1323 | 183	245	0.4141
1324 | 183	251	0.1253
1325 | 184	189	0.2659
1326 | 184	208	0.2664
1327 | 185	207	0.2646
1328 | 185	243	0.4195
1329 | 186	206	0.2623
1330 | 186	242	0.4151
1331 | 186	247	0.1630
1332 | 187	241	0.4120
1333 | 187	246	0.1675
1334 | 188	204	0.2552
1335 | 188	233	0.2913
1336 | 188	239	0.2783
1337 | 188	240	0.3384
1338 | 188	245	0.1657
1339 | 189	203	0.2552
1340 | 189	232	0.3127
1341 | 189	238	0.3832
1342 | 189	239	0.2480
1343 | 189	244	0.1641
1344 | 190	201	0.1917
1345 | 190	202	0.1798
1346 | 190	237	0.4403
1347 | 190	243	0.1623
1348 | 191	200	0.2595
1349 | 191	230	0.1195
1350 | 191	231	0.3992
1351 | 191	232	0.2219
1352 | 191	236	0.4424
1353 | 191	242	0.1599
1354 | 192	199	0.2557
1355 | 192	204	0.1006
1356 | 192	220	0.1095
1357 | 192	230	0.4051
1358 | 192	231	0.2300
1359 | 192	235	0.4341
1360 | 193	198	0.2380
1361 | 193	203	0.1582
1362 | 193	204	0.1119
1363 | 193	219	0.1555
1364 | 193	229	0.4299
1365 | 193	230	0.2555
1366 | 193	234	0.4051
1367 | 193	257	0.1250
1368 | 194	202	0.1893
1369 | 194	218	0.1681
1370 | 194	228	0.4521
1371 | 194	256	0.1405
1372 | 195	201	0.1879
1373 | 195	202	0.1677
1374 | 195	217	0.1673
1375 | 195	227	0.4480
1376 | 195	228	0.2994
1377 | 195	255	0.1387
1378 | 196	201	0.1670
1379 | 196	216	0.1648
1380 | 196	227	0.2989
1381 | 196	228	0.1074
1382 | 196	254	0.1375
1383 | 197	227	0.1070
1384 | 197	253	0.1360
1385 | 198	214	0.1629
1386 | 198	224	0.6974
1387 | 198	282	0.1447
1388 | 199	213	0.1618
1389 | 199	223	0.7427
1390 | 199	228	0.4664
1391 | 199	281	0.1427
1392 | 199	282	0.2381
1393 | 200	212	0.1509
1394 | 200	222	0.7426
1395 | 200	227	0.4641
1396 | 200	246	0.2606
1397 | 200	281	0.2355
1398 | 201	221	0.7385
1399 | 201	226	0.4607
1400 | 201	245	0.2632
1401 | 201	284	0.1826
1402 | 202	210	0.1298
1403 | 202	220	0.7302
1404 | 202	225	0.4571
1405 | 202	244	0.2611
1406 | 202	279	0.3080
1407 | 202	283	0.1860
1408 | 203	224	0.4532
1409 | 203	243	0.2586
1410 | 203	278	0.3203
1411 | 203	282	0.1840
1412 | 204	218	0.7288
1413 | 204	223	0.4500
1414 | 204	254	0.1049
1415 | 204	281	0.1813
1416 | 205	217	0.7268
1417 | 205	222	0.4465
1418 | 205	241	0.2517
1419 | 205	253	0.1161
1420 | 205	276	0.3939
1421 | 206	216	0.7213
1422 | 206	275	0.3911
1423 | 207	215	0.6862
1424 | 207	221	0.4364
1425 | 207	239	0.1292
1426 | 207	240	0.2213
1427 | 207	251	0.1256
1428 | 207	252	0.1793
1429 | 207	274	0.3868
1430 | 208	215	0.2014
1431 | 208	220	0.4327
1432 | 208	238	0.1290
1433 | 208	239	0.2193
1434 | 208	250	0.1259
1435 | 208	251	0.1784
1436 | 208	273	0.3820
1437 | 209	214	0.2540
1438 | 209	237	0.1051
1439 | 210	217	0.2492
1440 | 210	218	0.2174
1441 | 211	216	0.2219
1442 | 211	237	0.2420
1443 | 211	270	0.3821
1444 | 212	236	0.2566
1445 | 212	249	0.3393
1446 | 212	269	0.3827
1447 | 213	235	0.2612
1448 | 213	248	0.3666
1449 | 213	268	0.3846
1450 | 214	234	0.2546
1451 | 214	247	0.3653
1452 | 214	267	0.3821
1453 | 215	246	0.3638
1454 | 216	232	0.1862
1455 | 216	233	0.1119
1456 | 216	245	0.2027
1457 | 216	265	0.3740
1458 | 217	231	0.2273
1459 | 217	232	0.1171
1460 | 217	244	0.1958
1461 | 217	245	0.3007
1462 | 217	264	0.3753
1463 | 218	230	0.2258
1464 | 218	231	0.1162
1465 | 218	244	0.3011
1466 | 218	263	0.3729
1467 | 220	228	0.2625
1468 | 221	227	0.2622
1469 | 221	241	0.4807
1470 | 222	226	0.2594
1471 | 222	240	0.4781
1472 | 223	239	0.4743
1473 | 223	240	0.1305
1474 | 224	238	0.3782
1475 | 224	239	0.1607
1476 | 225	237	0.2621
1477 | 225	316	0.1707
1478 | 226	237	0.4363
1479 | 226	241	0.3036
1480 | 226	246	0.2336
1481 | 226	315	0.2062
1482 | 227	236	0.5146
1483 | 227	240	0.3042
1484 | 227	245	0.2360
1485 | 227	314	0.1552
1486 | 228	235	0.5126
1487 | 228	239	0.3028
1488 | 228	244	0.2350
1489 | 228	314	0.1960
1490 | 229	243	0.2339
1491 | 229	312	0.1315
1492 | 229	313	0.3049
1493 | 229	318	0.1386
1494 | 230	237	0.2806
1495 | 230	295	0.1403
1496 | 230	311	0.1305
1497 | 230	312	0.3251
1498 | 230	317	0.1378
1499 | 231	241	0.2286
1500 | 231	294	0.1627
1501 | 231	310	0.1289
1502 | 231	311	0.3226
1503 | 231	316	0.1358
1504 | 232	293	0.1786
1505 | 232	310	0.3195
1506 | 232	315	0.1341
1507 | 233	292	0.1764
1508 | 234	260	0.1667
1509 | 234	291	0.1740
1510 | 234	313	0.1140
1511 | 235	259	0.1890
1512 | 235	290	0.1703
1513 | 235	312	0.1256
1514 | 236	290	0.1095
1515 | 236	311	0.1226
1516 | 237	257	0.1902
1517 | 237	288	0.1490
1518 | 237	289	0.1128
1519 | 237	307	0.4526
1520 | 238	256	0.1895
1521 | 238	306	0.5672
1522 | 239	254	0.1737
1523 | 239	255	0.1351
1524 | 239	305	0.5709
1525 | 240	253	0.2200
1526 | 240	304	0.5685
1527 | 241	252	0.2197
1528 | 241	263	0.3035
1529 | 241	285	0.2119
1530 | 241	303	0.5635
1531 | 242	262	0.4954
1532 | 242	301	0.6004
1533 | 242	302	0.1170
1534 | 243	250	0.2167
1535 | 243	261	0.4933
1536 | 243	283	0.2292
1537 | 243	300	0.6093
1538 | 244	260	0.4906
1539 | 244	282	0.2347
1540 | 244	299	0.6047
1541 | 245	259	0.4886
1542 | 245	262	0.1086
1543 | 245	281	0.2330
1544 | 245	298	0.6000
1545 | 246	258	0.4856
1546 | 246	261	0.1086
1547 | 246	279	0.1551
1548 | 246	297	0.5932
1549 | 247	260	0.1080
1550 | 247	278	0.1349
1551 | 247	294	0.3547
1552 | 247	295	0.1083
1553 | 248	256	0.4615
1554 | 248	259	0.1074
1555 | 248	293	0.3850
1556 | 248	295	0.3593
1557 | 249	255	0.4529
1558 | 249	278	0.2689
1559 | 249	292	0.3772
1560 | 249	294	0.4187
1561 | 250	254	0.3058
1562 | 250	291	0.3510
1563 | 250	292	0.1586
1564 | 250	293	0.4156
1565 | 250	343	0.1227
1566 | 251	256	0.1032
1567 | 251	276	0.4630
1568 | 251	290	0.3245
1569 | 251	291	0.3708
1570 | 251	292	0.2899
1571 | 251	342	0.1401
1572 | 252	275	0.4684
1573 | 252	290	0.4897
1574 | 252	328	0.4845
1575 | 252	341	0.1389
1576 | 253	269	0.1012
1577 | 253	274	0.4745
1578 | 253	288	0.2933
1579 | 253	289	0.5037
1580 | 253	327	0.5040
1581 | 253	340	0.1377
1582 | 254	268	0.1007
1583 | 254	273	0.4767
1584 | 254	287	0.2883
1585 | 254	288	0.4983
1586 | 254	326	0.5073
1587 | 254	339	0.1342
1588 | 255	267	0.1003
1589 | 255	272	0.4800
1590 | 255	286	0.2055
1591 | 255	287	0.4917
1592 | 255	325	0.5118
1593 | 255	326	0.1405
1594 | 255	338	0.1291
1595 | 255	354	0.3027
1596 | 256	271	0.4853
1597 | 256	285	0.1833
1598 | 256	286	0.4466
1599 | 256	324	0.5171
1600 | 256	325	0.1905
1601 | 256	337	0.1228
1602 | 256	353	0.3612
1603 | 256	354	0.2952
1604 | 257	270	0.4823
1605 | 257	323	0.4131
1606 | 257	352	0.2904
1607 | 258	323	0.4835
1608 | 258	352	0.4587
1609 | 259	268	0.4778
1610 | 259	272	0.1480
1611 | 259	284	0.1254
1612 | 259	285	0.1686
1613 | 259	286	0.2925
1614 | 259	322	0.6637
1615 | 259	351	0.5186
1616 | 260	267	0.4724
1617 | 260	271	0.1481
1618 | 260	284	0.1549
1619 | 260	285	0.3898
1620 | 260	321	0.6696
1621 | 260	350	0.4933
1622 | 261	270	0.1506
1623 | 261	320	0.6754
1624 | 261	348	0.2245
1625 | 261	349	0.4306
1626 | 262	269	0.1503
1627 | 262	283	0.5249
1628 | 262	319	0.6680
1629 | 262	347	0.2745
1630 | 263	282	0.5251
1631 | 263	318	0.6542
1632 | 263	346	0.2348
1633 | 264	281	0.5218
1634 | 264	317	0.6442
1635 | 264	346	0.5753
1636 | 265	316	0.4044
1637 | 265	318	0.1911
1638 | 265	344	0.1325
1639 | 266	315	0.2707
1640 | 266	317	0.1937
1641 | 266	344	0.6201
1642 | 266	349	0.1703
1643 | 267	278	0.4836
1644 | 267	316	0.1907
1645 | 267	343	0.6162
1646 | 267	348	0.1742
1647 | 268	315	0.1513
1648 | 268	316	0.4888
1649 | 268	342	0.6039
1650 | 269	276	0.4876
1651 | 269	315	0.5846
1652 | 269	341	0.5893
1653 | 269	346	0.1851
1654 | 270	314	0.6253
1655 | 270	340	0.5718
1656 | 270	345	0.1797
1657 | 271	313	0.6394
1658 | 271	344	0.1753
1659 | 272	312	0.6408
1660 | 272	343	0.1693
1661 | 273	282	0.1266
1662 | 273	311	0.6348
1663 | 273	336	0.5352
1664 | 273	342	0.1652
1665 | 274	281	0.1259
1666 | 274	310	0.6287
1667 | 274	335	0.5267
1668 | 274	341	0.1612
1669 | 275	280	0.1157
1670 | 275	309	0.6104
1671 | 275	334	0.5182
1672 | 275	340	0.1471
1673 | 276	308	0.2020
1674 | 276	309	0.1141
1675 | 276	333	0.5088
1676 | 278	337	0.1424
1677 | 279	336	0.1457
1678 | 280	335	0.1307
1679 | 281	289	0.1714
1680 | 281	308	0.7719
1681 | 282	288	0.1712
1682 | 282	307	0.7961
1683 | 283	306	0.7896
1684 | 284	305	0.7828
1685 | 284	346	0.2155
1686 | 285	302	0.1225
1687 | 285	304	0.7742
1688 | 286	301	0.2205
1689 | 286	344	0.2500
1690 | 287	302	0.4072
1691 | 287	343	0.2455
1692 | 288	299	0.7449
1693 | 288	301	0.2077
1694 | 288	342	0.2399
1695 | 289	298	0.7669
1696 | 289	341	0.2341
1697 | 290	297	0.7634
1698 | 290	340	0.2287
1699 | 291	296	0.7379
1700 | 291	339	0.2197
1701 | 292	338	0.2089
1702 | 293	337	0.2030
1703 | 298	333	0.1914
1704 | 299	332	0.1882
1705 | 301	330	0.1848
1706 | 302	329	0.1819
1707 | 303	328	0.1794
1708 | 303	341	0.2057
1709 | 304	327	0.1767
1710 | 304	340	0.2026
1711 | 305	326	0.1742
1712 | 305	338	0.2341
1713 | 306	325	0.1689
1714 | 306	337	0.2425
1715 | 307	336	0.3177
1716 | 308	323	0.1309
1717 | 308	335	0.2980
1718 | 308	336	0.1359
1719 | 308	342	0.1271
1720 | 309	335	0.1151
1721 | 309	341	0.1246
1722 | 310	332	0.8187
1723 | 310	340	0.1177
1724 | 311	331	0.8100
1725 | 311	338	0.1012
1726 | 312	322	0.1608
1727 | 312	330	0.7985
1728 | 312	361	0.2602
1729 | 313	321	0.1607
1730 | 313	329	0.7868
1731 | 313	360	0.1996
1732 | 314	320	0.1592
1733 | 314	328	0.7773
1734 | 314	359	0.1689
1735 | 315	319	0.1561
1736 | 315	327	0.7662
1737 | 315	332	0.1012
1738 | 315	358	0.1454
1739 | 316	326	0.7528
1740 | 317	325	0.7430
1741 | 317	354	0.1010
1742 | 318	324	0.7329
1743 | 319	323	0.4464
1744 | 320	353	0.1220
1745 | 321	352	0.1182
1746 | 323	350	0.2078
1747 | 324	349	0.3066
1748 | 325	348	0.3353
1749 | 327	346	0.4853
1750 | 328	345	0.4762
1751 | 329	344	0.5723
1752 | 330	343	0.5674
1753 | 330	344	0.1310
1754 | 331	342	0.5570
1755 | 331	343	0.1323
1756 | 332	341	0.5435
1757 | 332	342	0.1321
1758 | 333	341	0.1293
1759 | 340	359	0.8187
1760 | 341	358	0.7120
1761 | 342	357	0.6354
1762 | 343	354	0.3905
1763 | 343	355	0.2281
1764 | 344	353	0.4835
1765 | 344	354	0.1711
1766 | 345	352	0.4907
1767 | 345	359	0.2303
1768 | 346	351	0.4709
1769 | 346	357	0.2970
1770 | 346	358	0.1768
1771 | 347	356	0.2915
1772 | 347	359	0.3459
1773 | 348	355	0.2722
1774 | 348	358	0.3004
1775 | 349	354	0.2445
1776 | 349	357	0.2696
1777 | 350	356	0.2437
1778 | 351	359	0.1083
1779 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/positives.con:
--------------------------------------------------------------------------------
  1 | >CLIP_0000001
  2 | 1	0.001	0.885
  3 | 2	0	0.025
  4 | 3	0	-0.388
  5 | 4	0.003	0.284
  6 | 5	0	-0.822
  7 | 6	0	0.168
  8 | 7	0	0.477
  9 | 8	0	-0.07
 10 | 9	0	0.013
 11 | 10	0	-0.177
 12 | 11	0	-0.861
 13 | 12	0	0.306
 14 | 13	0	-0.164
 15 | 14	0	-0.299
 16 | 15	0.001	1.155
 17 | 16	0.001	-0.021
 18 | 17	0	-1.02
 19 | 18	0.001	0.272
 20 | 19	0.002	0.585
 21 | 20	0.001	-0.116
 22 | 21	0.003	1.826
 23 | 22	0	-0.582
 24 | 23	0	0.042
 25 | 24	0	0.146
 26 | 25	0	-0.041
 27 | 26	0.003	0.163
 28 | 27	0.01	0.793
 29 | 28	0.011	-0.031
 30 | 29	0.027	2.031
 31 | 30	0.002	-0.014
 32 | 31	0	-0.536
 33 | 32	0.001	0.85
 34 | 33	0	-0.201
 35 | 34	0	-0.254
 36 | 35	0.001	0.682
 37 | 36	0	0.282
 38 | 37	0	-1.049
 39 | 38	0	0.038
 40 | 39	0	-0.309
 41 | 40	0.002	0.512
 42 | 41	0.001	0.246
 43 | 42	0	-0.31
 44 | 43	0.01	0.675
 45 | 44	0.006	-0.938
 46 | 45	0.008	0.055
 47 | 46	0.009	0.055
 48 | 47	0.009	0.055
 49 | 48	0.01	0.055
 50 | 49	0.01	0.145
 51 | 50	0.009	0.153
 52 | 51	0.008	0.254
 53 | 52	0.006	0.261
 54 | 53	0.003	-0.51
 55 | 54	0.002	-0.51
 56 | 55	0.002	-1.057
 57 | 56	0	-0.121
 58 | 57	0.001	0.651
 59 | 58	0	-2.419
 60 | 59	0	-1.172
 61 | 60	0.002	-0.074
 62 | 61	0.02	2.531
 63 | 62	0.013	-0.429
 64 | 63	0.052	1.886
 65 | 64	0.047	0.246
 66 | 65	0.001	-0.178
 67 | 66	0	-0.634
 68 | 67	0	0.413
 69 | 68	0	-0.702
 70 | 69	0	-0.586
 71 | 70	0	-0.924
 72 | 71	0	-0.021
 73 | 72	0	-0.064
 74 | 73	0	-2.023
 75 | 74	0	0.006
 76 | 75	0.001	0.61
 77 | 76	0.001	0.463
 78 | 77	0	-0.447
 79 | 78	0	-0.545
 80 | 79	0.001	0.456
 81 | 80	0	-0.221
 82 | 81	0	-0.288
 83 | 82	0.002	-0.02
 84 | 83	0.007	2.362
 85 | 84	0	-1.272
 86 | 85	0	-0.056
 87 | 86	0.001	-0.07
 88 | 87	0.003	0.8
 89 | 88	0	-2.114
 90 | 89	0	-0.159
 91 | 90	0.002	0.121
 92 | 91	0.006	0.556
 93 | 92	0.007	0.693
 94 | 93	0.007	0.826
 95 | 94	0	-1.12
 96 | 95	0	-0.308
 97 | 96	0	-1.861
 98 | 97	0.02	0.51
 99 | 98	0.029	0.265
100 | 99	0.042	2.029
101 | 100	0.037	0.881
102 | 101	0.014	-0.051
103 | 102	0.001	-0.581
104 | 103	0	-1.109
105 | 104	0.001	0.322
106 | 105	0.001	0.253
107 | 106	0.001	0.102
108 | 107	0	-0.029
109 | 108	0	-0.238
110 | 109	0	-1.159
111 | 110	0	-4.994
112 | 111	0	-2.867
113 | 112	0	-0.514
114 | 113	0	-0.943
115 | 114	0	-0.12
116 | 115	0	0.44
117 | 116	0	-0.286
118 | 117	0	-0.109
119 | 118	0	-1.768
120 | 119	0	-0.593
121 | 120	0	-0.436
122 | 121	0	-0.513
123 | 122	0	-0.553
124 | 123	0.004	0.212
125 | 124	0.008	0.24
126 | 125	0.01	0.717
127 | 126	0.005	-0.121
128 | 127	0.002	-0.725
129 | 128	0	-1.092
130 | 129	0	-0.289
131 | 130	0	-1.007
132 | 131	0	-1.305
133 | 132	0	-0.206
134 | 133	0	0.052
135 | 134	0	-0.215
136 | 135	0	-1.421
137 | 136	0	-0.73
138 | 137	0	0.29
139 | 138	0	-0.244
140 | 139	0	-0.462
141 | 140	0	-0.188
142 | 141	0	-2.198
143 | 142	0	-1.756
144 | 143	0	-2.305
145 | 144	0	-0.856
146 | 145	0.001	0.612
147 | 146	0.002	-0.064
148 | 147	0.009	1.771
149 | 148	0	-2.318
150 | 149	0	-0.443
151 | 150	0	0.175
152 | 151	0	0.329
153 | 152	0	-1.491
154 | 153	0	-0.113
155 | 154	0	-0.555
156 | 155	0	-1.417
157 | 156	0	-0.006
158 | 157	0	-0.319
159 | 158	0	0.175
160 | 159	0	-0.83
161 | 160	0.001	-0.015
162 | 161	0.002	-0.623
163 | 162	0.057	1.208
164 | 163	0.075	1.216
165 | 164	0.073	-0.154
166 | 165	0.077	0.489
167 | 166	0.076	0.651
168 | 167	0.067	-0.07
169 | 168	0.066	0.204
170 | 169	0.066	1.144
171 | 170	0.012	0.199
172 | 171	0	-0.527
173 | 172	0	-0.257
174 | 173	0	0.058
175 | 174	0	-0.195
176 | 175	0	-3.504
177 | 176	0.044	2.417
178 | 177	0.04	0.734
179 | 178	0.022	0.11
180 | 179	0.015	0.173
181 | 180	0	-0.312
182 | 181	0	-0.212
183 | 182	0	-2.236
184 | 183	0	0.092
185 | 184	0.001	0.539
186 | 185	0	0.237
187 | 186	0	-0.6
188 | 187	0	-0.16
189 | 188	0	-1.018
190 | 189	0	-0.279
191 | 190	0.013	0.56
192 | 191	0.02	0.76
193 | 192	0	-0.653
194 | 193	0	-0.009
195 | 194	0	-0.21
196 | 195	0	-0.585
197 | 196	0	0.164
198 | 197	0	-0.307
199 | 198	0.001	0.84
200 | 199	0	-0.252
201 | 200	0	-0.955
202 | 201	0.001	-0.036
203 | 202	0.022	0.335
204 | 203	0.062	1.302
205 | 204	0.061	1.343
206 | 205	0.008	-0.065
207 | 206	0.005	0.656
208 | 207	0	-0.34
209 | 208	0	-0.221
210 | 209	0	-0.626
211 | 210	0	-0.994
212 | 211	0	-0.277
213 | 212	0	-0.081
214 | 213	0	-2.719
215 | 214	0	0.047
216 | 215	0	-0.894
217 | 216	0	0.106
218 | 217	0	-0.073
219 | 218	0	0.569
220 | 219	0	-0.149
221 | 220	0.004	0.538
222 | 221	0.006	0.871
223 | 222	0	-0.454
224 | 223	0	-0.63
225 | 224	0	-0.646
226 | 225	0	-0.105
227 | 226	0	-0.323
228 | 227	0	-0.15
229 | 228	0	-0.207
230 | 229	0.002	1.092
231 | 230	0	-0.919
232 | 231	0.005	2.271
233 | 232	0.001	0.322
234 | 233	0	-0.464
235 | 234	0.001	0.33
236 | 235	0.001	0.363
237 | 236	0	-0.873
238 | 237	0	0.096
239 | 238	0	0.095
240 | 239	0	0.077
241 | 240	0	-0.23
242 | 241	0	-0.309
243 | 242	0	0.288
244 | 243	0	0.339
245 | 244	0	-0.188
246 | 245	0	-1.03
247 | 246	0.001	0.075
248 | 247	0	-1.197
249 | 248	0	-0.813
250 | 249	0	-2.185
251 | 250	0	-1.711
252 | 251	0.001	-0.069
253 | 252	0.013	1.699
254 | 253	0.008	0.24
255 | 254	0.007	0.531
256 | 255	0.002	0.078
257 | 256	0.001	0.433
258 | 257	0	-0.116
259 | 258	0	0.043
260 | 259	0	-0.522
261 | 260	0.013	1.779
262 | 261	0.008	0.526
263 | 262	0.003	0.202
264 | 263	0.001	0.012
265 | 264	0.001	-0.311
266 | 265	0.028	0.2
267 | 266	0.083	1.302
268 | 267	0.085	0.033
269 | 268	0.109	1.908
270 | 269	0.001	-0.278
271 | 270	0	-0.875
272 | 271	0	-1.003
273 | 272	0	-0.356
274 | 273	0.001	-0.343
275 | 274	0.003	1.223
276 | 275	0	-0.203
277 | 276	0	-0.154
278 | 277	0	-0.029
279 | 278	0.001	-0.437
280 | 279	0.007	2.383
281 | 280	0.001	-0.273
282 | 281	0	-0.554
283 | 282	0	-0.841
284 | 283	0	-4.03
285 | 284	0	-1.276
286 | 285	0	0.041
287 | 286	0	-0.018
288 | 287	0	-0.898
289 | 288	0	-0.517
290 | 289	0	0.343
291 | 290	0	-0.491
292 | 291	0	-0.268
293 | 292	0	-0.529
294 | 293	0	-0.158
295 | 294	0	-0.62
296 | 295	0	-0.885
297 | 296	0.002	0.266
298 | 297	0.002	0.469
299 | 298	0.001	0.235
300 | 299	0	-0.586
301 | 300	0	-0.083
302 | 301	0.001	-0.031
303 | 302	0.004	0.765
304 | 303	0.004	-0.122
305 | 304	0.009	0.135
306 | 305	0.016	2.168
307 | 306	0.008	0.037
308 | 307	0.002	0.008
309 | 308	0	-0.863
310 | 309	0.001	0.583
311 | 310	0	-0.042
312 | 311	0	-1.706
313 | 312	0	-0.207
314 | 313	0	-0.018
315 | 314	0	-0.137
316 | 315	0	-0.346
317 | 316	0	-0.477
318 | 317	0	0.031
319 | 318	0.001	0.193
320 | 319	0.001	-0.062
321 | 320	0.002	1.533
322 | 321	0	-1.955
323 | 322	0	-0.173
324 | 323	0	-0.985
325 | 324	0	-0.04
326 | 325	0	-1.04
327 | 326	0	-0.403
328 | 327	0.001	0.073
329 | 328	0.002	1.279
330 | 329	0	-1.286
331 | 330	0	-2.497
332 | 331	0	-0.527
333 | 332	0	0.028
334 | 333	0	-1.388
335 | 334	0	-2.542
336 | 335	0.002	1.57
337 | 336	0.002	-0.143
338 | 337	0.001	0.085
339 | 338	0	-0.832
340 | 339	0	-0.654
341 | 340	0.001	0.192
342 | 341	0	-0.793
343 | 342	0	-0.193
344 | 343	0.001	0.173
345 | 344	0	-1.655
346 | 345	0	-0.015
347 | 346	0	-1.077
348 | 347	0	-0.169
349 | 348	0.002	1.067
350 | 349	0	-0.754
351 | 350	0	-0.154
352 | 351	0	-0.266
353 | 352	0	0.083
354 | 353	0	-0.595
355 | 354	0	-0.516
356 | 355	0	0.019
357 | 356	0	0.019
358 | 357	0	-1.335
359 | 358	0	-1.077
360 | 359	0	-0.73
361 | 360	0	-0.042
362 | 361	0	-0.73
363 | >CLIP_0000002
364 | 1	0	-0.042
365 | 2	0	-0.905
366 | 3	0.008	-0.822
367 | 4	0.031	0.81
368 | 5	0.001	-0.034
369 | 6	0	-0.701
370 | 7	0.001	0.63
371 | 8	0	-0.404
372 | 9	0	-0.976
373 | 10	0	-0.835
374 | 11	0.001	0.898
375 | 12	0	-0.576
376 | 13	0	-0.869
377 | 14	0.099	1.485
378 | 15	0.038	0.12
379 | 16	0.001	-0.145
380 | 17	0	-0.522
381 | 18	0	-4.148
382 | 19	0	0.047
383 | 20	0	-0.315
384 | 21	0	-1.065
385 | 22	0	0.287
386 | 23	0	-2.147
387 | 24	0	-1.229
388 | 25	0.002	1.095
389 | 26	0	0.058
390 | 27	0	0.006
391 | 28	0	0.266
392 | 29	0	-0.788
393 | 30	0	-1.213
394 | 31	0	-0.196
395 | 32	0	-0.43
396 | 33	0	-2.048
397 | 34	0	-0.14
398 | 35	0	-0.036
399 | 36	0	-0.663
400 | 37	0	-0.334
401 | 38	0	-3.165
402 | 39	0	-0.18
403 | 40	0	-0.129
404 | 41	0	-0.285
405 | 42	0.038	-0.552
406 | 43	0.824	1.331
407 | 44	0.876	1.932
408 | 45	0.855	1.768
409 | 46	0.008	-0.178
410 | 47	0.001	0.027
411 | 48	0	-0.268
412 | 49	0	-0.69
413 | 50	0.003	0.971
414 | 51	0	-2.757
415 | 52	0.008	0.869
416 | 53	0.009	0.392
417 | 54	0.012	1.307
418 | 55	0.003	-0.588
419 | 56	0.034	2.033
420 | 57	0.022	0.643
421 | 58	0.006	0.286
422 | 59	0	-1.536
423 | 60	0.03	1.672
424 | 61	0.025	0.407
425 | 62	0.025	0.711
426 | 63	0.019	0.718
427 | 64	0.002	0.023
428 | 65	0	-0.119
429 | 66	0	-0.739
430 | 67	0.016	-0.07
431 | 68	0.297	0.389
432 | 69	0.611	0.659
433 | 70	0.733	0.414
434 | 71	0.912	1.483
435 | 72	0.936	1.142
436 | 73	0.94	0.197
437 | 74	0.967	0.804
438 | 75	0.975	1.086
439 | 76	0.976	1.54
440 | 77	0.939	1.108
441 | 78	0.384	0.568
442 | 79	0.002	-0.574
443 | 80	0	0.085
444 | 81	0	0.124
445 | 82	0	-0.516
446 | 83	0	-0.755
447 | 84	0	-0.186
448 | 85	0	-0.419
449 | 86	0	-1.436
450 | 87	0	-0.873
451 | 88	0	-1.431
452 | 89	0.002	1.122
453 | 90	0	0.338
454 | 91	0	-0.156
455 | 92	0	-0.419
456 | 93	0	-0.273
457 | 94	0.001	0.654
458 | 95	0	0.217
459 | 96	0	0.124
460 | 97	0	0.334
461 | 98	0	0.058
462 | 99	0	-0.522
463 | 100	0.001	0.765
464 | 101	0	0.106
465 | 102	0	-0.421
466 | 103	0	-0.273
467 | 104	0	-0.214
468 | 105	0.001	0.375
469 | 106	0	-0.43
470 | 107	0	-1.167
471 | 108	0	-0.167
472 | 109	0	-0.049
473 | 110	0.001	0.767
474 | 111	0	-0.021
475 | 112	0	-0.253
476 | 113	0.002	0.575
477 | 114	0	-0.039
478 | 115	0	-0.064
479 | 116	0	0.169
480 | 117	0	0.155
481 | 118	0	-0.477
482 | 119	0	0.206
483 | 120	0	-1.106
484 | 121	0.067	1.567
485 | 122	0.069	0.943
486 | 123	0.061	1.067
487 | 124	0.001	-0.346
488 | 125	0	0.088
489 | 126	0	0.027
490 | 127	0	-0.307
491 | 128	0	-0.254
492 | 129	0	-1.547
493 | 130	0.966	2.334
494 | 131	0.973	1.681
495 | 132	0.914	0.626
496 | 133	0.881	0.727
497 | 134	0.842	0.592
498 | 135	0.803	2.141
499 | 136	0.033	-0.101
500 | 137	0.01	0.165
501 | 138	0.003	0.137
502 | 139	0	-1.726
503 | 140	0.855	0.625
504 | 141	0.937	1.68
505 | 142	0.937	1.686
506 | 143	0.828	1.029
507 | 144	0	-0.516
508 | 145	0	-1.062
509 | 146	0.001	0.078
510 | 147	0.011	0.327
511 | 148	0.019	0.3
512 | 149	0.037	2.455
513 | 150	0	0.089
514 | 151	0.012	0.4
515 | 152	0.014	-0.121
516 | 153	0.035	2.224
517 | 154	0.004	0.125
518 | 155	0.001	-0.36
519 | 156	0	-0.078
520 | 157	0	-0.128
521 | 158	0	-1.04
522 | 159	0	-0.637
523 | 160	0	-0.143
524 | 161	0	-1.073
525 | 162	0	-1.335
526 | 163	0	-0.665
527 | 164	0	0.211
528 | 165	0	-1.316
529 | 166	0	-0.286
530 | 167	0	-0.759
531 | 168	0	-1.05
532 | 169	0.001	0.99
533 | 170	0	-1.992
534 | 171	0	-1.379
535 | 172	0	0.203
536 | 173	0	-1.536
537 | 174	0	-0.911
538 | 175	0	-0.579
539 | 176	0	0.414
540 | 177	0	-2.395
541 | 178	0	-0.597
542 | 179	0	0.401
543 | 180	0	-1.253
544 | 181	0.001	0.805
545 | 182	0.001	0.461
546 | 183	0	-0.525
547 | 184	0	-1.16
548 | 185	0.006	0.197
549 | 186	0.008	0.286
550 | 187	0.014	1.048
551 | 188	0.011	0.755
552 | 189	0	-0.742
553 | 190	0.003	0.622
554 | 191	0.005	0.636
555 | 192	0	-0.335
556 | 193	0	-0.267
557 | 194	0	-1.716
558 | 195	0	-2.641
559 | 196	0.001	-0.034
560 | 197	0.034	0.809
561 | 198	0.045	1.1
562 | 199	0	-0.918
563 | 200	0	-1.013
564 | 201	0	-0.763
565 | 202	0	-1.231
566 | 203	0	-0.668
567 | 204	0	0.219
568 | 205	0	-0.408
569 | 206	0	-0.008
570 | 207	0.007	0.207
571 | 208	0.003	0.594
572 | 209	0	-0.336
573 | 210	0	0.051
574 | 211	0	-0.231
575 | 212	0	0.066
576 | 213	0	-0.713
577 | 214	0.001	0.189
578 | 215	0.002	0.095
579 | 216	0.001	0.081
580 | 217	0	-0.524
581 | 218	0.001	-0.683
582 | 219	0.291	1.142
583 | 220	0.37	0.8
584 | 221	0.389	2.12
585 | 222	0.278	0.75
586 | 223	0.06	0.214
587 | 224	0.008	-0.068
588 | 225	0.003	0.283
589 | 226	0	-0.471
590 | 227	0	0.127
591 | 228	0	-0.761
592 | 229	0	-2.246
593 | 230	0	-0.138
594 | 231	0.005	1.456
595 | 232	0.001	0.142
596 | 233	0.001	0.318
597 | 234	0.001	-0.672
598 | 235	0.111	4.02
599 | 236	0.038	0.369
600 | 237	0.002	-0.19
601 | 238	0.002	0.426
602 | 239	0.001	0.584
603 | 240	0.001	0.283
604 | 241	0	-0.247
605 | 242	0.136	2.022
606 | 243	0.083	0.162
607 | 244	0.001	-1.029
608 | 245	0.232	2.434
609 | 246	0	0.126
610 | 247	0	-1.05
611 | 248	0.262	0.876
612 | 249	0.275	0.205
613 | 250	0.327	0.591
614 | 251	0.358	1.732
615 | 252	0.303	0.398
616 | 253	0.277	0.946
617 | 254	0.213	0.319
618 | 255	0.008	0.308
619 | 256	0	-1.461
620 | 257	0	0.058
621 | 258	0.003	0.769
622 | 259	0	-0.423
623 | 260	0.001	0.193
624 | 261	0	-0.073
625 | 262	0	-0.315
626 | 263	0	-3.398
627 | 264	0	-0.126
628 | 265	0	-0.38
629 | 266	0.015	1.765
630 | 267	0.001	0.004
631 | 268	0.002	0.407
632 | 269	0.554	1.231
633 | 270	0.556	0.21
634 | 271	0.576	0.474
635 | 272	0.599	1.152
636 | 273	0.583	1.568
637 | 274	0.161	0.154
638 | 275	0	-0.226
639 | 276	0	-3.478
640 | 277	0	0.045
641 | 278	0	-1.253
642 | 279	0	-0.399
643 | 280	0	-0.127
644 | 281	0	-0.259
645 | 282	0	-0.619
646 | 283	0	-1.361
647 | 284	0	-1.47
648 | 285	0	-0.076
649 | 286	0	0.667
650 | 287	0	-0.013
651 | 288	0	-0.058
652 | 289	0	-0.132
653 | 290	0.001	0.646
654 | 291	0	-1.077
655 | 292	0	-0.93
656 | 293	0	-0.147
657 | 294	0	0.283
658 | 295	0	-2.675
659 | 296	0	-0.164
660 | 297	0.019	2.01
661 | 298	0.007	0.484
662 | 299	0	-1.659
663 | 300	0.002	0.609
664 | 301	0	-0.917
665 | 302	0	-1.318
666 | 303	0.004	0.692
667 | 304	0	-2.132
668 | 305	0	-0.103
669 | 306	0	-0.573
670 | 307	0	-1.787
671 | 308	0	-0.01
672 | 309	0	0.116
673 | 310	0	-0.212
674 | 311	0	-1.019
675 | 312	0	-0.021
676 | 313	0	-0.211
677 | 314	0.001	0.413
678 | 315	0	-0.139
679 | 316	0	-0.858
680 | 317	0	-0.321
681 | 318	0	-1.413
682 | 319	0.002	1.051
683 | 320	0	0.192
684 | 321	0	-2.138
685 | 322	0	-0.302
686 | 323	0.001	0.209
687 | 324	0	-0.092
688 | 325	0	-0.302
689 | 326	0	0.518
690 | 327	0	0.095
691 | 328	0	-0.337
692 | 329	0	-0.801
693 | 330	0.001	0.366
694 | 331	0	-0.248
695 | 332	0.002	0.574
696 | 333	0.003	0.656
697 | 334	0.001	0.191
698 | 335	0.002	0.25
699 | 336	0.003	0.443
700 | 337	0	-1.432
701 | 338	0.001	0.606
702 | 339	0	-0.039
703 | 340	0.001	0.97
704 | 341	0	-0.704
705 | 342	0	-0.743
706 | 343	0	-0.617
707 | 344	0	-0.493
708 | 345	0	-1.472
709 | 346	0	-0.867
710 | 347	0.059	0.361
711 | 348	0.18	0.643
712 | 349	0.991	1.141
713 | 350	0.994	1.526
714 | 351	0.991	1.697
715 | 352	0.901	0.068
716 | 353	0.887	0.85
717 | 354	0.829	0.297
718 | 355	0.802	1.476
719 | 356	0.612	0.446
720 | 357	0.398	0.001
721 | 358	0.393	1.265
722 | 359	0.27	0.361
723 | 360	0	-0.554
724 | 361	0.001	0.631
725 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/positives.entr:
--------------------------------------------------------------------------------
1 | id	avg_rbpc	avg_cov	entr
2 | CLIP_0000001	0.0381165919282511	6.93251991540603	2.91636117977064
3 | CLIP_0000002	0.0986547085201793	9.40589762432022	4.63970283907066
4 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/positives.fa:
--------------------------------------------------------------------------------
1 | >CLIP_0000001
2 | ctgggtgacttactcaggtttctccatcgttttcccactagggctttttttttttttttttttttttttaaacagttacttcgagcattccagccggcctggcctggccagcagagcgttctcactgtcacccttaccccactcactttcATTCAGTTCACAGATTGCCTGCCCTGGGCTGTGGGCTTGGTGACATCCTAAAGGGACTAAGgtaaagagatgtgggggtttcttgtttgggtcaagcctcagctagacagagaaggggccacagctgtgactgcagttgggtggcagctcagagggagagtaagacggtgcatgtggccgggtacagtggctcacgcctgtaatcccaaca
3 | >CLIP_0000002
4 | cgagggctccacaggccgtgcctggccatgctctccctgtcgggggtccttgcgcgcttgaggaccaggccacgaggtttgccgatctgtgttgcagaaccggcgggcagcttcgccatatctcgttcggggacactttggggttgggggTTTTCTGCTGACTGTGTTCCAGGGCGCGAAGGTGGTGTCGCTTGGGGGGGCCGGGACCAGAtctgtccaggcctggccggggaaggtgggcgcggcagagggcttcagctgcggggaggtggggtcgtgaccggggaggcttcttagccgctgcccgggccctgctccgcagtggggcgggggatcggagcctcgcgttagtggatggcag
5 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/positives.sf:
--------------------------------------------------------------------------------
1 | id	a	c	g	t	at	ags	cts	gcs	gts	ks	ps	cpg	ce	cz	lct1	lct2	lct3
2 | CLIP_0000001	0.213114754098361	0.229508196721311	0.295081967213115	0.262295081967213	0.475409836065574	-0.161290322580645	-0.0666666666666667	-0.125	0.0588235294117647	0.114754098360656	0.0163934426229508	0	0.994324937055195	0.491935483870968	1	0.9375	0.572033898305085
3 | CLIP_0000002	0.114754098360656	0.213114754098361	0.426229508196721	0.245901639344262	0.360655737704918	-0.575757575757576	-0.0714285714285714	-0.333333333333333	0.268292682926829	0.344262295081967	0.0819672131147541	0.131147540983607	0.927893321272971	0.491935483870968	1	0.875	0.519067796610169
4 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/positives.up:
--------------------------------------------------------------------------------
  1 | >CLIP_0000001
  2 | 1	0.1132637
  3 | 2	0.009074526
  4 | 3	0.001474107
  5 | 4	0.00083792
  6 | 5	0.005569934
  7 | 6	0.02338582
  8 | 7	0.08228648
  9 | 8	0.1537025
 10 | 9	0.3248531
 11 | 10	0.3772946
 12 | 11	0.3827209
 13 | 12	0.5965096
 14 | 13	0.8252077
 15 | 14	0.8342129
 16 | 15	0.712054
 17 | 16	0.1521305
 18 | 17	0.1273786
 19 | 18	0.1362242
 20 | 19	0.2312455
 21 | 20	0.7466383
 22 | 21	0.8038445
 23 | 22	0.8619737
 24 | 23	0.4644667
 25 | 24	0.4953313
 26 | 25	0.5039586
 27 | 26	0.5453085
 28 | 27	0.9199201
 29 | 28	0.8634082
 30 | 29	0.8666431
 31 | 30	0.8892989
 32 | 31	0.9377045
 33 | 32	0.9613061
 34 | 33	0.1760916
 35 | 34	0.1440123
 36 | 35	0.1431093
 37 | 36	0.1502738
 38 | 37	0.1955326
 39 | 38	0.9676392
 40 | 39	0.8397812
 41 | 40	0.03928555
 42 | 41	0.02155061
 43 | 42	0.0186039
 44 | 43	0.03040555
 45 | 44	0.0808085
 46 | 45	0.9147374
 47 | 46	0.9281922
 48 | 47	0.941499
 49 | 48	0.9718084
 50 | 49	0.9726181
 51 | 50	0.9749937
 52 | 51	0.978448
 53 | 52	0.9774263
 54 | 53	0.97494
 55 | 54	0.9719632
 56 | 55	0.9674495
 57 | 56	0.9618186
 58 | 57	0.9566381
 59 | 58	0.9415386
 60 | 59	0.9240645
 61 | 60	0.9073189
 62 | 61	0.8909262
 63 | 62	0.8757979
 64 | 63	0.8924943
 65 | 64	0.9029947
 66 | 65	0.9389295
 67 | 66	0.9634906
 68 | 67	0.989508
 69 | 68	0.9855148
 70 | 69	0.8033434
 71 | 70	0.7931939
 72 | 71	0.3570529
 73 | 72	0.3034771
 74 | 73	0.3051202
 75 | 74	0.3090184
 76 | 75	0.315209
 77 | 76	0.3261837
 78 | 77	0.3859434
 79 | 78	0.7910875
 80 | 79	0.8132241
 81 | 80	0.961219
 82 | 81	0.9608871
 83 | 82	0.07105951
 84 | 83	0.04562111
 85 | 84	0.02972527
 86 | 85	0.03313
 87 | 86	0.04034405
 88 | 87	0.05418164
 89 | 88	0.1344679
 90 | 89	0.1161701
 91 | 90	0.1061408
 92 | 91	0.114548
 93 | 92	0.0152915
 94 | 93	0.01294858
 95 | 94	0.01332824
 96 | 95	0.001292915
 97 | 96	0.0008442121
 98 | 97	0.005219625
 99 | 98	0.009045591
100 | 99	0.01024872
101 | 100	0.0109491
102 | 101	0.9215416
103 | 102	0.913031
104 | 103	0.9056885
105 | 104	0.9004127
106 | 105	0.03884343
107 | 106	0.002430802
108 | 107	0.002389267
109 | 108	0.01367174
110 | 109	0.05219642
111 | 110	0.01678701
112 | 111	0.01952243
113 | 112	0.01940334
114 | 113	0.008655543
115 | 114	0.02446356
116 | 115	0.01919789
117 | 116	0.05758215
118 | 117	0.07872809
119 | 118	0.2067933
120 | 119	0.2055038
121 | 120	0.1292559
122 | 121	0.1617614
123 | 122	0.148998
124 | 123	0.3750283
125 | 124	0.3338905
126 | 125	0.2978471
127 | 126	0.2503499
128 | 127	0.2564189
129 | 128	0.2771204
130 | 129	0.4145146
131 | 130	0.6737869
132 | 131	0.5980946
133 | 132	0.6055971
134 | 133	0.6103883
135 | 134	0.7445528
136 | 135	0.7404973
137 | 136	0.4405297
138 | 137	0.3017196
139 | 138	0.299689
140 | 139	0.3162012
141 | 140	0.3130792
142 | 141	0.3695617
143 | 142	0.411314
144 | 143	0.440484
145 | 144	0.5355261
146 | 145	0.4982557
147 | 146	0.5454128
148 | 147	0.5709188
149 | 148	0.4119498
150 | 149	0.3646228
151 | 150	0.3670238
152 | 151	0.3753178
153 | 152	0.3811081
154 | 153	0.2375451
155 | 154	0.135913
156 | 155	0.1190919
157 | 156	0.1236601
158 | 157	0.1024292
159 | 158	0.1031423
160 | 159	0.1819453
161 | 160	0.2315644
162 | 161	0.2304535
163 | 162	0.07556254
164 | 163	0.07321135
165 | 164	0.41753
166 | 165	0.6477649
167 | 166	0.2916197
168 | 167	0.1035282
169 | 168	0.01929465
170 | 169	0.04145831
171 | 170	0.03224867
172 | 171	0.1163466
173 | 172	0.4709971
174 | 173	0.6641935
175 | 174	0.4932901
176 | 175	0.05546995
177 | 176	0.09756164
178 | 177	0.1170544
179 | 178	0.09373348
180 | 179	0.1122407
181 | 180	0.09215082
182 | 181	0.09380458
183 | 182	0.003094801
184 | 183	0.002042966
185 | 184	0.007358544
186 | 185	0.006911216
187 | 186	0.065604
188 | 187	0.1576787
189 | 188	0.0778106
190 | 189	0.09302456
191 | 190	0.02483315
192 | 191	0.08214345
193 | 192	0.1529267
194 | 193	0.20702
195 | 194	0.2532418
196 | 195	0.3038869
197 | 196	0.1688286
198 | 197	0.2097633
199 | 198	0.2047319
200 | 199	0.2604637
201 | 200	0.4079587
202 | 201	0.7966812
203 | 202	0.2599345
204 | 203	0.09947444
205 | 204	0.06460988
206 | 205	0.04996038
207 | 206	0.0470485
208 | 207	0.1355551
209 | 208	0.3204869
210 | 209	0.387661
211 | 210	0.4974323
212 | 211	0.3687194
213 | 212	0.387146
214 | 213	0.4440538
215 | 214	0.3061378
216 | 215	0.3390534
217 | 216	0.3034699
218 | 217	0.3139627
219 | 218	0.2641477
220 | 219	0.2342705
221 | 220	0.1363674
222 | 221	0.07683787
223 | 222	0.05729442
224 | 223	0.2900674
225 | 224	0.2975814
226 | 225	0.3482887
227 | 226	0.2320513
228 | 227	0.08014795
229 | 228	0.009644241
230 | 229	0.1999706
231 | 230	0.1651235
232 | 231	0.1466117
233 | 232	0.1352274
234 | 233	0.1268466
235 | 234	0.1044928
236 | 235	0.1223889
237 | 236	0.2414299
238 | 237	0.218121
239 | 238	0.1108315
240 | 239	0.1442604
241 | 240	0.04344815
242 | 241	0.07396111
243 | 242	0.08192872
244 | 243	0.1072411
245 | 244	0.2696251
246 | 245	0.1727703
247 | 246	0.1506427
248 | 247	0.1407976
249 | 248	0.1393223
250 | 249	0.6146733
251 | 250	0.540464
252 | 251	0.07944838
253 | 252	0.03514689
254 | 253	0.04121974
255 | 254	0.04101178
256 | 255	0.07097913
257 | 256	0.2562613
258 | 257	0.1072592
259 | 258	0.116023
260 | 259	0.1024713
261 | 260	0.1795061
262 | 261	0.1749156
263 | 262	0.247621
264 | 263	0.1914696
265 | 264	0.2343513
266 | 265	0.1705168
267 | 266	0.09502419
268 | 267	0.1056166
269 | 268	0.001174632
270 | 269	0.001031639
271 | 270	0.001258695
272 | 271	0.03961598
273 | 272	0.1142545
274 | 273	0.06452246
275 | 274	0.09559797
276 | 275	0.08841404
277 | 276	0.03857833
278 | 277	0.03759366
279 | 278	0.04672104
280 | 279	0.06269607
281 | 280	0.4084091
282 | 281	0.4327363
283 | 282	0.05019657
284 | 283	0.01653826
285 | 284	0.3999581
286 | 285	0.4032127
287 | 286	0.4420881
288 | 287	0.4422861
289 | 288	0.4069712
290 | 289	0.07813281
291 | 290	0.01083108
292 | 291	0.05398209
293 | 292	0.03170152
294 | 293	0.02727547
295 | 294	0.1328849
296 | 295	0.1495276
297 | 296	0.03415234
298 | 297	0.01031283
299 | 298	0.007398623
300 | 299	0.00661984
301 | 300	0.09287886
302 | 301	0.4089212
303 | 302	0.8184594
304 | 303	0.7388654
305 | 304	0.7432597
306 | 305	0.6519493
307 | 306	0.6557075
308 | 307	0.4071598
309 | 308	0.3912923
310 | 309	0.2343953
311 | 310	0.3336683
312 | 311	0.3452533
313 | 312	0.3621085
314 | 313	0.6632283
315 | 314	0.6473971
316 | 315	0.3137251
317 | 316	0.2830455
318 | 317	0.2598815
319 | 318	0.1894132
320 | 319	0.1488113
321 | 320	0.1257117
322 | 321	0.6146854
323 | 322	0.4314724
324 | 323	0.4827869
325 | 324	0.4634641
326 | 325	0.4171946
327 | 326	0.03183582
328 | 327	0.01621369
329 | 328	0.0058961
330 | 329	0.005549194
331 | 330	0.006729865
332 | 331	0.1915274
333 | 332	0.4803198
334 | 333	0.441722
335 | 334	0.405319
336 | 335	0.4377516
337 | 336	0.3798482
338 | 337	0.1708563
339 | 338	0.09756025
340 | 339	0.04985982
341 | 340	0.01287929
342 | 341	0.03408909
343 | 342	0.03333032
344 | 343	0.08069263
345 | 344	0.05908077
346 | 345	0.3411382
347 | 346	0.09507793
348 | 347	0.0450496
349 | 348	0.01967618
350 | 349	0.008201709
351 | 350	0.0117844
352 | 351	0.02490977
353 | 352	0.05642183
354 | 353	0.2360227
355 | 354	0.1110728
356 | 355	0.008863147
357 | 356	0.001003514
358 | 357	0.001256338
359 | 358	0.007752783
360 | 359	0.947672
361 | 360	0.9533998
362 | 361	0.9533998
363 | >CLIP_0000002
364 | 1	0.08864626
365 | 2	0.04364174
366 | 3	0.01433507
367 | 4	0.0179199
368 | 5	0.03535702
369 | 6	0.09984623
370 | 7	0.05274506
371 | 8	0.03035134
372 | 9	0.4920656
373 | 10	0.5129704
374 | 11	0.1187901
375 | 12	0.1453577
376 | 13	0.01302907
377 | 14	0.003414816
378 | 15	0.002221365
379 | 16	0.002735313
380 | 17	0.02164491
381 | 18	0.3033058
382 | 19	0.2154425
383 | 20	0.379595
384 | 21	0.3993408
385 | 22	0.2496909
386 | 23	0.06568144
387 | 24	0.04978214
388 | 25	0.04955523
389 | 26	0.2064406
390 | 27	0.374588
391 | 28	0.4769737
392 | 29	0.58454
393 | 30	0.5850916
394 | 31	0.5969203
395 | 32	0.5669482
396 | 33	0.4195576
397 | 34	0.04669049
398 | 35	0.01360207
399 | 36	0.013317
400 | 37	0.06204502
401 | 38	0.08542369
402 | 39	0.5629674
403 | 40	0.5727751
404 | 41	0.02263836
405 | 42	0.006773044
406 | 43	0.02654163
407 | 44	0.003672895
408 | 45	0.008460017
409 | 46	0.01426129
410 | 47	0.02236168
411 | 48	0.007164311
412 | 49	0.008053694
413 | 50	0.01003641
414 | 51	0.008997697
415 | 52	0.02023941
416 | 53	0.4109969
417 | 54	0.6585458
418 | 55	0.6361977
419 | 56	0.6151227
420 | 57	0.6051969
421 | 58	0.371747
422 | 59	0.02003478
423 | 60	0.02459665
424 | 61	0.01822467
425 | 62	0.2984553
426 | 63	0.3022079
427 | 64	0.3100102
428 | 65	0.1225236
429 | 66	0.1341932
430 | 67	0.08741195
431 | 68	0.1932521
432 | 69	0.05298032
433 | 70	0.06853379
434 | 71	0.08921197
435 | 72	0.3221216
436 | 73	0.2860684
437 | 74	0.2936716
438 | 75	0.2397757
439 | 76	0.01413281
440 | 77	0.01354044
441 | 78	0.01733445
442 | 79	0.06470916
443 | 80	0.01725937
444 | 81	0.006103408
445 | 82	0.01447965
446 | 83	0.01708829
447 | 84	0.02728938
448 | 85	0.01952686
449 | 86	0.00372886
450 | 87	0.006212252
451 | 88	0.01205689
452 | 89	0.02059776
453 | 90	0.007921465
454 | 91	0.1244683
455 | 92	0.9281764
456 | 93	0.1321241
457 | 94	0.02924363
458 | 95	0.04951179
459 | 96	0.06094603
460 | 97	0.09092263
461 | 98	0.09983349
462 | 99	0.07451973
463 | 100	0.07090742
464 | 101	0.03823456
465 | 102	0.03263343
466 | 103	0.03053843
467 | 104	0.02472878
468 | 105	0.02027605
469 | 106	0.04209581
470 | 107	0.07220385
471 | 108	0.05885833
472 | 109	0.05373158
473 | 110	0.2001347
474 | 111	0.197005
475 | 112	0.2117958
476 | 113	0.2028122
477 | 114	0.01074958
478 | 115	0.006015542
479 | 116	0.007735377
480 | 117	0.02282747
481 | 118	0.04585734
482 | 119	0.3828304
483 | 120	0.1783897
484 | 121	0.08066253
485 | 122	0.07828013
486 | 123	0.05068961
487 | 124	0.02239619
488 | 125	0.02358536
489 | 126	0.04869063
490 | 127	0.09952388
491 | 128	0.0816393
492 | 129	0.01210142
493 | 130	0.005745496
494 | 131	0.009090968
495 | 132	0.02570449
496 | 133	0.04438092
497 | 134	0.05487051
498 | 135	0.05219116
499 | 136	0.06375727
500 | 137	0.07121605
501 | 138	0.8717022
502 | 139	0.8452023
503 | 140	0.8310592
504 | 141	0.03330473
505 | 142	0.01690013
506 | 143	0.01967417
507 | 144	0.01866458
508 | 145	0.01608228
509 | 146	0.01547095
510 | 147	0.01907624
511 | 148	0.02873947
512 | 149	0.05813546
513 | 150	0.06608159
514 | 151	0.08558009
515 | 152	0.9545637
516 | 153	0.942311
517 | 154	0.05486768
518 | 155	0.04660503
519 | 156	0.01854812
520 | 157	0.01383036
521 | 158	0.01733322
522 | 159	0.01274791
523 | 160	0.02276957
524 | 161	0.02080408
525 | 162	0.03131954
526 | 163	0.02712704
527 | 164	0.04852702
528 | 165	0.1110937
529 | 166	0.06021122
530 | 167	0.037061
531 | 168	0.005500478
532 | 169	0.003235088
533 | 170	0.005052581
534 | 171	0.01259562
535 | 172	0.01479566
536 | 173	0.006313901
537 | 174	0.005774189
538 | 175	0.00461622
539 | 176	0.006794857
540 | 177	0.01227423
541 | 178	0.03557373
542 | 179	0.2322458
543 | 180	0.2612514
544 | 181	0.2726107
545 | 182	0.2012755
546 | 183	0.1972362
547 | 184	0.05450502
548 | 185	0.04618117
549 | 186	0.1274639
550 | 187	0.09299857
551 | 188	0.02071831
552 | 189	0.03771661
553 | 190	0.002468393
554 | 191	0.01545893
555 | 192	0.007440572
556 | 193	0.06829891
557 | 194	0.1736896
558 | 195	0.3973171
559 | 196	0.3889605
560 | 197	0.2767223
561 | 198	0.1152426
562 | 199	0.09024519
563 | 200	0.014108
564 | 201	0.01031842
565 | 202	0.01283983
566 | 203	0.01672361
567 | 204	0.0470179
568 | 205	0.05683292
569 | 206	0.04660035
570 | 207	0.04357871
571 | 208	0.04417672
572 | 209	0.4502948
573 | 210	0.5856441
574 | 211	0.6073425
575 | 212	0.6457911
576 | 213	0.6237298
577 | 214	0.193401
578 | 215	0.1403108
579 | 216	0.1295373
580 | 217	0.07882427
581 | 218	0.07965112
582 | 219	0.03100182
583 | 220	0.005071266
584 | 221	0.001135619
585 | 222	0.0005574937
586 | 223	0.001525437
587 | 224	0.06858073
588 | 225	0.02820052
589 | 226	0.01554641
590 | 227	0.003611382
591 | 228	0.002655904
592 | 229	0.003222071
593 | 230	0.4607663
594 | 231	0.4706654
595 | 232	0.5591861
596 | 233	0.5319066
597 | 234	0.3151054
598 | 235	0.3544809
599 | 236	0.171066
600 | 237	0.1259608
601 | 238	0.1043987
602 | 239	0.1325497
603 | 240	0.01028639
604 | 241	0.01722932
605 | 242	0.001710461
606 | 243	0.01290163
607 | 244	0.004426815
608 | 245	0.05114073
609 | 246	0.05196682
610 | 247	0.0730529
611 | 248	0.3004998
612 | 249	0.2258052
613 | 250	0.180169
614 | 251	0.2137332
615 | 252	0.2554025
616 | 253	0.1735915
617 | 254	0.05833584
618 | 255	0.04626378
619 | 256	0.1002623
620 | 257	0.1024123
621 | 258	0.1508598
622 | 259	0.09429901
623 | 260	0.08631173
624 | 261	0.02375135
625 | 262	0.2358
626 | 263	0.2283151
627 | 264	0.2658243
628 | 265	0.2930665
629 | 266	0.2069147
630 | 267	0.1158727
631 | 268	0.068501
632 | 269	0.03970749
633 | 270	0.03227395
634 | 271	0.2629315
635 | 272	0.2706266
636 | 273	0.2717301
637 | 274	0.2575488
638 | 275	0.01491965
639 | 276	0.01907078
640 | 277	0.2410147
641 | 278	0.525586
642 | 279	0.5231536
643 | 280	0.1016666
644 | 281	0.05966959
645 | 282	0.04644402
646 | 283	0.0398184
647 | 284	0.1060278
648 | 285	0.09853777
649 | 286	0.1150624
650 | 287	0.07219886
651 | 288	0.04037848
652 | 289	0.02217677
653 | 290	0.01553303
654 | 291	0.01804998
655 | 292	0.04712342
656 | 293	0.5841206
657 | 294	0.5969192
658 | 295	0.09826348
659 | 296	0.03746811
660 | 297	0.009696454
661 | 298	0.001801887
662 | 299	0.00127537
663 | 300	0.001434376
664 | 301	0.3838779
665 | 302	0.3858973
666 | 303	0.01772229
667 | 304	0.006835213
668 | 305	0.0003794622
669 | 306	0.0004182977
670 | 307	0.001214036
671 | 308	0.07316029
672 | 309	0.02309701
673 | 310	0.02756752
674 | 311	0.0004492934
675 | 312	0.0009835337
676 | 313	0.001854475
677 | 314	0.00313203
678 | 315	0.005667265
679 | 316	0.004958805
680 | 317	0.02610517
681 | 318	0.002838654
682 | 319	0.001659739
683 | 320	0.3126152
684 | 321	0.5142273
685 | 322	0.3373457
686 | 323	0.01345525
687 | 324	0.0127383
688 | 325	0.03862277
689 | 326	0.004758424
690 | 327	0.0006986588
691 | 328	0.0007587924
692 | 329	0.0009305989
693 | 330	0.07025639
694 | 331	0.04038257
695 | 332	0.04018416
696 | 333	0.04646335
697 | 334	0.5283556
698 | 335	0.5418583
699 | 336	0.4826922
700 | 337	0.4773228
701 | 338	0.8327672
702 | 339	0.4054245
703 | 340	0.05485319
704 | 341	0.02515121
705 | 342	0.008214937
706 | 343	0.003562771
707 | 344	0.003648546
708 | 345	0.002556901
709 | 346	0.06328486
710 | 347	0.06640745
711 | 348	0.5097492
712 | 349	0.4914333
713 | 350	0.2995623
714 | 351	0.3430392
715 | 352	0.3823125
716 | 353	0.3092924
717 | 354	0.359895
718 | 355	0.4328364
719 | 356	0.3977562
720 | 357	0.2640137
721 | 358	0.08237274
722 | 359	0.1002992
723 | 360	0.09959237
724 | 361	0.09959237
725 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test.bpp:
--------------------------------------------------------------------------------
1 | >CLIP_01
2 | 80	120	0.11
3 | 110	140	0.22
4 | 130	150	0.33
5 | 160	200	0.44
6 | 240	260	0.55
7 | 270	290	0.66
8 | 280	310	0.77
9 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test.con:
--------------------------------------------------------------------------------
1 | >CLIP_01
2 | 1	0.1	0.3
3 | 2	0.2	-0.4
4 | >CLIP_02
5 | 1	0.4	0.6
6 | 2	0.5	0.7
7 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test.elem_p.str:
--------------------------------------------------------------------------------
1 | >CLIP_01
2 | 0.1	0.2	0.4	0.2	0.1
3 | 0.2	0.3	0.2	0.1	0.2
4 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test.entr:
--------------------------------------------------------------------------------
1 | id	avg_rbpc	avg_cov	entr
2 | CLIP_01	0.03	6.05	3.18
3 | CLIP_02	0.02	4.37	3.27
4 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test.exon_intron_labels:
--------------------------------------------------------------------------------
1 | CLIP1	IIIIIIEEEE
2 | CLIP2	EEEEEIIIIIIIIII
3 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test.fa:
--------------------------------------------------------------------------------
1 | >seq1
2 | acgtACGTacgt
3 | >seq2
4 | tgcaTGCAtgca
5 | ACGTacgt
6 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test.ids:
--------------------------------------------------------------------------------
1 | clip1
2 | clip2
3 | clip3
4 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test.pp.con:
--------------------------------------------------------------------------------
1 | >CLIP_01
2 | 0.1
3 | 0.2
4 | >CLIP_02
5 | 0.4
6 | 0.5
7 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test.region_labels:
--------------------------------------------------------------------------------
1 | CLIP_1	EIIE
2 | CLIP_2	IIII
3 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test.sf:
--------------------------------------------------------------------------------
1 | id	a	c	g	t
2 | CLIP_01	0.2	0.3	0.3	0.2
3 | CLIP_02	0.1	0.2	0.4	0.3
4 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test.sorted.bed:
--------------------------------------------------------------------------------
1 | chr1	1000	2000	r1	1	+
2 | chr1	2000	3000	r2	2	+
3 | chr1	2500	2700	r4	4	+
4 | chr1	5000	6000	r7	3	+
5 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test.sorted.merged.exp.bed:
--------------------------------------------------------------------------------
1 | chr1	1000	3000	r1;r2;r4
2 | chr1	5000	6000	r7
3 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test.str_elem.up:
--------------------------------------------------------------------------------
1 | >CLIP_01
2 | 1	0.9	0.1	0.2	0.4	0.2	0.1
3 | 2	0.8	0.2	0.3	0.2	0.1	0.2
4 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test.tra:
--------------------------------------------------------------------------------
1 | site1	FT
2 | site2	CN
3 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test.up:
--------------------------------------------------------------------------------
1 | >CLIP_01
2 | 1	0.11
3 | 2	0.22
4 | >CLIP_02
5 | 1	0.33
6 | 2	0.44
7 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test1.bed:
--------------------------------------------------------------------------------
1 | chr1	1000	2500	CLIP1	1	+
2 | chr1	3000	4000	CLIP2	0	+
3 | chr1	5000	6000	CLIP3	2	+
4 | chr1	7000	8000	CLIP4	3	+
5 | chr1	9000	10000	CLIP5	1	+
6 | chr1	11000	12000	CLIP6	0	+
7 | chr1	13000	13500	CLIP7	3	+
8 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test2.bed:
--------------------------------------------------------------------------------
1 | chr1	12000	13000	reg1	0	+
2 | chr1	1300	1400	reg1	0	+
3 | chr1	10000	11000	reg1	0	+
4 | chr1	1000	1100	reg1	0	+
5 | chr2	12000	13000	reg2	0	-
6 | chr2	10000	11000	reg2	0	-
7 | chr2	1000	1100	reg2	0	-
8 | chr3	6666	66666	reg3	0	+
9 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test2.bpp:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/BackofenLab/RNAProt/6091c9882d0355e3457607f12ee43ddf82cbb11b/rnaprot/test_data/test2.bpp


--------------------------------------------------------------------------------
/rnaprot/test_data/test2.con:
--------------------------------------------------------------------------------
 1 | >CLIP1
 2 | 1	0.001	0.885
 3 | 2	0	0.025
 4 | 3	0	-0.388
 5 | 4	0.003	0.284
 6 | 5	0	-0.822
 7 | 6	0	0.168
 8 | 7	0	0.477
 9 | 8	0	-0.07
10 | 9	0	0.013
11 | 10	0	-0.177
12 | >CLIP2_e1
13 | 1	0	-0.042
14 | 2	0	-0.905
15 | 3	0.008	-0.822
16 | 4	0.031	0.81
17 | 5	0.001	-0.034
18 | >CLIP2_e2
19 | 1	0	-0.701
20 | 2	0.001	0.63
21 | 3	0	-0.404
22 | 4	0	-0.976
23 | 5	0	-0.835
24 | >CLIP2_e3
25 | 1	0.001	0.898
26 | 2	0	-0.576
27 | 3	0	-0.869
28 | 4	0.099	1.485
29 | 5	0.038	0.12
30 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test2.exon_intron_labels:
--------------------------------------------------------------------------------
1 | CLIP1	IIIIIEEEEE
2 | CLIP2_e1	IIIEE
3 | CLIP2_e2	EEEEE
4 | CLIP2_e3	IIIII
5 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test2.exp.bed:
--------------------------------------------------------------------------------
1 | chr1	12000	13000	reg1	0	+
2 | chr1	1300	1400	reg1	0	+
3 | chr1	10000	11000	reg1	0	+
4 | chr1	1000	1100	reg1	0	+
5 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test2.exp.con:
--------------------------------------------------------------------------------
 1 | >CLIP1
 2 | 1	0.001	0.885
 3 | 2	0	0.025
 4 | 3	0	-0.388
 5 | 4	0.003	0.284
 6 | 5	0	-0.822
 7 | 6	0	0.168
 8 | 7	0	0.477
 9 | 8	0	-0.07
10 | 9	0	0.013
11 | 10	0	-0.177
12 | >CLIP2
13 | 1	0	-0.042
14 | 2	0	-0.905
15 | 3	0.008	-0.822
16 | 4	0.031	0.81
17 | 5	0.001	-0.034
18 | 6	0	-0.701
19 | 7	0.001	0.63
20 | 8	0	-0.404
21 | 9	0	-0.976
22 | 10	0	-0.835
23 | 11	0.001	0.898
24 | 12	0	-0.576
25 | 13	0	-0.869
26 | 14	0.099	1.485
27 | 15	0.038	0.12
28 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test2.exp.exon_intron_labels:
--------------------------------------------------------------------------------
1 | CLIP1	IIIIIEEEEE
2 | CLIP2	IIIEEEEEEEIIIII
3 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test2.fa:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/BackofenLab/RNAProt/6091c9882d0355e3457607f12ee43ddf82cbb11b/rnaprot/test_data/test2.fa


--------------------------------------------------------------------------------
/rnaprot/test_data/test2.pp.con:
--------------------------------------------------------------------------------
1 | >CLIP_01
2 | 0.1	0.2
3 | 0.3	0.4
4 | >CLIP_02
5 | 0.5	0.6
6 | 0.7	0.8
7 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test2.up:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/BackofenLab/RNAProt/6091c9882d0355e3457607f12ee43ddf82cbb11b/rnaprot/test_data/test2.up


--------------------------------------------------------------------------------
/rnaprot/test_data/test3.bed:
--------------------------------------------------------------------------------
1 | chr1	10	20	CLIP1	0	+
2 | chr1	30	45	CLIP2	0	-
3 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test3.fa:
--------------------------------------------------------------------------------
1 | >seq2
2 | tgcaTGCAtgcaACGTacgt
3 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test4.bed:
--------------------------------------------------------------------------------
1 | chr1	16	30	tr1_e1	0	+
2 | chr1	40	70	tr2_e1	0	-
3 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test4.exp.fa:
--------------------------------------------------------------------------------
1 | >CLIP1
2 | AAAAACCCCC
3 | >CLIP2
4 | GGGGGUUUUUAAAAA
5 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test4.fa:
--------------------------------------------------------------------------------
1 | >CLIP1
2 | AAAAACCCCC
3 | >CLIP2_e1
4 | GGGGG
5 | >CLIP2_e2
6 | UUUUU
7 | >CLIP2_e3
8 | AAAAA
9 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test5.bed:
--------------------------------------------------------------------------------
1 | chr1	3000	4000	CLIP2	2.57	+
2 | chr2	1000	2500	CLIP1	1.58	+
3 | chr1	3500	5000	CLIP3	3.11	+
4 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test5.centered_zero_sc.bed:
--------------------------------------------------------------------------------
1 | chr1	3500	3501	CLIP2	0	+
2 | chr2	1750	1751	CLIP1	0	+
3 | chr1	4250	4251	CLIP3	0	+
4 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test5.exp.bed:
--------------------------------------------------------------------------------
1 | chr1	3500	5000	CLIP3	3.11	+
2 | chr2	1000	2500	CLIP1	1.58	+
3 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test5.exp.fa:
--------------------------------------------------------------------------------
1 | >seq1
2 | ACGT
3 | ACGT
4 | ACGT
5 | AC
6 | >seq2
7 | ACGT
8 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test6.bed:
--------------------------------------------------------------------------------
1 | chr1	1000	3000	ENST1_e1	0	+
2 | chr1	5000	7000	ENST1_e2	0	+
3 | chr2	10000	11000	ENST2_e1	0	+
4 | chr2	12000	12500	ENST2_e2	0	+
5 | chr3	20000	22500	ENST3_e1	0	+
6 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test7.exp.out:
--------------------------------------------------------------------------------
 1 | >reg1
 2 | 0
 3 | 0
 4 | 5
 5 | 5
 6 | 5
 7 | >reg2
 8 | 5
 9 | 0
10 | 0
11 | 0
12 | 0
13 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test7.feat.bed:
--------------------------------------------------------------------------------
1 | chr1	1002	1021	feat1	5	+
2 | chr1	1000	2000	feat2	10	-
3 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test7.in.bed:
--------------------------------------------------------------------------------
1 | chr1	1000	1005	reg1	0	+
2 | chr1	1020	1025	reg2	0	+
3 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test8.bed:
--------------------------------------------------------------------------------
1 | chr1	1000	1001	reg1	0	+
2 | chr2	1000	1001	reg2_p1	0	+
3 | chr2	2000	2001	reg2_p2	0	+
4 | chr3	1000	1001	reg3	0	+
5 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test8.exp.rra:
--------------------------------------------------------------------------------
1 | >seq1
2 | NNRRRRNN
3 | >seq2
4 | NNNNNNN
5 | >seq3
6 | RRRRRRRRR
7 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_border_annot.exp.bed:
--------------------------------------------------------------------------------
 1 | chr1	1000	1001	A	0	+
 2 | chr1	1019	1020	Z	0	+
 3 | chr1	2000	2001	A	0	+
 4 | chr1	2099	2100	Z	0	+
 5 | chr1	2009	2010	B	0	+
 6 | chr1	2080	2081	B	0	+
 7 | chr1	2099	2100	A	0	-
 8 | chr1	2000	2001	Z	0	-
 9 | chr1	2080	2081	B	0	-
10 | chr1	2009	2010	B	0	-
11 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_border_annot.gtf:
--------------------------------------------------------------------------------
1 | 1	havana	transcript	1001	1020	.	+	.	gene_id "ENSG1"; transcript_id "ENST1";
2 | 1	havana	exon	1001	1020	.	+	.	gene_id "ENSG1"; transcript_id "ENST1"; exon_id "ENSE01"; exon_number "1";
3 | 1	havana	transcript	2001	2100	.	+	.	gene_id "ENSG2"; transcript_id "ENST2";
4 | 1	havana	exon	2001	2010	.	+	.	gene_id "ENSG2"; transcript_id "ENST2"; exon_id "ENSE02"; exon_number "1";
5 | 1	havana	exon	2081	2100	.	+	.	gene_id "ENSG2"; transcript_id "ENST2"; exon_id "ENSE03"; exon_number "2";
6 | 1	havana	transcript	2001	2100	.	-	.	gene_id "ENSG3"; transcript_id "ENST3";
7 | 1	havana	exon	2081	2100	.	-	.	gene_id "ENSG3"; transcript_id "ENST3"; exon_id "ENSE04"; exon_number "1";
8 | 1	havana	exon	2001	2010	.	-	.	gene_id "ENSG3"; transcript_id "ENST3"; exon_id "ENSE05"; exon_number "2";
9 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_con.bed:
--------------------------------------------------------------------------------
1 | chr1	1000	1020	site1	0	+
2 | chr1	1000	1020	site2	0	-
3 | chr1	999	1002	site3_p1	0	+
4 | chr1	1008	1011	site3_p2	0	+
5 | chr1	999	1002	site4_e2	0	-
6 | chr1	1007	1011	site4_e1	0	-
7 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_con.bw:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/BackofenLab/RNAProt/6091c9882d0355e3457607f12ee43ddf82cbb11b/rnaprot/test_data/test_con.bw


--------------------------------------------------------------------------------
/rnaprot/test_data/test_con.exp.con:
--------------------------------------------------------------------------------
 1 | >site1
 2 | 0.1
 3 | 0.1
 4 | 0.2
 5 | 0.2
 6 | 0.3
 7 | 0.3
 8 | 0.4
 9 | 0.4
10 | 0.5
11 | 0.5
12 | 0
13 | 0
14 | 0
15 | 0
16 | 0
17 | 0
18 | 0
19 | 0
20 | 0
21 | 0
22 | >site2
23 | 0
24 | 0
25 | 0
26 | 0
27 | 0
28 | 0
29 | 0
30 | 0
31 | 0
32 | 0
33 | 0.5
34 | 0.5
35 | 0.4
36 | 0.4
37 | 0.3
38 | 0.3
39 | 0.2
40 | 0.2
41 | 0.1
42 | 0.1
43 | >site3
44 | 0
45 | 0.1
46 | 0.1
47 | 0.5
48 | 0.5
49 | 0
50 | >site4
51 | 0
52 | 0.5
53 | 0.5
54 | 0.4
55 | 0.1
56 | 0.1
57 | 0
58 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_con2.exp.con:
--------------------------------------------------------------------------------
 1 | >site1
 2 | 0.1
 3 | 0.1
 4 | 0.2
 5 | 0.2
 6 | 0.3
 7 | 0.3
 8 | 0.4
 9 | 0.4
10 | 0.5
11 | 0.5
12 | 0
13 | 0
14 | 0
15 | 0
16 | 0
17 | 0
18 | 0
19 | 0
20 | 0
21 | 0
22 | >site2
23 | 0
24 | 0
25 | 0
26 | 0
27 | 0
28 | 0
29 | 0
30 | 0
31 | 0
32 | 0
33 | 0.5
34 | 0.5
35 | 0.4
36 | 0.4
37 | 0.3
38 | 0.3
39 | 0.2
40 | 0.2
41 | 0.1
42 | 0.1
43 | >site3_p1
44 | 0
45 | 0.1
46 | 0.1
47 | >site3_p2
48 | 0.5
49 | 0.5
50 | 0
51 | >site4_e2
52 | 0.1
53 | 0.1
54 | 0
55 | >site4_e1
56 | 0
57 | 0.5
58 | 0.5
59 | 0.4
60 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_eia.bed:
--------------------------------------------------------------------------------
1 | chr1	95	110	CLIP1	0	+
2 | chr1	115	130	CLIP2	0	+
3 | chr1	185	205	CLIP3	0	+
4 | chr1	295	310	CLIP4	0	-
5 | chr1	315	330	CLIP5	0	-
6 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_eia.exp1.eia:
--------------------------------------------------------------------------------
 1 | >CLIP1
 2 | IIIIIEEEEEEEEEE
 3 | >CLIP2
 4 | EEEEEIIIIIIIIII
 5 | >CLIP3
 6 | IIIIIEEEEEEEEEEIIIII
 7 | >CLIP4
 8 | EEEEEEEEEEIIIII
 9 | >CLIP5
10 | IIIIIIIIIIEEEEE
11 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_eia.exp2.eia:
--------------------------------------------------------------------------------
 1 | >CLIP1
 2 | NNNNNEEEEEEEEEE
 3 | >CLIP2
 4 | EEEEEIIIIIIIIII
 5 | >CLIP3
 6 | IIIIIEEEEEEEEEENNNNN
 7 | >CLIP4
 8 | EEEEEEEEEENNNNN
 9 | >CLIP5
10 | IIIIIIIIIIEEEEE
11 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_eia.exp3.eia:
--------------------------------------------------------------------------------
 1 | >CLIP1
 2 | IIIIIEEEEEEEEEE
 3 | >CLIP2
 4 | EEEEEFIIIIIIIII
 5 | >CLIP3
 6 | IIIITEEEEEEEEEEIIIII
 7 | >CLIP4
 8 | EEEEEEEEEEIIIII
 9 | >CLIP5
10 | IIIIIIIIITEEEEE
11 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_eia.exp4.eia:
--------------------------------------------------------------------------------
 1 | >CLIP1
 2 | NNNNNEEEEEEEEEE
 3 | >CLIP2
 4 | EEEEEFIIIIIIIII
 5 | >CLIP3
 6 | IIIITEEEEEEEEEENNNNN
 7 | >CLIP4
 8 | EEEEEEEEEENNNNN
 9 | >CLIP5
10 | IIIIIIIIITEEEEE
11 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_eia.gtf:
--------------------------------------------------------------------------------
1 | 1	havana	transcript	101	200	.	+	.	gene_id "gene1"; transcript_id "tr1";
2 | 1	havana	exon	101	120	.	+	.	gene_id "gene1"; transcript_id "tr1"; exon_id "ex1"; exon_number "1";
3 | 1	havana	exon	191	200	.	+	.	gene_id "gene1"; transcript_id "tr1"; exon_id "ex2"; exon_number "2";
4 | 1	havana	transcript	301	400	.	-	.	gene_id "gene2"; transcript_id "tr2";
5 | 1	havana	exon	391	400	.	-	.	gene_id "gene2"; transcript_id "tr2"; exon_id "ex3"; exon_number "1";
6 | 1	havana	exon	301	320	.	-	.	gene_id "gene2"; transcript_id "tr2"; exon_id "ex4"; exon_number "2";
7 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_intersect.genes.bed:
--------------------------------------------------------------------------------
1 | chr1	1000	2000	ENSG1	0	+
2 | chr1	1000	2000	ENSG2	0	-
3 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_intersect.sites.bed:
--------------------------------------------------------------------------------
1 | chr1	1000	1050	site1	0	+
2 | chr1	1500	1550	site2	0	+
3 | chr1	1950	2050	site3	0	+
4 | chr1	1000	1050	site4	0	-
5 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_lengths_to_bed.exp.bed:
--------------------------------------------------------------------------------
1 | tr1	0	100	tr1	0	+
2 | tr2	0	50	tr2	0	+
3 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_most_prom_select.gtf:
--------------------------------------------------------------------------------
 1 | 1	havana	transcript	32001	40000	.	+	.	gene_id "ENSG01"; transcript_id "ENST01"; gene_name "ABC1"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_biotype "lncRNA"; tag "basic";
 2 | 1	havana	exon	32001	40000	.	+	.	gene_id "ENSG01"; transcript_id "ENST01"; gene_name "ABC1"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_biotype "lncRNA"; tag "basic";
 3 | 1	havana	transcript	30001	40000	.	+	.	gene_id "ENSG01"; transcript_id "ENST02"; gene_name "ABC1"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_biotype "lncRNA"; tag "basic";
 4 | 1	havana	exon	30001	40000	.	+	.	gene_id "ENSG01"; transcript_id "ENST02"; gene_name "ABC1"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_biotype "lncRNA"; tag "basic";
 5 | 2	havana	transcript	70001	80000	.	-	.	gene_id "ENSG02"; transcript_id "ENST03"; gene_name "ABC2"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_biotype "lncRNA";
 6 | 2	havana	exon	70001	80000	.	-	.	gene_id "ENSG02"; transcript_id "ENST03"; gene_name "ABC2"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_biotype "lncRNA";
 7 | X	havana	transcript	50001	60000	.	-	.	gene_id "ENSG03"; transcript_id "ENST04"; gene_name "ABC3"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_biotype "lncRNA"; tag "basic"; transcript_support_level "5";
 8 | X	havana	exon	50001	60000	.	-	.	gene_id "ENSG03"; transcript_id "ENST04"; gene_name "ABC3"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_biotype "lncRNA"; tag "basic"; transcript_support_level "5";
 9 | X	havana	transcript	52001	60000	.	-	.	gene_id "ENSG03"; transcript_id "ENST05"; gene_name "ABC3"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_biotype "lncRNA"; tag "basic"; transcript_support_level "2";
10 | X	havana	exon	52001	60000	.	-	.	gene_id "ENSG03"; transcript_id "ENST05"; gene_name "ABC3"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_biotype "lncRNA"; tag "basic"; transcript_support_level "2";
11 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_new_format.tra:
--------------------------------------------------------------------------------
1 | >site1
2 | FT
3 | >site2
4 | CN
5 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_seq_extr.chr_sizes:
--------------------------------------------------------------------------------
1 | chr1	210
2 | chr2	200
3 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_seq_extr.sequences.2bit:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/BackofenLab/RNAProt/6091c9882d0355e3457607f12ee43ddf82cbb11b/rnaprot/test_data/test_seq_extr.sequences.2bit


--------------------------------------------------------------------------------
/rnaprot/test_data/test_seq_extr.sequences.fa:
--------------------------------------------------------------------------------
 1 | >chr1
 2 | ATCTGGGCCATGATACTATGTATTGGTATAAACAGGACTCTAAGAAATTTCTGAAGATAA
 3 | TGTTTAGCTACAATAATAAGGAGCTCATTATAAATGAAACAGTTCCAAATCGCTTCTCAC
 4 | CTAAATCTCCAGACAAAGCTCACTTAAATCTTCACATCAATTCCCTGGAGCTTGGTGACT
 5 | CTGCTGTGTATTTCTGTGCCAGCAGCCAAC
 6 | >chr2
 7 | ATTCATTACTCAGTTGGTGAGGGTACAACTGCCAAAGGAGAGGTCCCTGATGGCTACAAT
 8 | GTCTCCAGATTAAAAAAACAGAATTTCCTGCTGGGGTTGGAGTCGGCTGCTCCCTCCCAA
 9 | ACATCTGTGTACTTCTGTGC
10 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_seq_extr.sites.bed:
--------------------------------------------------------------------------------
1 | chr1	55	65	site1	0	+
2 | chr2	0	10	site2	0	-
3 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_seq_extr.sites.exp.fa:
--------------------------------------------------------------------------------
1 | >site1
2 | GATAATGTTT
3 | >site2
4 | AGTAATGAAT
5 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_seq_feat.in:
--------------------------------------------------------------------------------
1 | p1	-0.2,0.1,0,-1
2 | p2	0.2,-0.1,0,1
3 | n1	-0.1,0.2,0,-1
4 | n2	0.1,-0.2,0
5 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_seq_feat_gp.exp.out:
--------------------------------------------------------------------------------
 1 | >t1
 2 | -0.2
 3 | 0.1
 4 | 0
 5 | -1
 6 | >t2
 7 | 0.2
 8 | -0.1
 9 | 0
10 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_seq_feat_gp.in:
--------------------------------------------------------------------------------
1 | t1	-0.2,0.1,0,-1
2 | t2	0.2,-0.1,0
3 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_seq_feat_neg.exp.out:
--------------------------------------------------------------------------------
 1 | >n1
 2 | -0.1
 3 | 0.2
 4 | 0
 5 | -1
 6 | >n2
 7 | 0.1
 8 | -0.2
 9 | 0
10 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_seq_feat_pos.exp.out:
--------------------------------------------------------------------------------
 1 | >p1
 2 | -0.2
 3 | 0.1
 4 | 0
 5 | -1
 6 | >p2
 7 | 0.2
 8 | -0.1
 9 | 0
10 | 1
11 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_settings.out:
--------------------------------------------------------------------------------
1 | peyote	20.5
2 | china_white	43.1
3 | bolivian_marching_powder	1000.0
4 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_start_end.bed:
--------------------------------------------------------------------------------
1 | chr1	200	220	site1	0	+
2 | chr2	100	110	site2	0	-
3 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_start_end.exp.bed:
--------------------------------------------------------------------------------
1 | chr1	200	201	F	0	+
2 | chr1	219	220	T	0	+
3 | chr2	109	110	F	0	-
4 | chr2	100	101	T	0	-
5 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_tr2gen.bed:
--------------------------------------------------------------------------------
1 | ENST00000498151	30	50	ENST00000498151_site1	0	+
2 | ENST00000498151	100	120	ENST00000498151_site2	0	+
3 | ENST00000430259	30	50	ENST00000430259_site1	0	+
4 | ENST00000430259	1700	1720	ENST00000430259_site2	0	+
5 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_tr2gen.exp.bed:
--------------------------------------------------------------------------------
1 | chr21	46254083	46254103	ENST00000430259_site1	0	-
2 | chr21	46252429	46252433	ENST00000430259_site2_p1	0	-
3 | chr21	46252105	46252121	ENST00000430259_site2_p2	0	-
4 | chr21	46648537	46648557	ENST00000498151_site1	0	+
5 | chr21	46648607	46648619	ENST00000498151_site2_p1	0	+
6 | chr21	46649512	46649520	ENST00000498151_site2_p2	0	+
7 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_tr2gen.gtf:
--------------------------------------------------------------------------------
1 | 21	havana	transcript	46648508	46649893	.	+	.	gene_id "ENSG00000160310"; gene_version "18"; transcript_id "ENST00000498151"; transcript_version "1"; gene_name "PRMT2"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "PRMT2-215"; transcript_source "havana"; transcript_biotype "lncRNA"; transcript_support_level "3";
2 | 21	havana	exon	46648508	46648619	.	+	.	gene_id "ENSG00000160310"; gene_version "18"; transcript_id "ENST00000498151"; transcript_version "1"; exon_number "1"; gene_name "PRMT2"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "PRMT2-215"; transcript_source "havana"; transcript_biotype "lncRNA"; exon_id "ENSE00001939336"; exon_version "1"; transcript_support_level "3";
3 | 21	havana	exon	46649513	46649893	.	+	.	gene_id "ENSG00000160310"; gene_version "18"; transcript_id "ENST00000498151"; transcript_version "1"; exon_number "2"; gene_name "PRMT2"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "PRMT2-215"; transcript_source "havana"; transcript_biotype "lncRNA"; exon_id "ENSE00001842516"; exon_version "1"; transcript_support_level "3";
4 | 21	havana	transcript	46251812	46254133	.	-	.	gene_id "ENSG00000239415"; gene_version "1"; transcript_id "ENST00000430259"; transcript_version "1"; gene_name "AP001469.3"; gene_source "havana"; gene_biotype "lncRNA"; transcript_name "AP001469.3-202"; transcript_source "havana"; transcript_biotype "lncRNA"; tag "basic"; transcript_support_level "5";
5 | 21	havana	exon	46252430	46254133	.	-	.	gene_id "ENSG00000239415"; gene_version "1"; transcript_id "ENST00000430259"; transcript_version "1"; exon_number "1"; gene_name "AP001469.3"; gene_source "havana"; gene_biotype "lncRNA"; transcript_name "AP001469.3-202"; transcript_source "havana"; transcript_biotype "lncRNA"; exon_id "ENSE00001774125"; exon_version "1"; tag "basic"; transcript_support_level "5";
6 | 21	havana	exon	46251812	46252121	.	-	.	gene_id "ENSG00000239415"; gene_version "1"; transcript_id "ENST00000430259"; transcript_version "1"; exon_number "2"; gene_name "AP001469.3"; gene_source "havana"; gene_biotype "lncRNA"; transcript_name "AP001469.3-202"; transcript_source "havana"; transcript_biotype "lncRNA"; exon_id "ENSE00001700485"; exon_version "1"; tag "basic"; transcript_support_level "5";
7 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_tr_annot.bed:
--------------------------------------------------------------------------------
1 | chr1	1000	1030	site1	0	+
2 | chr1	2000	2030	site2	0	-
3 | chr1	1090	1100	site3_p1	0	+
4 | chr1	1500	1505	site3_p2	0	+
5 | chr1	2500	2505	site4_e1	0	-
6 | chr1	2090	2100	site4_e2	0	-
7 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_tr_annot.codons.exp.tra:
--------------------------------------------------------------------------------
1 | >site1
2 | FFFFFSSSCCCCCCCCCCCCEEETTTTTTT
3 | >site2
4 | FFFFFFFSSSCCCCCCCCCCCCEEETTTTT
5 | >site3
6 | TTTTTTTTTTNNNNN
7 | >site4
8 | NNNNNFFFFFFFFFF
9 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_tr_annot.exp.tra:
--------------------------------------------------------------------------------
1 | >site1
2 | FFFFFCCCCCCCCCCCCCCCCCCTTTTTTT
3 | >site2
4 | FFFFFFFCCCCCCCCCCCCCCCCCCTTTTT
5 | >site3
6 | TTTTTTTTTTNNNNN
7 | >site4
8 | NNNNNFFFFFFFFFF
9 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_tr_annot.gtf:
--------------------------------------------------------------------------------
 1 | 1	havana	transcript	951	1100	.	+	.	gene_id "ENSG1"; transcript_id "ENST1";
 2 | 1	havana	exon	951	1050	.	+	.	gene_id "ENSG1"; transcript_id "ENST1"; exon_id "ex1"; exon_number "1";
 3 | 1	havana	exon	1051	1100	.	+	.	gene_id "ENSG1"; transcript_id "ENST1"; exon_id "ex2"; exon_number "2";
 4 | 1	havana	five_prime_utr	951	1005	.	+	.	gene_id "ENSG1"; transcript_id "ENST1";
 5 | 1	havana	start_codon	1006	1008	.	+	.	gene_id "ENSG1"; transcript_id "ENST1";
 6 | 1	havana	CDS	1006	1023	.	+	.	gene_id "ENSG1"; transcript_id "ENST1";
 7 | 1	havana	stop_codon	1021	1023	.	+	.	gene_id "ENSG1"; transcript_id "ENST1";
 8 | 1	havana	three_prime_utr	1024	1100	.	+	.	gene_id "ENSG1"; transcript_id "ENST1";
 9 | 1	havana	transcript	1951	2100	.	-	.	gene_id "ENSG2"; transcript_id "ENST2";
10 | 1	havana	exon	2051	2100	.	-	.	gene_id "ENSG2"; transcript_id "ENST2"; exon_id "ex3"; exon_number "1";
11 | 1	havana	exon	1951	2050	.	-	.	gene_id "ENSG2"; transcript_id "ENST2"; exon_id "ex4"; exon_number "2";
12 | 1	havana	three_prime_utr	1951	2005	.	-	.	gene_id "ENSG2"; transcript_id "ENST2";
13 | 1	havana	stop_codon	2006	2008	.	-	.	gene_id "ENSG2"; transcript_id "ENST2";
14 | 1	havana	CDS	2006	2023	.	-	.	gene_id "ENSG2"; transcript_id "ENST2";
15 | 1	havana	start_codon	2021	2023	.	-	.	gene_id "ENSG2"; transcript_id "ENST2";
16 | 1	havana	five_prime_utr	2024	2100	.	-	.	gene_id "ENSG2"; transcript_id "ENST2";
17 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_tr_annot_gtf.exp.bed:
--------------------------------------------------------------------------------
 1 | chr1	950	951	A	0	+
 2 | chr1	1099	1100	Z	0	+
 3 | chr1	1049	1050	B	0	+
 4 | chr1	1050	1051	B	0	+
 5 | chr1	950	1005	F	0	+
 6 | chr1	1005	1008	S	0	+
 7 | chr1	1005	1023	C	0	+
 8 | chr1	1020	1023	E	0	+
 9 | chr1	1023	1100	T	0	+
10 | chr1	2099	2100	A	0	-
11 | chr1	1950	1951	Z	0	-
12 | chr1	2050	2051	B	0	-
13 | chr1	2049	2050	B	0	-
14 | chr1	1950	2005	T	0	-
15 | chr1	2005	2008	E	0	-
16 | chr1	2005	2023	C	0	-
17 | chr1	2020	2023	S	0	-
18 | chr1	2023	2100	F	0	-
19 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_tsl_genes.exp.bed:
--------------------------------------------------------------------------------
1 | chrX	50000	60000	ENSG02	0	-
2 | 


--------------------------------------------------------------------------------
/rnaprot/test_data/test_tsl_genes.gtf:
--------------------------------------------------------------------------------
1 | 1	havana	gene	30001	40000	.	+	.	gene_id "ENSG01"; gene_version "1"; gene_name "ABC1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene";
2 | 1	havana	transcript	30001	40000	.	+	.	gene_id "ENSG01"; gene_version "1"; transcript_id "ENST01"; transcript_version "1"; gene_name "ABC1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "ABC1-202"; transcript_source "havana"; transcript_biotype "lncRNA";
3 | 1	havana	exon	30001	40000	.	+	.	gene_id "ENSG01"; gene_version "1"; transcript_id "ENST01"; transcript_version "1"; gene_name "ABC1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "ABC1-202"; transcript_source "havana"; transcript_biotype "lncRNA";
4 | X	havana	gene	50001	60000	.	-	.	gene_id "ENSG02"; gene_version "1"; gene_name "ABC2"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene";
5 | X	havana	transcript	50001	60000	.	-	.	gene_id "ENSG02"; gene_version "1"; transcript_id "ENST02"; transcript_version "1"; gene_name "ABC2"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "ABC2-202"; transcript_source "havana"; transcript_biotype "lncRNA"; tag "basic"; transcript_support_level "1";
6 | X	havana	exon	50001	60000	.	-	.	gene_id "ENSG02"; gene_version "1"; transcript_id "ENST02"; transcript_version "1"; gene_name "ABC2"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "ABC2-202"; transcript_source "havana"; transcript_biotype "lncRNA"; tag "basic"; transcript_support_level "1";
7 | 


--------------------------------------------------------------------------------
/setup.py:
--------------------------------------------------------------------------------
 1 | #!/usr/bin/env python3
 2 | 
 3 | from setuptools import setup
 4 | 
 5 | 
 6 | """
 7 | Setup RNAProt
 8 | 
 9 | NOTE that additional libraries are needed to run RNAProt. For full 
10 | installation instructions see the README.md at:
11 | https://github.com/BackofenLab/RNAProt
12 | 
13 | """
14 | 
15 | setup(
16 |     name='rnaprot',
17 |     version='0.5',
18 |     description='Modelling RBP binding preferences to predict RPB binding sites',
19 |     long_description=open('README.md').read(),
20 |     author='Michael Uhl',
21 |     author_email='uhlm@informatik.uni-freiburg.de',
22 |     url='https://github.com/BackofenLab/RNAProt',
23 |     license='MIT',
24 |     scripts=['bin/rnaprot', 'bin/gtf_extract_gene_regions.py', 'bin/gtf_extract_transcript_regions.py'],
25 |     packages=['rnaprot'],
26 |     package_data={'rnaprot': ['content/*']},
27 |     zip_safe=False,
28 | )
29 | 
30 | 


--------------------------------------------------------------------------------
/test/ENST00000314032.fa:
--------------------------------------------------------------------------------
 1 | >ENST00000314032.9
 2 | AGAGACAACAGUGAAUGACAAGGAGGGGCCAUCCAAUCCCUGCUGCCACCUCCUGGGAUG
 3 | GAGCCCUAGGGAGCCCCUGUGCUGCCCCUGCCGUGGCAGGACUCACAGCCCCACCGCUGC
 4 | ACUGAAGCCCAGGGCUGUGGAGCAGCCUCUCUCCUUGGACCUCCUCUCGGCCCUAAAGGG
 5 | ACUGGGCAGAGCCUUCCAGGACUAUGGUUGGACUGAAGCCUUCAGACGUGCCUCCCACCA
 6 | UGGCUGUGAAGUUCCUGGGGGCAGGCACAGCAGCCUGUUUUGCUGACCUCGUUACCUUUC
 7 | CACUGGACACAGCCAAGGUCCGCCUGCAGAUCCAGGGGGAGAACCAGGCGGUCCAGACGG
 8 | CCCGGCUCGUGCAGUACCGUGGCGUGCUGGGCACCAUCCUGACCAUGGUGCGGACUGAGG
 9 | GUCCCUGCAGCCCCUACAAUGGGCUGGUGGCCGGCCUGCAGCGCCAGAUGAGCUUCGCCU
10 | CCAUCCGCAUCGGCCUCUAUGACUCCGUCAAGCAGGUGUACACCCCCAAAGGCGCGGACA
11 | ACUCCAGCCUCACUACCCGGAUUUUGGCCGGCUGCACCACAGGAGCCAUGGCGGUGACCU
12 | GUGCCCAGCCCACAGAUGUGGUGAAGGUCCGAUUUCAGGCCAGCAUACACCUCGGGCCAU
13 | CCAGGAGCGACAGAAAAUACAGCGGGACUAUGGACGCCUACAGAACCAUCGCCAGGGAGG
14 | AAGGAGUCAGGGGCCUGUGGAAAGGAACUUUGCCCAACAUCAUGAGGAAUGCUAUCGUCA
15 | ACUGUGCUGAGGUGGUGACCUACGACAUCCUCAAGGAGAAGCUGCUGGACUACCACCUGC
16 | UCACUGACAACUUCCCCUGCCACUUUGUCUCUGCCUUUGGAGCCGGCUUCUGUGCCACAG
17 | UGGUGGCCUCCCCGGUGGACGUGGUGAAGACCCGGUAUAUGAACUCACCUCCAGGCCAGU
18 | ACUUCAGCCCCCUCGACUGUAUGAUAAAGAUGGUGGCCCAGGAGGGCCCCACAGCCUUCU
19 | ACAAGGGAUUUACACCCUCCUUUUUGCGUUUGGGAUCCUGGAACGUGGUGAUGUUCGUAA
20 | CCUAUGAGCAGCUGAAACGGGCCCUGAUGAAAGUCCAGAUGUUACGGGAAUCACCGUUUU
21 | GAACAAGACAAGAAGGCCACUGGUAGCUAACGUGUCCGAAACCAGUUAAGAAUGGAAGAA
22 | AACGGUGCAUCCACGCACACAUGGACACAGACCCACACAUGUUUACAGAACUGUUGUUUA
23 | CUUGUUGCUGAUUCAAGAAACAGAAGUAGAAGAGGAGGAGGGAUUCUGGUCUUCACUGCC
24 | AUGCCUCAAGAACACCUUUGUUUUGCACUGACAAGAUGGAAAAUAAAUUAUAUUAAUUUU
25 | UGAAACCCAUUAGGCAUGCCUAAUAUUUAGGCAAGAGAAAAUAAACCAAGAUAGAUCCAU
26 | UUGGACAAAAUGGAAGGUUGGAGACGUGUAUCCCCGUGAAAUCUGGUUAGAUAAUGAAUG
27 | AUAAGCAGGAAGGAUGGCAAGCACGGGACAGGAGGGGCCCACAAUGGAGUGGGAGAUCAG
28 | CCACGGAGCCUGGAGGGAUGCCACCCAGCAACACAGAGCUGGCGACUGCAGCUGCACCAU
29 | CACACAUGCAUCAUCAGCCUAUUUGUAAUAUGUCUGCCACAGAGAGUCCUUUGGGAUUCU
30 | AGGAAACCCAAGGAACAAGAGAAAAAACUAGAGCCUGUGCUAAAGAAGCCCUGCUGGGCC
31 | CAUGUGAGGCUGGGGCUCGUAAAUAUUCCCUGACGACACUGAAGAAUCAAGAGGGCAGCC
32 | CCCACUUUCCUACAAAAUGGAGGGAGCCAUCCCUUCCCUGUCCACCUCACCAGGGGUGCU
33 | AUGACAUGCAAGUGAGAAGCUGGGCAUGAACGCACUUUAUAAAAGCAAAAGCUCUGUGUA
34 | AAUCUAACUACAAGGACAAUGCCUUGGGAGAGAUUUUGUCGGGACAGAGAGGAGUUGCCA
35 | GGGAAGAAGGUUUGAAAGAUACGGUUGUCUAGAGGUGAGACCAAAGGAUCCAGAGACUUG
36 | GGGACCAGAGGUGACAGUGGAUGACGUGAAGCCACAGGAGCCCCACCCCCAUGCAGCCUC
37 | UUCCCCACCCCCCCCACCACGUGCUCAAUCAUGAGUACCUCAAAGGAUUGUUGGGCUUGG
38 | GGGAAAAGAGGUGGAUUCCUGGGCAAGAACCUAAAGUAGCAGGACUCGGAAUUCUCGGGA
39 | AAUUAUUAUGACUCAAUAAAAGAAUUCACACCUUAGGUGUGGGAGUAAGAACAGCCA
40 | 


--------------------------------------------------------------------------------
/test/NORAD_lncRNA.fa:
--------------------------------------------------------------------------------
 1 | >ENST00000565493.2
 2 | AGCGCAAGGGCACTTCCGGTACCGCTCCTCTCTTGCCAGCGCAGAGAACTGCCAAGTCAG
 3 | TTCCGGTCCGGCAGAGATCGCGGAGAGACGCAGAACGCAGCCCGCTCCTCCAGGGCCCTC
 4 | CAGGCCCTCCGGCCCCGGGCCGGCGGGTGAACTGGGGGGCCCCGGGACAGGCCGAGCCCT
 5 | CTGCCCTGCAGATAACGGAGGCCTCTGCTGTGGCTGCCCACTGGCTGTGCCCGCCCACTG
 6 | GCTGTGCCCAGACCTTGAAGCCGCAGCGAACCTCTCTTTCCCACCCCACCTCGGTGACTA
 7 | ATGGCGGCCGTGGCGTCTCCCAGCCCGGACCCCGCCGGCACCCGGGTCTCCCGACCCAAG
 8 | CCTCGACGAAACCCCCGCAGAGCCGCCGGGACGCAGCGCCTTTGGGCGGCGCTGGGCGTG
 9 | GTGGGCCGGGAAGTATGGCGGCAGCTCGAACGCCGCGCGGCGGAGGCCATTAAGGCGTGG
10 | ACGGCCCGGGAAGGCGGCCTAGGGACGCAAGCAGGCTCGGCCGCCTCTTTAGGCCACGGA
11 | GCCGCGCAGATCCGGTTCCCGGGTGACCACTCTGTCGCCATTGGGCGAGACCTACCTAGT
12 | CCTGACGACAACGGACAAAGGCCTTAAGGGGCCTGGAAGGTGAGCGAAGTCCCGAACGAC
13 | GACGGGTGGAACGGTTAGCGGCCATCGGGCGGTTGGTCTTCATTCTACCAGACTTTGCTG
14 | TCGGAAGAGAGAAATGGTAGAATGACAGGCCACGTTTGGCCCGTTGGAAATGCCCACCAC
15 | CCTCTGGGAAGATTTACTGGCCGTTTATGGAAGGCCTGTGTATATAATATGAAAAAGCTG
16 | CTCTCAACTCCACCCCAACCTTTTAATAGAAAACATTTGTCACATCTAGCCCTTCTAGAT
17 | GGAAAGAGGTTGCCGACGTATGATAAAATAGAGTTAGAAAGTTACACATCTTGTAAATTC
18 | TCATTTGTTTAAAAGAAATCATAGAAAATACATGTCTTCTGGAGATGACTTTTGGAAATG
19 | GAGTTGTTAAGACGGCCTCTGGAAGCGATACGTCCACGTTTGTTAAGTGGGTTAGATGAC
20 | ATGGAGCTGGAAGACCTGAGAAGGAAGAGAAGAAGGTTCTATGCTAGACTGGTCATATTT
21 | AGAAGACATTTTCATATTCTATCCATTGTTTTGTGTGCATTTTATTCCTCACTACTGTGT
22 | ATATAGTTGACAATGCTAAGCTTTTTTGAAATGTCTCTTCTTTTTAGATGTTCTGAAGTG
23 | CCTGATATGTTAAAATTAGAGGTAGCAAAATCACATTTTGTAAATACCTTTTTGTTACAA
24 | TTCATAGGAAATATTTTTGGGGGGGAATGGCCAAATCACCTGTTGAGTAATACTCATTGT
25 | GTTTGTGCAGTGGTTCAGGGGAGGAGAGAGGAGGGGGAGGTGCAGAGAGCTCTATGCCAT
26 | CCTGTTTACAGCGAGGCAAGATGAATCATTATGTCTGTGCATTTTGTTTTACTTATCTGT
27 | GTATATAGTGTACATAAAGGACAGACGAGTCCTAATTGACAACATCTAGTCTTTCTGGAT
28 | GTTAAAGAGGTTGCCAGTGTATGACAAAAGTAGAGTTAGTAAACTAATATATTTTGTACA
29 | TTTTGTTTTACAAGTCCTAGGAAAGATTGTCTTCTGAAAATTTGATGTCTTCTGGGTTGA
30 | TGGAGATGGGAAGGGTTCTAGGCCAGAATGTTCACATTTGGAAGACTCTTTCAAATTATA
31 | ACTGTTGTTACATGTTTGCAGTTTATTCAAGACTGCTGTATACATAGTAGACAAATTAAC
32 | TCCTTACTTGAAACATCTAGTCTATCTAGATGTTTAGAAGTGCCCGATGTATGTTAAATG
33 | TATAGGTAGTAAAATACCACTTTGTAAATATCTTTTTGCTAAAATTCATAGGAAATGCTT
34 | TTGGAAATTGAATTGTGAAGCCACCTTTGTGAACAGTATAGTAATGTCTATACTTGTTCA
35 | ATAGTTTAGAGGAGGTAGGAGGGAAGAAATTGCAAAAGGTAATATTACTAGTGTGTTCAT
36 | ACTTGGACATTTTCAGACACCATTTTTCTATATGTTTTGTGCATTTTGTTTTGCTCTGTA
37 | TATAGTATATATAATGGACAAATAGTCCTAATTTTTCAACATCTAGTCTCTAGATGTTAA
38 | AGAGGTTGCCAGTGTATGACAAAGGAGTAAAATTAGCATATTTTGTACACTTTGTGTTGA
39 | AATTCGTAGGAAAACTTGTCTTCTGTAAAGACTTTTGCATAGGAATTTGTTTGACCATCT
40 | CTAAGCATTACACGTGCCTGTACTTGTCCACTGGATTGAAGGCAGAGAAGGAAGGGAGGA
41 | GGGAATGATTCAAGGCCAAAATGGCCACATTTAGAAGATACCTCAGATGATAACCATTGT
42 | TATGTGTGTGCAATTTTATTTAACAGTGCTGTGTATGTGGTGGACAAGTTATATGAAATA
43 | TCTAGTCTTTCTAGATATTTGGAAGTGCTTGATGTATTTAAAAGTGGTAGTAGAATAACA
44 | CTTTGTAAATAGCTTTTAAAAACTGATGGGAAATGCTGTTTGGAAGTGGAATTGTTGAAC
45 | CACCTGGGAGGTGGGAGGGAAGAAATTGCAAATGGTGTTTTGCCATTGTTTATTAGAAAA
46 | TTTCAGCTTAATCCATTGTGTATATGTTACATGCATTTCATTTAACTTTGCTATACTGTA
47 | TATATTGTATATATAACGGACAAATTAGTCCCGATTTTATAATATCTAGTCTCTAGATAT
48 | TAAAGAGGTTGCCAATGTATGACAGAAGTAGAGTTAGTAAACTAACACATTTTGTACACT
49 | TTGTTAAAATTTGTAGAAAGGCTGTCTTCTGAAAAGGACTTTTGGAAGTGAGATAACATC
50 | AGCTCTAAGTGACACGTGCCTATATCCATCAGGTTGGTGGTGGAGAGGAGTTGGAAGGAA
51 | TGAAGGGTTCTAGACCAGAATGTTCGTATTTAGAAGACACTATCAGATATAACCATTGTT
52 | ACATGTGTGTAGTTTATTCAACCCTACTGTGTATATAGCGGACAAACTTAAGTCCTTATT
53 | TGAAACATCTAGTCTTTCTAGATGTTTAGAAGTGCACAAAGTATGTTAAAAGTAGAGGTA
54 | GTAAATAACACATTTTGTAGCTATCCTTTTGATATGAAATATTGTCTTGGAAATTGATCA
55 | ATTCTCTGAGCAGTACCCATTTTGATATTTGTGCTGGTTCAGGGGGAAGGAGGAGCACAA
56 | AGTGCAAAGGGCTTTCTACCAGTGTCCAGTGTGTTTATGAGGAGGCACATTGACCATTGT
57 | CCCTTATGTCTGCATTTTCATTTACTGTGCTGTGTATATAGTGTATATAAGCGGACATAG
58 | GAGTCCTAATTTACGTCTAGTCGATGTTAAAAAGGTTGCCAGTATATGACAAAAGTAGAA
59 | TTAGTAAACTACTACATTGAGTACACTTTGTGTTAAAATTCATAGGGAAGACTTCTTAAA
60 | AACAAGTGAAATTGTTAAAACCCCCCCTAAGCATTACAGATGGCTTATAGCTGTCCACGG
61 | GGTTGGTAGAGGTGGGAAAGGGAAGGGTTCTAGGCCAGAATGTTCCTATTTAGAAGACAC
62 | TCAAATTACAGTCTGTGTTATGTATGTATACCATTTATTCAATGCTACTGTGTATATAAT
63 | GGAAAACTTAAGTCCAGTTTGAAACATCTAGTCTTTCTAGGTGTTTAAAAGTGTACAACG
64 | GCCTGTCGCAGTGGCGCATGCCTGTAATCCCAGCACTTTGGGAGGCCGAGGCAGGCGGAT
65 | CACGAGGTCAAGAGATCAGGACCATCTTGGCCAACATGGTGAAACCCCATCTTTACTAAA
66 | AATACAAAAATTAGCTGGTCGTGGTGGTGCCCACCTGTAGCCCCAGTTACTCGAGAGGCT
67 | GAGGCAGGAGAATCGCTTGAACTTGGGAGGCGGAAGTTGCAGTGAGCCAAGATCGCACCA
68 | CTGCACTCCAGCCTGGCGACAGAGCGAGGCTCCGTTTCAAAAAAAAAAGTGCACAATGTA
69 | GGTTAACAGTAGAGGGCTTAAGTAACACCCCTCTAAGCATTTGTTTTCAGTACTTCCTAG
70 | GAGTGGTTGCATTTGGGAATGGAATTGTTAAAACTTGATGCTTAGGAGCGAATGCAGACT
71 | ATTCATTGGGTGTTTGGGGTGGGGGAAGGGGGGGTGGGCAGAGGAGGTATGCAGGGAGAG
72 | GGGTTCTGTGCTCCTGAGATTAGTTCAGATGGTCTAACCATTGTTCTATATGTGCATTTT
73 | AGTTAATATTGTGTATTAAAGGATAAGTCTTAATGCTCAAAGTATGTTAAAAATAGATGT
74 | AGTAAATCAGTCCCTTTGTGAATGTCCTTTTGTTAGTTTTTAGGAAGGCCTGTCCTCTGG
75 | GAGTGACCTTTATTAGTCCACCCCTTGGAGCTAGACATCCTGTACTTAGTCACGGGGATG
76 | GTGGAAGAGGGAGAAGAGGAAGGGTGAAGGGAAGGGCTCTTTGCTAGTATCTCCATATCT
77 | AGACGATGGTTTTAGATGATAACCACAGGTCTACAAGAGCGTTTTTAGTAAAGTGCCTGT
78 | GTTCATTGTGGACAAAGTTATTATTTTGCAACATCTAAGCTTTACGAATGGGGTGACAAC
79 | TTATGATAAAAACTAGAGCTAGTGAATTAGCCTATTTGTAAATACCTTTGTTATAATTGA
80 | TAGGATACATCTTGGACATGGAATTGTTAAGCCACCTCTGAGCAGTGTATGTCAGGACTT
81 | GTTCATTAGGTTGGCAGCAGAGGGGCAGAAGGAATTATACAGGTAGAGATGTATGCAGAT
82 | GTGTCCATATATGTCCATATTTACATTTTGATAGCCATTGATGTATGCATCTCTTGGCTG
83 | TACTATAAGAACACATTAATTCAATGGAAATACACTTTGCTAATATTTTAATGGTATAGA
84 | TCTGCTAATGAATTCTCTTAAAAACATACTGTATTCTGTTGCTGTGTGTTTCATTTTAAA
85 | TTGAGCATTAAGGGAATGCAGCATTTAAATCAGAACTCTGCCAATGCTTTTATCTAGAGG
86 | CGTGTTGCCATTTTTGTCTTATATGAAATTTCTGTCCCAAGAAAGGCAGGATTACATCTT
87 | TTTTTTTTTTTTTAGCAGTTTGAGTTGGTGTAGTGTATTCTTGGTTATCAGAATACTCAT
88 | ATAGCTTTGGGATTTTGAATTGGTAAATATTCATGATGTGTGAAAAATCATGATACATAC
89 | TGTACAGTCTCAGTCCCATAAAATTGGATGTTGTGCCTACACACAGGATCTAGAAGAATA
90 | TGTCAAACTATAAACTGCTTGTGATTGTGAATGACTTTGTTCTTTGCTTGTGTTTTTCAA
91 | TTTCCTATAATGCACATACTAACTTTTAAAAAATAAAGGTTATTTTAAAAGCCTGTATTA
92 | A
93 | 


--------------------------------------------------------------------------------
/test/cde_sites_str_model_folder.zip:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/BackofenLab/RNAProt/6091c9882d0355e3457607f12ee43ddf82cbb11b/test/cde_sites_str_model_folder.zip


--------------------------------------------------------------------------------