├── Validation
├── Validation_1_Background.fasta.fai
├── Validation_1_Input.fasta
├── Validation_1_Input_Aligned.fasta
└── Validation_1_Background.fasta
├── setup.py
├── meta.yaml
├── PrimedRPA.yml
├── README.md
├── PrimedRPA_Parameters.txt
├── LICENSE
└── PrimedRPA
/Validation/Validation_1_Background.fasta.fai:
--------------------------------------------------------------------------------
1 | AF033819.3 910 35 70 71
2 |
--------------------------------------------------------------------------------
/setup.py:
--------------------------------------------------------------------------------
1 | import setuptools
2 |
3 | setuptools.setup(
4 | name="primedrpa",
5 | version="1.0.0",
6 | license="GPL3",
7 | packages=setuptools.find_packages(),
8 | long_description="RPA Primer & Probe Design Tool",
9 | scripts= ['PrimedRPA'])
10 |
--------------------------------------------------------------------------------
/Validation/Validation_1_Input.fasta:
--------------------------------------------------------------------------------
1 | >Seq1
2 | GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTCGTCTGGCGGCTGTGCACG
3 | CGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGAAGTA
4 | >Seq2
5 | NNNGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTCGTCTGGCGGCTGTGCACG
6 | CGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGAAGTANNN
7 |
--------------------------------------------------------------------------------
/Validation/Validation_1_Input_Aligned.fasta:
--------------------------------------------------------------------------------
1 | >Seq1
2 | ---GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTAT
3 | TTCGTCTGGCGGCTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATG
4 | TCGCAGTATCTGTCTTTGAAGTA---
5 | >Seq2
6 | NNNGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTAT
7 | TTCGTCTGGCGGCTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATG
8 | TCGCAGTATCTGTCTTTGAAGTANNN
9 |
--------------------------------------------------------------------------------
/meta.yaml:
--------------------------------------------------------------------------------
1 | {% set name = "primedrpa" %}
2 | {% set version = "1.0.1" %}
3 | {% set sha256 = "f622eaac1c28e874cb829663b6ce377c7da10ce5ec16010b8d447e19eea29faa" %}
4 |
5 | package:
6 | name: {{name}}
7 | version: {{version}}
8 |
9 |
10 | source:
11 | url: https://github.com/MatthewHiggins2017/bioconda-PrimedRPA/archive/1.0.1.tar.gz
12 | sha256: '{{sha256}}'
13 |
14 | build:
15 | script: python -m pip install --no-deps --ignore-installed .
16 | noarch: python
17 | number: 0
18 |
19 | requirements:
20 | host:
21 | - python >=3.5
22 | - pip
23 | run:
24 | - python >=3.5
25 | - pandas
26 | - clustalo
27 | - samtools
28 | - blast
29 |
30 | test:
31 | commands:
32 | - PrimedRPA --help
33 |
34 | about:
35 | home: https://github.com/MatthewHiggins2017/bioconda-PrimedRPA/
36 | license: GPL3
37 | license_file: LICENSE
38 | summary: RPA primer & probe design tool.
39 |
--------------------------------------------------------------------------------
/Validation/Validation_1_Background.fasta:
--------------------------------------------------------------------------------
1 | >AF033819.3 HIV-1, complete genome
2 | GGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCC
3 | TCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGA
4 | TCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACCTGAAAGCGAA
5 | AGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGG
6 | CGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCG
7 | TCAGTATTAAGCGGGGGAGAATTAGATCGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAAT
8 | ATAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGA
9 | AACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTT
10 | AGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGATAAAAGACACCAAGG
11 | AAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAGAAAAAAGCACAGCAAGCAGCAGCTGACAC
12 | AGGACACAGCAATCAGGTCAGCCAAAATTACCCTATAGTGCAGAACATCCAGGGGCAAATGGTACATCAG
13 | GCCATATCACCTAGAACTTTAAATGCATGGGTAAAAGTAGTAGAAGAGAAGGCTTTCAGCCCAGAAGTGA
14 | TACCCATGTTTTCAGCATTATCAGAAGGAGCCACCCCACAAGATTTAAACACCATGCTAAACACAGTGGG
15 |
--------------------------------------------------------------------------------
/PrimedRPA.yml:
--------------------------------------------------------------------------------
1 | name: RPA
2 | channels:
3 | - conda-forge
4 | - bioconda
5 | - defaults
6 | dependencies:
7 | - _libgcc_mutex=0.1
8 | - _openmp_mutex=5.1
9 | - blas=1.0
10 | - blast=2.12.0
11 | - bzip2=1.0.8
12 | - c-ares=1.18.1
13 | - ca-certificates=2022.6.15
14 | - certifi=2021.5.30
15 | - clustalo=1.2.3
16 | - curl=7.82.0
17 | - entrez-direct=16.2
18 | - htslib=1.10.2
19 | - intel-openmp=2022.0.1
20 | - krb5=1.19.2
21 | - ld_impl_linux-64=2.38
22 | - libcurl=7.82.0
23 | - libdeflate=1.6
24 | - libedit=3.1.20210714
25 | - libev=4.33
26 | - libffi=3.3
27 | - libgcc-ng=11.2.0
28 | - libgomp=11.2.0
29 | - libidn2=2.3.2
30 | - libnghttp2=1.46.0
31 | - libssh2=1.10.0
32 | - libstdcxx-ng=11.2.0
33 | - libunistring=0.9.10
34 | - mkl=2020.2
35 | - mkl-service=2.3.0
36 | - mkl_fft=1.3.0
37 | - mkl_random=1.1.1
38 | - ncurses=6.2
39 | - numpy=1.19.2
40 | - numpy-base=1.19.2
41 | - openssl=1.1.1o
42 | - pandas=1.1.5
43 | - pcre=8.45
44 | - perl=5.26.2
45 | - perl-archive-tar=2.32
46 | - perl-carp=1.38
47 | - perl-common-sense=3.74
48 | - perl-compress-raw-bzip2=2.087
49 | - perl-compress-raw-zlib=2.087
50 | - perl-exporter=5.72
51 | - perl-exporter-tiny=1.002001
52 | - perl-extutils-makemaker=7.36
53 | - perl-io-compress=2.087
54 | - perl-io-zlib=1.10
55 | - perl-json=4.02
56 | - perl-json-xs=2.34
57 | - perl-list-moreutils=0.428
58 | - perl-list-moreutils-xs=0.428
59 | - perl-pathtools=3.75
60 | - perl-scalar-list-utils=1.52
61 | - perl-types-serialiser=1.0
62 | - perl-xsloader=0.24
63 | - pip=21.2.2
64 | - python=3.6.13
65 | - python-dateutil=2.8.2
66 | - python_abi=3.6
67 | - pytz=2021.3
68 | - readline=8.1
69 | - samtools=1.10
70 | - setuptools=58.0.4
71 | - six=1.16.0
72 | - sqlite=3.38.5
73 | - tk=8.6.12
74 | - wget=1.21.3
75 | - wheel=0.37.1
76 | - xz=5.2.5
77 | - zlib=1.2.12
78 |
--------------------------------------------------------------------------------
/README.md:
--------------------------------------------------------------------------------
1 | # PrimedRPA
2 |
3 | [](https://anaconda.org/bioconda/primedrpa) [](https://anaconda.org/bioconda/primedrpa) [](https://anaconda.org/bioconda/primedrpa)
5 |
6 | A python-based command-line package to augment primer and probe design for Recombinase Polymerase Amplification (RPA).
7 |
8 |
9 | ### Installation
10 |
11 |
12 | GitHub Installation
13 |
14 | ```
15 | git clone https://github.com/MatthewHiggins2017/bioconda-PrimedRPA.git
16 | cd ./bioconda-PrimedRPA
17 | conda env create --file=PrimedRPA.yml
18 | conda activate RPA
19 | python setup.py install
20 | ```
21 |
22 | Conda Installation
23 |
24 | ```
25 | conda install -c bioconda primedrpa
26 | ```
27 |
28 |
29 | ### Parameter Parsing
30 |
31 | Parameters can be parsed to PrimedRPA via the command line or using the PrimedRPA_Parameters.txt file. To download the text file
32 | please see the link below:
33 |
34 | ```
35 | wget https://raw.githubusercontent.com/MatthewHiggins2017/bioconda-PrimedRPA/master/PrimedRPA_Parameters.txt
36 | ```
37 |
38 | ### Key Output Files
39 |
40 | For each PrimedRPA run the following 3 key files are generated:
41 |
42 | ```
43 | [RunID]_Alignment_Summary.csv
44 | [RunID]_Oligo_Binding_Sites.csv
45 | [RunID]_Output_Sets.csv
46 | ```
47 |
48 | ### Walk-Through
49 |
50 | Please see the wiki for more information, including a step-by-step walk through of using the software.
51 |
52 | ### 3rd-Party Software
53 |
54 | PrimerRPA incorporates the following 3rd party software:
55 |
56 | Clustal Omega (http://www.clustal.org/omega/) - For sequence alignment if necessary.
57 | Blastn (https://blast.ncbi.nlm.nih.gov/Blast.cgi) - To assess primer/probe cross-reactivity.
58 | Samtools (http://www.htslib.org/) - To assess primer/probe cross-reactivity.
59 |
60 |
61 |
62 | ### Contact
63 |
64 |
65 | If you encounter any bugs please contact me directly at **matthew.higgins[at]lshtm.ac.uk**
66 |
--------------------------------------------------------------------------------
/PrimedRPA_Parameters.txt:
--------------------------------------------------------------------------------
1 | This parameters file will guide the PrimedRPA-based primer and probe design process. Please follow the instructions outlined below:
2 |
3 | ----####----
4 | Important Note - Do not remove any of the “>” and write your input directly after this symbol.
5 | ----####----
6 |
7 |
8 | Please define the reference name for this PrimedRPA run:
9 | >Installation_Validation_Run
10 |
11 | Please indicate if you would like to use a previously generated Alignment File: [NO or File path]
12 | >NO
13 |
14 | Please indicate if you would like to use the previously generated Binding Sites: [NO or File path]
15 | >NO
16 |
17 | Please enter the path, from your current working directory, to the input fasta file:
18 | >Validation/Validation_1_Input.fasta
19 |
20 | Please classify the contents of the input fasta file as one of the following options: [SS, MS, AMS]. Whereby:
21 | SS = Single sequence
22 | MS = Multiple unaligned sequences
23 | MAS = Multiple aligned sequences
24 |
25 | >MS
26 |
27 | If multiple sequences are present in the input fasta file (Classification of MS or MAS), please indicate below the
28 | percentage identity required for the primers and probes target binding sites:
29 | >99
30 |
31 | Please indicate if a primer identity anchor is required. [NO or length of anchor]
32 | >NO
33 |
34 | Desired primer length (This can be a range: 28-32 or fixed value: 32):
35 | >28-32
36 |
37 | Please state if you require a probe to be designed and if so what type [NO,EXO,NFO]
38 | >NO
39 |
40 | Desired probe length (This can be a range: 45-50 or fixed value: 50):
41 | >50
42 |
43 | Below please define your max amplicon length.
44 | >300
45 |
46 | Below please state the repeat nucleotide cut-off in bp (e.g. 5bp will exclude sequences containing GGGGG).
47 |
48 | >5
49 |
50 | Below please insert the minimum percentage GC content for primer/probe:
51 | >40
52 |
53 | Below please insert the maximum percentage GC content for primer/probe:
54 | >60
55 |
56 | Below please indicate the percentage match tolerance for primer-probe dimerisation and secondary structure formation:
57 | >60
58 |
59 | Please enter [No or Path to Background file] below to identify if you want to perform a background DNA binding check:
60 | >Validation/Validation_1_Background.fasta
61 |
62 | Below please insert the percentage background cross reactivity threshold:
63 | >65
64 |
65 | Below please indicate if you would like to implement a Background Hard Fail Filter [NO,YES]:
66 | >NO
67 |
68 | Please define the maximum number of sets you would like to identify:
69 | >5
70 |
71 | Please define the number of threads available:
72 | >1
73 |
74 | Blastn Cross Reactivity Search Settings [Basic or Advanced or Fast]
75 | >Fast
76 |
77 | Blastn Evalue
78 | >1000
79 |
--------------------------------------------------------------------------------
/LICENSE:
--------------------------------------------------------------------------------
1 | GNU GENERAL PUBLIC LICENSE
2 | Version 3, 29 June 2007
3 |
4 | Copyright (C) 2007 Free Software Foundation, Inc.
5 | Everyone is permitted to copy and distribute verbatim copies
6 | of this license document, but changing it is not allowed.
7 |
8 | Preamble
9 |
10 | The GNU General Public License is a free, copyleft license for
11 | software and other kinds of works.
12 |
13 | The licenses for most software and other practical works are designed
14 | to take away your freedom to share and change the works. By contrast,
15 | the GNU General Public License is intended to guarantee your freedom to
16 | share and change all versions of a program--to make sure it remains free
17 | software for all its users. We, the Free Software Foundation, use the
18 | GNU General Public License for most of our software; it applies also to
19 | any other work released this way by its authors. You can apply it to
20 | your programs, too.
21 |
22 | When we speak of free software, we are referring to freedom, not
23 | price. Our General Public Licenses are designed to make sure that you
24 | have the freedom to distribute copies of free software (and charge for
25 | them if you wish), that you receive source code or can get it if you
26 | want it, that you can change the software or use pieces of it in new
27 | free programs, and that you know you can do these things.
28 |
29 | To protect your rights, we need to prevent others from denying you
30 | these rights or asking you to surrender the rights. Therefore, you have
31 | certain responsibilities if you distribute copies of the software, or if
32 | you modify it: responsibilities to respect the freedom of others.
33 |
34 | For example, if you distribute copies of such a program, whether
35 | gratis or for a fee, you must pass on to the recipients the same
36 | freedoms that you received. You must make sure that they, too, receive
37 | or can get the source code. And you must show them these terms so they
38 | know their rights.
39 |
40 | Developers that use the GNU GPL protect your rights with two steps:
41 | (1) assert copyright on the software, and (2) offer you this License
42 | giving you legal permission to copy, distribute and/or modify it.
43 |
44 | For the developers' and authors' protection, the GPL clearly explains
45 | that there is no warranty for this free software. For both users' and
46 | authors' sake, the GPL requires that modified versions be marked as
47 | changed, so that their problems will not be attributed erroneously to
48 | authors of previous versions.
49 |
50 | Some devices are designed to deny users access to install or run
51 | modified versions of the software inside them, although the manufacturer
52 | can do so. This is fundamentally incompatible with the aim of
53 | protecting users' freedom to change the software. The systematic
54 | pattern of such abuse occurs in the area of products for individuals to
55 | use, which is precisely where it is most unacceptable. Therefore, we
56 | have designed this version of the GPL to prohibit the practice for those
57 | products. If such problems arise substantially in other domains, we
58 | stand ready to extend this provision to those domains in future versions
59 | of the GPL, as needed to protect the freedom of users.
60 |
61 | Finally, every program is threatened constantly by software patents.
62 | States should not allow patents to restrict development and use of
63 | software on general-purpose computers, but in those that do, we wish to
64 | avoid the special danger that patents applied to a free program could
65 | make it effectively proprietary. To prevent this, the GPL assures that
66 | patents cannot be used to render the program non-free.
67 |
68 | The precise terms and conditions for copying, distribution and
69 | modification follow.
70 |
71 | TERMS AND CONDITIONS
72 |
73 | 0. Definitions.
74 |
75 | "This License" refers to version 3 of the GNU General Public License.
76 |
77 | "Copyright" also means copyright-like laws that apply to other kinds of
78 | works, such as semiconductor masks.
79 |
80 | "The Program" refers to any copyrightable work licensed under this
81 | License. Each licensee is addressed as "you". "Licensees" and
82 | "recipients" may be individuals or organizations.
83 |
84 | To "modify" a work means to copy from or adapt all or part of the work
85 | in a fashion requiring copyright permission, other than the making of an
86 | exact copy. The resulting work is called a "modified version" of the
87 | earlier work or a work "based on" the earlier work.
88 |
89 | A "covered work" means either the unmodified Program or a work based
90 | on the Program.
91 |
92 | To "propagate" a work means to do anything with it that, without
93 | permission, would make you directly or secondarily liable for
94 | infringement under applicable copyright law, except executing it on a
95 | computer or modifying a private copy. Propagation includes copying,
96 | distribution (with or without modification), making available to the
97 | public, and in some countries other activities as well.
98 |
99 | To "convey" a work means any kind of propagation that enables other
100 | parties to make or receive copies. Mere interaction with a user through
101 | a computer network, with no transfer of a copy, is not conveying.
102 |
103 | An interactive user interface displays "Appropriate Legal Notices"
104 | to the extent that it includes a convenient and prominently visible
105 | feature that (1) displays an appropriate copyright notice, and (2)
106 | tells the user that there is no warranty for the work (except to the
107 | extent that warranties are provided), that licensees may convey the
108 | work under this License, and how to view a copy of this License. If
109 | the interface presents a list of user commands or options, such as a
110 | menu, a prominent item in the list meets this criterion.
111 |
112 | 1. Source Code.
113 |
114 | The "source code" for a work means the preferred form of the work
115 | for making modifications to it. "Object code" means any non-source
116 | form of a work.
117 |
118 | A "Standard Interface" means an interface that either is an official
119 | standard defined by a recognized standards body, or, in the case of
120 | interfaces specified for a particular programming language, one that
121 | is widely used among developers working in that language.
122 |
123 | The "System Libraries" of an executable work include anything, other
124 | than the work as a whole, that (a) is included in the normal form of
125 | packaging a Major Component, but which is not part of that Major
126 | Component, and (b) serves only to enable use of the work with that
127 | Major Component, or to implement a Standard Interface for which an
128 | implementation is available to the public in source code form. A
129 | "Major Component", in this context, means a major essential component
130 | (kernel, window system, and so on) of the specific operating system
131 | (if any) on which the executable work runs, or a compiler used to
132 | produce the work, or an object code interpreter used to run it.
133 |
134 | The "Corresponding Source" for a work in object code form means all
135 | the source code needed to generate, install, and (for an executable
136 | work) run the object code and to modify the work, including scripts to
137 | control those activities. However, it does not include the work's
138 | System Libraries, or general-purpose tools or generally available free
139 | programs which are used unmodified in performing those activities but
140 | which are not part of the work. For example, Corresponding Source
141 | includes interface definition files associated with source files for
142 | the work, and the source code for shared libraries and dynamically
143 | linked subprograms that the work is specifically designed to require,
144 | such as by intimate data communication or control flow between those
145 | subprograms and other parts of the work.
146 |
147 | The Corresponding Source need not include anything that users
148 | can regenerate automatically from other parts of the Corresponding
149 | Source.
150 |
151 | The Corresponding Source for a work in source code form is that
152 | same work.
153 |
154 | 2. Basic Permissions.
155 |
156 | All rights granted under this License are granted for the term of
157 | copyright on the Program, and are irrevocable provided the stated
158 | conditions are met. This License explicitly affirms your unlimited
159 | permission to run the unmodified Program. The output from running a
160 | covered work is covered by this License only if the output, given its
161 | content, constitutes a covered work. This License acknowledges your
162 | rights of fair use or other equivalent, as provided by copyright law.
163 |
164 | You may make, run and propagate covered works that you do not
165 | convey, without conditions so long as your license otherwise remains
166 | in force. You may convey covered works to others for the sole purpose
167 | of having them make modifications exclusively for you, or provide you
168 | with facilities for running those works, provided that you comply with
169 | the terms of this License in conveying all material for which you do
170 | not control copyright. Those thus making or running the covered works
171 | for you must do so exclusively on your behalf, under your direction
172 | and control, on terms that prohibit them from making any copies of
173 | your copyrighted material outside their relationship with you.
174 |
175 | Conveying under any other circumstances is permitted solely under
176 | the conditions stated below. Sublicensing is not allowed; section 10
177 | makes it unnecessary.
178 |
179 | 3. Protecting Users' Legal Rights From Anti-Circumvention Law.
180 |
181 | No covered work shall be deemed part of an effective technological
182 | measure under any applicable law fulfilling obligations under article
183 | 11 of the WIPO copyright treaty adopted on 20 December 1996, or
184 | similar laws prohibiting or restricting circumvention of such
185 | measures.
186 |
187 | When you convey a covered work, you waive any legal power to forbid
188 | circumvention of technological measures to the extent such circumvention
189 | is effected by exercising rights under this License with respect to
190 | the covered work, and you disclaim any intention to limit operation or
191 | modification of the work as a means of enforcing, against the work's
192 | users, your or third parties' legal rights to forbid circumvention of
193 | technological measures.
194 |
195 | 4. Conveying Verbatim Copies.
196 |
197 | You may convey verbatim copies of the Program's source code as you
198 | receive it, in any medium, provided that you conspicuously and
199 | appropriately publish on each copy an appropriate copyright notice;
200 | keep intact all notices stating that this License and any
201 | non-permissive terms added in accord with section 7 apply to the code;
202 | keep intact all notices of the absence of any warranty; and give all
203 | recipients a copy of this License along with the Program.
204 |
205 | You may charge any price or no price for each copy that you convey,
206 | and you may offer support or warranty protection for a fee.
207 |
208 | 5. Conveying Modified Source Versions.
209 |
210 | You may convey a work based on the Program, or the modifications to
211 | produce it from the Program, in the form of source code under the
212 | terms of section 4, provided that you also meet all of these conditions:
213 |
214 | a) The work must carry prominent notices stating that you modified
215 | it, and giving a relevant date.
216 |
217 | b) The work must carry prominent notices stating that it is
218 | released under this License and any conditions added under section
219 | 7. This requirement modifies the requirement in section 4 to
220 | "keep intact all notices".
221 |
222 | c) You must license the entire work, as a whole, under this
223 | License to anyone who comes into possession of a copy. This
224 | License will therefore apply, along with any applicable section 7
225 | additional terms, to the whole of the work, and all its parts,
226 | regardless of how they are packaged. This License gives no
227 | permission to license the work in any other way, but it does not
228 | invalidate such permission if you have separately received it.
229 |
230 | d) If the work has interactive user interfaces, each must display
231 | Appropriate Legal Notices; however, if the Program has interactive
232 | interfaces that do not display Appropriate Legal Notices, your
233 | work need not make them do so.
234 |
235 | A compilation of a covered work with other separate and independent
236 | works, which are not by their nature extensions of the covered work,
237 | and which are not combined with it such as to form a larger program,
238 | in or on a volume of a storage or distribution medium, is called an
239 | "aggregate" if the compilation and its resulting copyright are not
240 | used to limit the access or legal rights of the compilation's users
241 | beyond what the individual works permit. Inclusion of a covered work
242 | in an aggregate does not cause this License to apply to the other
243 | parts of the aggregate.
244 |
245 | 6. Conveying Non-Source Forms.
246 |
247 | You may convey a covered work in object code form under the terms
248 | of sections 4 and 5, provided that you also convey the
249 | machine-readable Corresponding Source under the terms of this License,
250 | in one of these ways:
251 |
252 | a) Convey the object code in, or embodied in, a physical product
253 | (including a physical distribution medium), accompanied by the
254 | Corresponding Source fixed on a durable physical medium
255 | customarily used for software interchange.
256 |
257 | b) Convey the object code in, or embodied in, a physical product
258 | (including a physical distribution medium), accompanied by a
259 | written offer, valid for at least three years and valid for as
260 | long as you offer spare parts or customer support for that product
261 | model, to give anyone who possesses the object code either (1) a
262 | copy of the Corresponding Source for all the software in the
263 | product that is covered by this License, on a durable physical
264 | medium customarily used for software interchange, for a price no
265 | more than your reasonable cost of physically performing this
266 | conveying of source, or (2) access to copy the
267 | Corresponding Source from a network server at no charge.
268 |
269 | c) Convey individual copies of the object code with a copy of the
270 | written offer to provide the Corresponding Source. This
271 | alternative is allowed only occasionally and noncommercially, and
272 | only if you received the object code with such an offer, in accord
273 | with subsection 6b.
274 |
275 | d) Convey the object code by offering access from a designated
276 | place (gratis or for a charge), and offer equivalent access to the
277 | Corresponding Source in the same way through the same place at no
278 | further charge. You need not require recipients to copy the
279 | Corresponding Source along with the object code. If the place to
280 | copy the object code is a network server, the Corresponding Source
281 | may be on a different server (operated by you or a third party)
282 | that supports equivalent copying facilities, provided you maintain
283 | clear directions next to the object code saying where to find the
284 | Corresponding Source. Regardless of what server hosts the
285 | Corresponding Source, you remain obligated to ensure that it is
286 | available for as long as needed to satisfy these requirements.
287 |
288 | e) Convey the object code using peer-to-peer transmission, provided
289 | you inform other peers where the object code and Corresponding
290 | Source of the work are being offered to the general public at no
291 | charge under subsection 6d.
292 |
293 | A separable portion of the object code, whose source code is excluded
294 | from the Corresponding Source as a System Library, need not be
295 | included in conveying the object code work.
296 |
297 | A "User Product" is either (1) a "consumer product", which means any
298 | tangible personal property which is normally used for personal, family,
299 | or household purposes, or (2) anything designed or sold for incorporation
300 | into a dwelling. In determining whether a product is a consumer product,
301 | doubtful cases shall be resolved in favor of coverage. For a particular
302 | product received by a particular user, "normally used" refers to a
303 | typical or common use of that class of product, regardless of the status
304 | of the particular user or of the way in which the particular user
305 | actually uses, or expects or is expected to use, the product. A product
306 | is a consumer product regardless of whether the product has substantial
307 | commercial, industrial or non-consumer uses, unless such uses represent
308 | the only significant mode of use of the product.
309 |
310 | "Installation Information" for a User Product means any methods,
311 | procedures, authorization keys, or other information required to install
312 | and execute modified versions of a covered work in that User Product from
313 | a modified version of its Corresponding Source. The information must
314 | suffice to ensure that the continued functioning of the modified object
315 | code is in no case prevented or interfered with solely because
316 | modification has been made.
317 |
318 | If you convey an object code work under this section in, or with, or
319 | specifically for use in, a User Product, and the conveying occurs as
320 | part of a transaction in which the right of possession and use of the
321 | User Product is transferred to the recipient in perpetuity or for a
322 | fixed term (regardless of how the transaction is characterized), the
323 | Corresponding Source conveyed under this section must be accompanied
324 | by the Installation Information. But this requirement does not apply
325 | if neither you nor any third party retains the ability to install
326 | modified object code on the User Product (for example, the work has
327 | been installed in ROM).
328 |
329 | The requirement to provide Installation Information does not include a
330 | requirement to continue to provide support service, warranty, or updates
331 | for a work that has been modified or installed by the recipient, or for
332 | the User Product in which it has been modified or installed. Access to a
333 | network may be denied when the modification itself materially and
334 | adversely affects the operation of the network or violates the rules and
335 | protocols for communication across the network.
336 |
337 | Corresponding Source conveyed, and Installation Information provided,
338 | in accord with this section must be in a format that is publicly
339 | documented (and with an implementation available to the public in
340 | source code form), and must require no special password or key for
341 | unpacking, reading or copying.
342 |
343 | 7. Additional Terms.
344 |
345 | "Additional permissions" are terms that supplement the terms of this
346 | License by making exceptions from one or more of its conditions.
347 | Additional permissions that are applicable to the entire Program shall
348 | be treated as though they were included in this License, to the extent
349 | that they are valid under applicable law. If additional permissions
350 | apply only to part of the Program, that part may be used separately
351 | under those permissions, but the entire Program remains governed by
352 | this License without regard to the additional permissions.
353 |
354 | When you convey a copy of a covered work, you may at your option
355 | remove any additional permissions from that copy, or from any part of
356 | it. (Additional permissions may be written to require their own
357 | removal in certain cases when you modify the work.) You may place
358 | additional permissions on material, added by you to a covered work,
359 | for which you have or can give appropriate copyright permission.
360 |
361 | Notwithstanding any other provision of this License, for material you
362 | add to a covered work, you may (if authorized by the copyright holders of
363 | that material) supplement the terms of this License with terms:
364 |
365 | a) Disclaiming warranty or limiting liability differently from the
366 | terms of sections 15 and 16 of this License; or
367 |
368 | b) Requiring preservation of specified reasonable legal notices or
369 | author attributions in that material or in the Appropriate Legal
370 | Notices displayed by works containing it; or
371 |
372 | c) Prohibiting misrepresentation of the origin of that material, or
373 | requiring that modified versions of such material be marked in
374 | reasonable ways as different from the original version; or
375 |
376 | d) Limiting the use for publicity purposes of names of licensors or
377 | authors of the material; or
378 |
379 | e) Declining to grant rights under trademark law for use of some
380 | trade names, trademarks, or service marks; or
381 |
382 | f) Requiring indemnification of licensors and authors of that
383 | material by anyone who conveys the material (or modified versions of
384 | it) with contractual assumptions of liability to the recipient, for
385 | any liability that these contractual assumptions directly impose on
386 | those licensors and authors.
387 |
388 | All other non-permissive additional terms are considered "further
389 | restrictions" within the meaning of section 10. If the Program as you
390 | received it, or any part of it, contains a notice stating that it is
391 | governed by this License along with a term that is a further
392 | restriction, you may remove that term. If a license document contains
393 | a further restriction but permits relicensing or conveying under this
394 | License, you may add to a covered work material governed by the terms
395 | of that license document, provided that the further restriction does
396 | not survive such relicensing or conveying.
397 |
398 | If you add terms to a covered work in accord with this section, you
399 | must place, in the relevant source files, a statement of the
400 | additional terms that apply to those files, or a notice indicating
401 | where to find the applicable terms.
402 |
403 | Additional terms, permissive or non-permissive, may be stated in the
404 | form of a separately written license, or stated as exceptions;
405 | the above requirements apply either way.
406 |
407 | 8. Termination.
408 |
409 | You may not propagate or modify a covered work except as expressly
410 | provided under this License. Any attempt otherwise to propagate or
411 | modify it is void, and will automatically terminate your rights under
412 | this License (including any patent licenses granted under the third
413 | paragraph of section 11).
414 |
415 | However, if you cease all violation of this License, then your
416 | license from a particular copyright holder is reinstated (a)
417 | provisionally, unless and until the copyright holder explicitly and
418 | finally terminates your license, and (b) permanently, if the copyright
419 | holder fails to notify you of the violation by some reasonable means
420 | prior to 60 days after the cessation.
421 |
422 | Moreover, your license from a particular copyright holder is
423 | reinstated permanently if the copyright holder notifies you of the
424 | violation by some reasonable means, this is the first time you have
425 | received notice of violation of this License (for any work) from that
426 | copyright holder, and you cure the violation prior to 30 days after
427 | your receipt of the notice.
428 |
429 | Termination of your rights under this section does not terminate the
430 | licenses of parties who have received copies or rights from you under
431 | this License. If your rights have been terminated and not permanently
432 | reinstated, you do not qualify to receive new licenses for the same
433 | material under section 10.
434 |
435 | 9. Acceptance Not Required for Having Copies.
436 |
437 | You are not required to accept this License in order to receive or
438 | run a copy of the Program. Ancillary propagation of a covered work
439 | occurring solely as a consequence of using peer-to-peer transmission
440 | to receive a copy likewise does not require acceptance. However,
441 | nothing other than this License grants you permission to propagate or
442 | modify any covered work. These actions infringe copyright if you do
443 | not accept this License. Therefore, by modifying or propagating a
444 | covered work, you indicate your acceptance of this License to do so.
445 |
446 | 10. Automatic Licensing of Downstream Recipients.
447 |
448 | Each time you convey a covered work, the recipient automatically
449 | receives a license from the original licensors, to run, modify and
450 | propagate that work, subject to this License. You are not responsible
451 | for enforcing compliance by third parties with this License.
452 |
453 | An "entity transaction" is a transaction transferring control of an
454 | organization, or substantially all assets of one, or subdividing an
455 | organization, or merging organizations. If propagation of a covered
456 | work results from an entity transaction, each party to that
457 | transaction who receives a copy of the work also receives whatever
458 | licenses to the work the party's predecessor in interest had or could
459 | give under the previous paragraph, plus a right to possession of the
460 | Corresponding Source of the work from the predecessor in interest, if
461 | the predecessor has it or can get it with reasonable efforts.
462 |
463 | You may not impose any further restrictions on the exercise of the
464 | rights granted or affirmed under this License. For example, you may
465 | not impose a license fee, royalty, or other charge for exercise of
466 | rights granted under this License, and you may not initiate litigation
467 | (including a cross-claim or counterclaim in a lawsuit) alleging that
468 | any patent claim is infringed by making, using, selling, offering for
469 | sale, or importing the Program or any portion of it.
470 |
471 | 11. Patents.
472 |
473 | A "contributor" is a copyright holder who authorizes use under this
474 | License of the Program or a work on which the Program is based. The
475 | work thus licensed is called the contributor's "contributor version".
476 |
477 | A contributor's "essential patent claims" are all patent claims
478 | owned or controlled by the contributor, whether already acquired or
479 | hereafter acquired, that would be infringed by some manner, permitted
480 | by this License, of making, using, or selling its contributor version,
481 | but do not include claims that would be infringed only as a
482 | consequence of further modification of the contributor version. For
483 | purposes of this definition, "control" includes the right to grant
484 | patent sublicenses in a manner consistent with the requirements of
485 | this License.
486 |
487 | Each contributor grants you a non-exclusive, worldwide, royalty-free
488 | patent license under the contributor's essential patent claims, to
489 | make, use, sell, offer for sale, import and otherwise run, modify and
490 | propagate the contents of its contributor version.
491 |
492 | In the following three paragraphs, a "patent license" is any express
493 | agreement or commitment, however denominated, not to enforce a patent
494 | (such as an express permission to practice a patent or covenant not to
495 | sue for patent infringement). To "grant" such a patent license to a
496 | party means to make such an agreement or commitment not to enforce a
497 | patent against the party.
498 |
499 | If you convey a covered work, knowingly relying on a patent license,
500 | and the Corresponding Source of the work is not available for anyone
501 | to copy, free of charge and under the terms of this License, through a
502 | publicly available network server or other readily accessible means,
503 | then you must either (1) cause the Corresponding Source to be so
504 | available, or (2) arrange to deprive yourself of the benefit of the
505 | patent license for this particular work, or (3) arrange, in a manner
506 | consistent with the requirements of this License, to extend the patent
507 | license to downstream recipients. "Knowingly relying" means you have
508 | actual knowledge that, but for the patent license, your conveying the
509 | covered work in a country, or your recipient's use of the covered work
510 | in a country, would infringe one or more identifiable patents in that
511 | country that you have reason to believe are valid.
512 |
513 | If, pursuant to or in connection with a single transaction or
514 | arrangement, you convey, or propagate by procuring conveyance of, a
515 | covered work, and grant a patent license to some of the parties
516 | receiving the covered work authorizing them to use, propagate, modify
517 | or convey a specific copy of the covered work, then the patent license
518 | you grant is automatically extended to all recipients of the covered
519 | work and works based on it.
520 |
521 | A patent license is "discriminatory" if it does not include within
522 | the scope of its coverage, prohibits the exercise of, or is
523 | conditioned on the non-exercise of one or more of the rights that are
524 | specifically granted under this License. You may not convey a covered
525 | work if you are a party to an arrangement with a third party that is
526 | in the business of distributing software, under which you make payment
527 | to the third party based on the extent of your activity of conveying
528 | the work, and under which the third party grants, to any of the
529 | parties who would receive the covered work from you, a discriminatory
530 | patent license (a) in connection with copies of the covered work
531 | conveyed by you (or copies made from those copies), or (b) primarily
532 | for and in connection with specific products or compilations that
533 | contain the covered work, unless you entered into that arrangement,
534 | or that patent license was granted, prior to 28 March 2007.
535 |
536 | Nothing in this License shall be construed as excluding or limiting
537 | any implied license or other defenses to infringement that may
538 | otherwise be available to you under applicable patent law.
539 |
540 | 12. No Surrender of Others' Freedom.
541 |
542 | If conditions are imposed on you (whether by court order, agreement or
543 | otherwise) that contradict the conditions of this License, they do not
544 | excuse you from the conditions of this License. If you cannot convey a
545 | covered work so as to satisfy simultaneously your obligations under this
546 | License and any other pertinent obligations, then as a consequence you may
547 | not convey it at all. For example, if you agree to terms that obligate you
548 | to collect a royalty for further conveying from those to whom you convey
549 | the Program, the only way you could satisfy both those terms and this
550 | License would be to refrain entirely from conveying the Program.
551 |
552 | 13. Use with the GNU Affero General Public License.
553 |
554 | Notwithstanding any other provision of this License, you have
555 | permission to link or combine any covered work with a work licensed
556 | under version 3 of the GNU Affero General Public License into a single
557 | combined work, and to convey the resulting work. The terms of this
558 | License will continue to apply to the part which is the covered work,
559 | but the special requirements of the GNU Affero General Public License,
560 | section 13, concerning interaction through a network will apply to the
561 | combination as such.
562 |
563 | 14. Revised Versions of this License.
564 |
565 | The Free Software Foundation may publish revised and/or new versions of
566 | the GNU General Public License from time to time. Such new versions will
567 | be similar in spirit to the present version, but may differ in detail to
568 | address new problems or concerns.
569 |
570 | Each version is given a distinguishing version number. If the
571 | Program specifies that a certain numbered version of the GNU General
572 | Public License "or any later version" applies to it, you have the
573 | option of following the terms and conditions either of that numbered
574 | version or of any later version published by the Free Software
575 | Foundation. If the Program does not specify a version number of the
576 | GNU General Public License, you may choose any version ever published
577 | by the Free Software Foundation.
578 |
579 | If the Program specifies that a proxy can decide which future
580 | versions of the GNU General Public License can be used, that proxy's
581 | public statement of acceptance of a version permanently authorizes you
582 | to choose that version for the Program.
583 |
584 | Later license versions may give you additional or different
585 | permissions. However, no additional obligations are imposed on any
586 | author or copyright holder as a result of your choosing to follow a
587 | later version.
588 |
589 | 15. Disclaimer of Warranty.
590 |
591 | THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY
592 | APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT
593 | HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY
594 | OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO,
595 | THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
596 | PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM
597 | IS WITH YOU. SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF
598 | ALL NECESSARY SERVICING, REPAIR OR CORRECTION.
599 |
600 | 16. Limitation of Liability.
601 |
602 | IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING
603 | WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES AND/OR CONVEYS
604 | THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY
605 | GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE
606 | USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF
607 | DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD
608 | PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS),
609 | EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF
610 | SUCH DAMAGES.
611 |
612 | 17. Interpretation of Sections 15 and 16.
613 |
614 | If the disclaimer of warranty and limitation of liability provided
615 | above cannot be given local legal effect according to their terms,
616 | reviewing courts shall apply local law that most closely approximates
617 | an absolute waiver of all civil liability in connection with the
618 | Program, unless a warranty or assumption of liability accompanies a
619 | copy of the Program in return for a fee.
620 |
621 | END OF TERMS AND CONDITIONS
622 |
623 | How to Apply These Terms to Your New Programs
624 |
625 | If you develop a new program, and you want it to be of the greatest
626 | possible use to the public, the best way to achieve this is to make it
627 | free software which everyone can redistribute and change under these terms.
628 |
629 | To do so, attach the following notices to the program. It is safest
630 | to attach them to the start of each source file to most effectively
631 | state the exclusion of warranty; and each file should have at least
632 | the "copyright" line and a pointer to where the full notice is found.
633 |
634 |
635 | Copyright (C)
636 |
637 | This program is free software: you can redistribute it and/or modify
638 | it under the terms of the GNU General Public License as published by
639 | the Free Software Foundation, either version 3 of the License, or
640 | (at your option) any later version.
641 |
642 | This program is distributed in the hope that it will be useful,
643 | but WITHOUT ANY WARRANTY; without even the implied warranty of
644 | MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
645 | GNU General Public License for more details.
646 |
647 | You should have received a copy of the GNU General Public License
648 | along with this program. If not, see .
649 |
650 | Also add information on how to contact you by electronic and paper mail.
651 |
652 | If the program does terminal interaction, make it output a short
653 | notice like this when it starts in an interactive mode:
654 |
655 | Copyright (C)
656 | This program comes with ABSOLUTELY NO WARRANTY; for details type `show w'.
657 | This is free software, and you are welcome to redistribute it
658 | under certain conditions; type `show c' for details.
659 |
660 | The hypothetical commands `show w' and `show c' should show the appropriate
661 | parts of the General Public License. Of course, your program's commands
662 | might be different; for a GUI interface, you would use an "about box".
663 |
664 | You should also get your employer (if you work as a programmer) or school,
665 | if any, to sign a "copyright disclaimer" for the program, if necessary.
666 | For more information on this, and how to apply and follow the GNU GPL, see
667 | .
668 |
669 | The GNU General Public License does not permit incorporating your program
670 | into proprietary programs. If your program is a subroutine library, you
671 | may consider it more useful to permit linking proprietary applications with
672 | the library. If this is what you want to do, use the GNU Lesser General
673 | Public License instead of this License. But first, please read
674 | .
675 |
--------------------------------------------------------------------------------
/PrimedRPA:
--------------------------------------------------------------------------------
1 | #! /usr/bin/env python3
2 |
3 | #####################################################################
4 | # PrimedRPA: RPA Primer and Probe Set Finder #
5 | # Higgins M et al. Submitted. 2018 #
6 | # #
7 | # Dependencies: #
8 | # Python 3.7
9 | # Glob 0.6
10 | # Pandas 0.20.3 #
11 | # Sys 3.6.3 #
12 | # Bio 1.70 #
13 | #####################################################################
14 |
15 |
16 | # Install neccessary python libraries
17 | import os
18 | import sys
19 | import glob
20 | import subprocess
21 | import itertools
22 | import random
23 | import pandas as pd
24 | from collections import Counter
25 | from multiprocessing import Pool
26 | import argparse
27 | import re
28 |
29 |
30 | def FastaToDict(InputFile):
31 | fastadict = {}
32 | with open(InputFile) as file_one:
33 | for line in file_one:
34 | line = line.strip()
35 | if not line:
36 | continue
37 | if line.startswith(">"):
38 | active_sequence_name = line[1:]
39 | if active_sequence_name not in fastadict:
40 | fastadict[active_sequence_name] = ''
41 | continue
42 | sequence = line
43 | # If Uracil Present, Substitute for T (I.e. stick with 4 DNA bases)
44 | fastadict[active_sequence_name] += re.sub('U','T',sequence.upper())
45 | return fastadict
46 |
47 |
48 |
49 | # Wrapper for clustal omega
50 | def RunningClustalo1(ClustalOPath,
51 | ListOfFileNames,
52 | overwriteOutput=True):
53 |
54 | print('Aligning Input File')
55 | for FileName in ListOfFileNames:
56 | OutputName = FileName.replace(".fasta",'_Aligned.fasta')
57 | command = "{0} -i {1} -o {2} --outfmt=fasta".format(ClustalOPath,FileName, OutputName)
58 | result = subprocess.call([command], stdout=subprocess.PIPE, shell=True,)
59 |
60 |
61 | # Function to generate reverse complement sequence
62 | def getComplement(seq,
63 | reverse=False,
64 | rule='N2N'):
65 |
66 | seqComp = ""
67 | for base in seq.upper():
68 | base = base.upper()
69 | if base == "A":
70 | seqComp += "T"
71 | elif base == "T":
72 | seqComp += "A"
73 | elif base == "C":
74 | seqComp += "G"
75 | elif base == "G":
76 | seqComp += "C"
77 | elif base == 'U':
78 | seqComp += "A"
79 | elif base == "N":
80 | if rule == 'N2-':
81 | seqComp += '-'
82 | elif rule == 'N2N':
83 | seqComp += "N"
84 | elif base == "-":
85 | seqComp += "N"
86 |
87 | # If Character not any of above assign it as N
88 | else:
89 | seqComp += "N"
90 |
91 | if reverse:
92 | return(seqComp[::-1])
93 | else:
94 | return(seqComp)
95 |
96 |
97 |
98 | ## Background Binding Check = TO IMPROVE
99 | def BlastnBackgroundCheck(seq,AllParameter):
100 |
101 |
102 | MaxBackgroundScoreBindingScore = 0
103 | MaxScoreBackSeq = ''
104 | HardFailBoolean = False
105 |
106 | RIS = str(random.randint(0,1000000))
107 |
108 |
109 | #Create temp fasta file
110 | tempfastainput = open('./{}/{}_{}_Blastn_Input.fa'.format(AllParameter.PrimerBlastnOutput,seq,RIS),'w')
111 | tempfastainput.write('>Temp_Blastn_Fasta\n{}\n'.format(seq))
112 | tempfastainput.close()
113 |
114 |
115 | # Parameters default for basic run
116 | Penalty = '-2'
117 | WordSize = '4'
118 | if AllParameter.BackgroundSearchSensitivity == 'Advanced':
119 | Penalty = '-1'
120 |
121 | elif AllParameter.BackgroundSearchSensitivity == 'Fast':
122 | Penalty = '-3'
123 | WordSize = '7'
124 |
125 |
126 |
127 | #Triggure Blastn command
128 | blastncommandrun = '{0} -word_size {5} -gapopen 5 -gapextend 2 -reward 1 -penalty {4} -evalue {7} -query {3}/{1}_{6}_Blastn_Input.fa -db {2}/{2} -out {3}/{1}_{6}_Blastn_Output.csv -outfmt "10 sseqid pident qstart qend sstart send evalue gaps sstrand" '.format(AllParameter.BlastnPath,
129 | seq,
130 | AllParameter.BlastnDBName,
131 | AllParameter.PrimerBlastnOutput,
132 | Penalty,
133 | WordSize,
134 | RIS,
135 | AllParameter.Evalue)
136 |
137 |
138 |
139 | subprocess.call([blastncommandrun],shell=True)
140 |
141 | # Remove Blastn Input File
142 | os.remove('./{}/{}_{}_Blastn_Input.fa'.format(AllParameter.PrimerBlastnOutput,seq,RIS))
143 |
144 | # Try to read dataframe (may be empty if no alignments found)
145 | try:
146 |
147 | ShorterBackground = False
148 |
149 | blastnoutdf = pd.read_csv('{}/{}_{}_Blastn_Output.csv'.format(AllParameter.PrimerBlastnOutput,seq,RIS),header=None)
150 | blastnoutdf.columns=['Background_SeqID','Percentage Identity','qStart','qEnd','BackSeq_Start','BackSeq_End','Evalue','Number Of Gaps','Strand']
151 | blastnoutdf['Cross Reactivity Score'] = ((((blastnoutdf['qEnd']+1) - blastnoutdf['qStart'])*(blastnoutdf['Percentage Identity']/100))/len(seq))*100
152 | blastnoutdf = blastnoutdf.sort_values(by=['Cross Reactivity Score'],ascending=False)
153 |
154 |
155 | for blastoutindex in blastnoutdf.index.tolist():
156 |
157 | ReferenceID = blastnoutdf.loc[blastoutindex,'Background_SeqID']
158 | if ReferenceID.count("|") == 2:
159 | CleanRefID = ReferenceID[ReferenceID.find("|")+1:-1]
160 | else:
161 | CleanRefID = ReferenceID
162 |
163 | # If Background Seq Is (+) Sense
164 | if blastnoutdf.loc[blastoutindex,'Strand']=='plus':
165 |
166 | UpperExtension = (len(seq)-blastnoutdf.loc[blastoutindex,'qEnd']) + blastnoutdf.loc[blastoutindex,'BackSeq_End']
167 | LowerExtension = blastnoutdf.loc[blastoutindex,'BackSeq_Start'] - blastnoutdf.loc[blastoutindex,'qStart']+1
168 |
169 | if LowerExtension<0:
170 | LowerExtension = 0
171 | ShorterBackground = True
172 |
173 | SamToolsCommand = '{} faidx {} {}:{}-{} -o Adv_{}_{}_{}.fa'.format(AllParameter.SamtoolsPath,
174 | AllParameter.BackgroundCheck,
175 | CleanRefID,
176 | LowerExtension,
177 | UpperExtension,
178 | seq,
179 | CleanRefID,
180 | RIS)
181 |
182 | # If Background Seq Is (-) Sense
183 | else:
184 | UpperExtension = blastnoutdf.loc[blastoutindex,'BackSeq_Start'] + blastnoutdf.loc[blastoutindex,'qStart']-1
185 | LowerExtension = blastnoutdf.loc[blastoutindex,'BackSeq_End'] - (len(seq)-blastnoutdf.loc[blastoutindex,'qEnd'])
186 |
187 |
188 | if LowerExtension<0:
189 | LowerExtension = 0
190 | ShorterBackground = True
191 |
192 | SamToolsCommand = '{} faidx -i {} {}:{}-{} -o Adv_{}_{}_{}.fa'.format(AllParameter.SamtoolsPath,
193 | AllParameter.BackgroundCheck,
194 | CleanRefID,
195 | LowerExtension,
196 | UpperExtension,
197 | seq,
198 | CleanRefID,
199 | RIS)
200 |
201 | # Run Samtools Command
202 | subprocess.call([SamToolsCommand],shell=True,stdout=subprocess.DEVNULL,stderr=subprocess.DEVNULL)
203 |
204 | # Obtain Sequence
205 | fastadict = FastaToDict('Adv_{}_{}_{}.fa'.format(seq,CleanRefID,RIS))
206 |
207 | # Extract Sequence & Complement
208 | ExtraSeq = list(fastadict.values())[0]
209 | ComplementSeq = getComplement(ExtraSeq)
210 |
211 | # Bug Fix 2020-07-06 - I.e. Only run if global alignment is complete
212 | if len(ComplementSeq) == len(seq):
213 |
214 |
215 | # Run SS Check Function
216 | BackgroundMaxBindingPercentage, BackgroundMaxBindingString, BackgroundHardFail, BackgroundString = SSIdentification(seq, ComplementSeq, False, ShorterBackground)
217 |
218 | # Add to Blastn DataFrame
219 | blastnoutdf.loc[blastoutindex,'Advanced Cross Reactivity Percentage'] = BackgroundMaxBindingPercentage
220 | blastnoutdf.loc[blastoutindex,'Advanced Cross Reactivity Percentage String'] = BackgroundMaxBindingString
221 | blastnoutdf.loc[blastoutindex,'Cross Reactivity Hard Fail'] = BackgroundHardFail
222 | blastnoutdf.loc[blastoutindex,'Cross Reactivity Hard Fail String'] = BackgroundString
223 |
224 |
225 | # Remove Advance Samtools Generated String
226 | os.remove('Adv_{}_{}_{}.fa'.format(seq,CleanRefID,RIS))
227 |
228 | # Remove Raw Blastn Output
229 | os.remove('{}/{}_{}_Blastn_Output.csv'.format(AllParameter.PrimerBlastnOutput,seq,RIS))
230 |
231 | # Save Clean Blast Output
232 | blastnoutdf = blastnoutdf.sort_values(by=['Advanced Cross Reactivity Percentage'],ascending=False)
233 | blastnoutdf.to_csv('{}/{}_Blastn_Output.csv'.format(AllParameter.PrimerBlastnOutput,seq),index=None)
234 | IndexOfInterest = blastnoutdf.index.tolist()[0]
235 |
236 | MaximumPercentageMatch = blastnoutdf.loc[IndexOfInterest,'Advanced Cross Reactivity Percentage']
237 | MaxHomologyBackgroundSeq = blastnoutdf.iloc[IndexOfInterest,0]
238 |
239 |
240 | if True in blastnoutdf['Cross Reactivity Hard Fail'].unique():
241 | HardFailBoolean = True
242 |
243 |
244 | # If dataframe empty e.g. no alignments at all
245 | except pd.errors.EmptyDataError:
246 | MaximumPercentageMatch = 0
247 |
248 | if MaximumPercentageMatch > MaxBackgroundScoreBindingScore:
249 | MaxBackgroundScoreBindingScore = MaximumPercentageMatch
250 | MaxScoreBackSeq = MaxHomologyBackgroundSeq
251 |
252 |
253 | return (MaxBackgroundScoreBindingScore, MaxScoreBackSeq, HardFailBoolean)
254 |
255 |
256 | # Creates Exo Fluorescent Probe
257 | def RunFluroProbeAnalysis(ProbeBindingSeq):
258 |
259 | minIndexPosition = int(len(ProbeBindingSeq)*0.45)
260 | maxIndexPosition = int(len(ProbeBindingSeq)*0.75)
261 |
262 | ProbeValidPass = False
263 | basenumber = 0
264 | proberegionlength = len(ProbeBindingSeq)
265 | for base in ProbeBindingSeq:
266 | if (basenumber + 4) < proberegionlength:
267 | basenumber += 1
268 | if minIndexPosition < basenumber < maxIndexPosition and base == "T":
269 | if (basenumber + 2) < proberegionlength:
270 | if ProbeBindingSeq[(basenumber+2)] == "T" or ProbeBindingSeq[(basenumber+3)] == "T":
271 | # State that probe seq passed in forward sense.
272 | ProbeValidPass = True
273 | # New Break For Loop
274 | break
275 | return ProbeValidPass
276 |
277 |
278 | # Secondary Structure Filter
279 | def SSIdentification(SeqOne, SeqTwo, ReverseOrientation, FixedBack=False ,threshold=4):
280 |
281 | # Nucleotide Dict
282 | NucDict = {'A':'T',
283 | 'T':'A',
284 | 'C':'G',
285 | 'G':'C',
286 | }
287 |
288 | # Maximum Binding sites
289 | MaxBindingSites = 0
290 | MaxBindingString = ''
291 | MaxBindingPercentage = 0
292 |
293 | # Hard Fail Sites
294 | MaxHardFailScore = 0
295 | HardFail = False
296 | HardFailString = ''
297 |
298 | # Max length of string according to shift.
299 | MaxLength = len(SeqOne) + len(SeqTwo) - 1
300 |
301 | # Add white space to end of sequences
302 | SeqOneNorm = SeqOne + ' '*(MaxLength-len(SeqOne))
303 | SeqTwoNorm = SeqTwo + ' '*(MaxLength-len(SeqTwo))
304 | SeqTwoReversed = SeqTwo[::-1] + ' '*(MaxLength-len(SeqTwo))
305 |
306 |
307 | if ReverseOrientation == True:
308 | CombosToCheck = [(SeqTwoNorm,SeqOneNorm),
309 | (SeqOneNorm,SeqTwoNorm),
310 | (SeqOneNorm,SeqTwoReversed),
311 | (SeqTwoReversed,SeqOneNorm)]
312 | else:
313 | CombosToCheck = [(SeqTwoNorm,SeqOneNorm),
314 | (SeqOneNorm,SeqTwoNorm)]
315 |
316 |
317 |
318 |
319 | # Loop through var pairs whereby the first element will be shifted
320 | for VarPair in CombosToCheck:
321 |
322 | # Loop through possible shift positions
323 | for i in list(range(VarPair[0].count(' ')+1)):
324 |
325 |
326 | if i == 0:
327 | DynamicSeq = VarPair[0]
328 | else:
329 | DynamicSeq = ' '*i + VarPair[0][:-i]
330 |
331 | DyanimicSeqList = list(DynamicSeq)
332 | FixedSeqList = list(VarPair[1])
333 |
334 |
335 | # This shall house the syntax to represent binding
336 | PossibleBindingString = ''
337 |
338 | for StringPos in list(range(len(DyanimicSeqList))):
339 | if DyanimicSeqList[StringPos] in list(NucDict.keys()):
340 | if NucDict[DyanimicSeqList[StringPos]] == FixedSeqList[StringPos]:
341 | PossibleBindingString += '|'
342 | else:
343 | PossibleBindingString += '-'
344 | else:
345 | PossibleBindingString += '-'
346 |
347 | NumberOfBindingMatches = PossibleBindingString.count('|')
348 | CompleteBindingString = DynamicSeq + '\n' + PossibleBindingString + '\n' + VarPair[1]
349 |
350 |
351 | # Fixed String
352 | if VarPair[1] == SeqOneNorm:
353 | FiveIndex = 0
354 | ThreeIndex = len(SeqOne)
355 |
356 | # Dyamic String
357 | else:
358 | FiveIndex = i
359 | ThreeIndex = i + len(SeqOne)
360 |
361 |
362 | UpperLimit = FiveIndex+22
363 | LowerLimit = ThreeIndex-22
364 | if LowerLimit <0:
365 | LowerLimit = 0
366 |
367 |
368 | # Determine 5 Prime Counts
369 | FivePrimeCounts = PossibleBindingString[FiveIndex:UpperLimit]
370 |
371 | # Determine 3 Prime Counts
372 | ThreePrimeCounts = PossibleBindingString[LowerLimit:ThreeIndex]
373 |
374 |
375 | weightings = [3,2,1.5]
376 | ThreePrimeLoc = [-1,-2,-3]
377 | FivePrimeLoc = [0,1,2]
378 |
379 |
380 | OriginalScore = [FivePrimeCounts,ThreePrimeCounts]
381 | IndexLocations = [FivePrimeLoc,ThreePrimeLoc]
382 |
383 | AdjustedWeights = []
384 | for ib in [0,1]:
385 | TempScore = OriginalScore[ib].count('|') - OriginalScore[ib].count('-')
386 | Indexes = IndexLocations[ib]
387 | for iz in list(zip(Indexes,weightings)):
388 | if OriginalScore[ib][iz[0]] == '|':
389 | TempScore += iz[1] - 1
390 | AdjustedWeights.append(TempScore)
391 |
392 | if max(AdjustedWeights) >= 21.5:
393 | HardFail = True
394 | HardFailString = CompleteBindingString
395 |
396 |
397 | if MaxBindingSites < NumberOfBindingMatches:
398 | MaxBindingSites = NumberOfBindingMatches
399 | MaxBindingString = CompleteBindingString
400 |
401 | if FixedBack == False:
402 | Denom = min([len(SeqOne),len(SeqTwo)])
403 | else:
404 | Denom = len(SeqOne)
405 |
406 | MaxBindingPercentage = (MaxBindingSites/Denom)*100
407 |
408 | return (MaxBindingPercentage,MaxBindingString, HardFail, HardFailString)
409 |
410 |
411 |
412 |
413 |
414 | # Creating Alignment DF Multithread Function
415 | def CreatingInputHomologyDF(fastadict,FastaIndexList):
416 | AlignedDF = pd.DataFrame()
417 |
418 | for seqindex in FastaIndexList:
419 | TempNucleotides = []
420 | for faseq in fastadict.values():
421 | TempNucleotides.append(faseq[seqindex])
422 |
423 | # Remove NoN-specific Nucleotides = IUPAC designated the symbols for nucleotides
424 | TempNucleotides = [TN for TN in TempNucleotides if TN not in ['W','S','M',
425 | 'K','R','Y',
426 | 'N']]
427 | if (len(TempNucleotides) == 2 and
428 | '-' in TempNucleotides):
429 | MostCommonN = '-'
430 | NRepresentation = -100 #Harsh weighting against splits
431 | else:
432 | BugFix = Counter(TempNucleotides)
433 | MostCommonN = max(TempNucleotides, key=BugFix.get)
434 | if MostCommonN == '-':
435 | NRepresentation = -100 #Harsh weighting against splits
436 | else:
437 | NRepresentation = TempNucleotides.count(MostCommonN)/len(TempNucleotides)
438 | AlignedDF = AlignedDF.append({'Index_Pos':seqindex,'Nucleotide':MostCommonN,'IdentityScore':NRepresentation},ignore_index=True)
439 |
440 |
441 | return AlignedDF
442 |
443 |
444 | def IndentifyingAndFilteringOligos(AllParameter,
445 | AlignedDF,
446 | PossibleStartIndexes):
447 |
448 |
449 | OligoDF = pd.DataFrame()
450 | TargetSiteLengths = [AllParameter.PrimerLength]
451 | if AllParameter.ProbeRequired in ['EXO','NFO']:
452 | TargetSiteLengths.append(AllParameter.ProbeLength)
453 |
454 | # Loop through primer or probe
455 | for TSLP in TargetSiteLengths:
456 | if TSLP == AllParameter.PrimerLength:
457 | OligoType = 'Primer'
458 | else:
459 | OligoType = 'Probe'
460 |
461 | # Add in ability to handle specified range or primer or probe values.
462 | if '-' in str(TSLP):
463 | TSLRangePrior = [int(TSLI) for TSLI in TSLP.split('-')]
464 | TSLList = list(range(TSLRangePrior[0],TSLRangePrior[1]+1))
465 |
466 | else:
467 | TSLList = [int(TSLP)]
468 |
469 | # Loop through possible oligo lengths.
470 | for TSL in TSLList:
471 |
472 | # Loop through possible start sites
473 | for i in PossibleStartIndexes:
474 |
475 | # Make Sure dont go too far out of dataframe
476 | if i+TSL=i)&(AlignedDF['Index_Pos']<=(i+TSL-1))]
479 | MeanHomologyScore = DFSubSet['IdentityScore'].mean()
480 |
481 |
482 | IDSList = DFSubSet['IdentityScore'].tolist()
483 | OutIDScore = []
484 | for IDSO in [IDSList,IDSList[::-1]]:
485 | IDScore = 0
486 | for SCI in list(range(len(IDSO))):
487 | if float(IDSO[SCI]) == 1.0:
488 | IDScore +=1
489 | else:
490 | break
491 | OutIDScore.append(IDScore)
492 |
493 |
494 | ThreePrimeIdentityScore = OutIDScore[1]
495 | FivePrimerIdentityScore = OutIDScore[0]
496 |
497 |
498 | if MeanHomologyScore >= AllParameter.IdentityThreshold:
499 | NucleotideSeq = ''.join(DFSubSet['Nucleotide'].tolist())
500 | NucleotideSeq = NucleotideSeq.upper()
501 |
502 | #Check Length of Oligo
503 | if len(NucleotideSeq) == TSL:
504 |
505 | # Assess GC Content
506 | GCPercentage = ((NucleotideSeq.count('G') + NucleotideSeq.count('C'))/len(NucleotideSeq))*100
507 | if (GCPercentage < AllParameter.MaxGC and GCPercentage > AllParameter.MinGC):
508 |
509 | # Assess Repeat Nucleotide
510 | NoRepeat = True
511 | for RROI in ['N','A','G','C','T']:
512 | RROIString = RROI * AllParameter.NucleotideRepeatLimit
513 | if RROIString in NucleotideSeq:
514 | NoRepeat = False
515 |
516 | if NoRepeat == True:
517 |
518 | # Run Secondary Structure Check / Self Dimerisation
519 | SDSSFilterPass=True
520 | MaxBindingSites, MaxBindingString, IgnoreThresh, IgnoreString = SSIdentification(NucleotideSeq,NucleotideSeq,True)
521 | if MaxBindingSites > AllParameter.DimerisationThresh:
522 | SDSSFilterPass=False
523 |
524 |
525 | if SDSSFilterPass == True:
526 | # Define row dictionary if passed all above stages
527 | RowDict = {'Oligo_Sequence':NucleotideSeq,
528 | 'Oligo_Type':OligoType,
529 | 'Binding_Site_Start_Index':i,
530 | 'Oligo_Length':TSL,
531 | 'Identity_Score':MeanHomologyScore,
532 | 'GC_Content': GCPercentage,
533 | 'Dimerisation Percentage Score':MaxBindingSites,
534 | 'Dimerisation String':MaxBindingString,
535 | '3 prime conserved identity':ThreePrimeIdentityScore,
536 | '5 prime conserved identity':FivePrimerIdentityScore}
537 |
538 | # Assess if Specific Probe Check is Needed.
539 | ProbePass = True
540 | if OligoType == 'Probe':
541 |
542 | # Run Specific Exo Probe Checks
543 | if AllParameter.ProbeRequired == 'EXO':
544 | ProbePass = RunFluroProbeAnalysis(NucleotideSeq)
545 |
546 |
547 | if ProbePass == True:
548 |
549 | # Add Run Blastn Check
550 | BlastnPass = True
551 | #If Background Check Neccessary Look To Change Blastn pass
552 | if AllParameter.BackgroundCheck.upper() != 'NO':
553 |
554 | # Run Blastn Check And If Passess Write Out Set
555 | MaxBackgroundScoreBindingScore, MaxScoreBackSeq, HardFailBool = BlastnBackgroundCheck(NucleotideSeq, AllParameter)
556 |
557 |
558 | # Check to see if Max Binding Score Less Than Threshold
559 | if MaxBackgroundScoreBindingScore > AllParameter.CrossReactivityThresh:
560 | BlastnPass = False
561 |
562 |
563 | else:
564 | RowDict['Max Background Cross Reactivity Score'] = MaxBackgroundScoreBindingScore
565 | RowDict['Max Background Cross Reactivity SeqID'] = MaxScoreBackSeq
566 |
567 |
568 | ## NEW NEW NEW ## - Check to see if oligo type is primer and then if it failed the hard-fail setting - Possible add parameter into this check as well
569 | if (HardFailBool == True and OligoType == 'Primer' and AllParameter.HardCrossReactFilter!='NO'):
570 | BlastnPass = False
571 |
572 |
573 | # If it passed Background Filtering
574 | if BlastnPass == True:
575 | OligoDF = OligoDF.append(RowDict,ignore_index=True)
576 |
577 | # Return Primer/Probe DataFrame
578 | return OligoDF
579 |
580 |
581 | def ComboIdentifyier(PrimerSS,ReversePrimerSS,ProbeSS,AllParameter,PassedOligos,FPrimerL,RPrimerL,ProbeL):
582 |
583 | PassedSetsDataFrame = pd.DataFrame()
584 | CombosList = []
585 |
586 | for FP in PrimerSS:
587 |
588 | # If Probe Required
589 | if AllParameter.ProbeRequired in ['EXO','NFO']:
590 | Probes = [prss for prss in ProbeSS if (prss >= (FP+FPrimerL) and
591 | prss<= (FP+AllParameter.AmpliconSizeLimit-RPrimerL-ProbeL))]
592 |
593 | for Probe in Probes:
594 | ReversePrimers = [rpss for rpss in ReversePrimerSS if (rpss >= (Probe+ProbeL) and
595 | rpss <= (FP+AllParameter.AmpliconSizeLimit-RPrimerL))]
596 |
597 | CombosList += list(itertools.product([FP],ReversePrimers,[Probe]))
598 |
599 | # Probe Not Required
600 | else:
601 | ReversePrimers = [rpss for rpss in ReversePrimerSS if (rpss >= (FP+FPrimerL) and
602 | rpss <= (FP+AllParameter.AmpliconSizeLimit-RPrimerL))]
603 |
604 | CombosList += list(itertools.product([FP],ReversePrimers))
605 |
606 |
607 | # Extract Valid Primer-Probe Combos
608 | for Combo in CombosList:
609 | # Identify Indexes
610 | FPIndex = PassedOligos[(PassedOligos['Oligo_Type']=='Primer')&(PassedOligos['Oligo_Length']==FPrimerL)&(PassedOligos['Binding_Site_Start_Index']==Combo[0])].index.tolist()[0]
611 | RPIndex = PassedOligos[(PassedOligos['Oligo_Type']=='Primer')&(PassedOligos['Oligo_Length']==RPrimerL)&(PassedOligos['Binding_Site_Start_Index']==Combo[1])].index.tolist()[0]
612 |
613 |
614 | # Extract Combo Primer Sequences - (Reverse Complement RP)
615 | ComboSeqList = [PassedOligos.loc[FPIndex,'Oligo_Sequence'],getComplement(PassedOligos.loc[RPIndex,'Oligo_Sequence'],True)]
616 |
617 | # Add Probe Sequence If Necessary
618 | if AllParameter.ProbeRequired in ['EXO','NFO']:
619 | ProbeIndex = PassedOligos[(PassedOligos['Oligo_Type']=='Probe')&(PassedOligos['Oligo_Length']==ProbeL)&(PassedOligos['Binding_Site_Start_Index']==Combo[2])].index.tolist()[0]
620 | ComboSeqList.append(PassedOligos.loc[ProbeIndex,'Oligo_Sequence'])
621 |
622 |
623 | #Run Dimerisation Check And If Passess Continue
624 | DimerisationPass = True
625 | MaxComboSSScore = 0
626 | MaxComboSSString = ''
627 | for SSSCombo in list(itertools.combinations(ComboSeqList,r=2)):
628 | SSMaxBindingSites, SSMaxBindingString, IgnoreThresh, IgnoreString = SSIdentification(SSSCombo[0],SSSCombo[1],True)
629 |
630 | if SSMaxBindingSites > MaxComboSSScore:
631 | MaxComboSSScore = SSMaxBindingSites
632 | MaxComboSSString = SSMaxBindingString
633 |
634 |
635 | if MaxComboSSScore > AllParameter.DimerisationThresh:
636 | DimerisationPass = False
637 |
638 | if DimerisationPass == True:
639 |
640 | BlastnPass = True ### REMOVE INDEX AT LATER DATE
641 |
642 |
643 | # Add Everything To DF If Passed All Parameters
644 | if BlastnPass == True:
645 |
646 | PassedComboRow = {'Forward Primer (FP)':ComboSeqList[0],
647 | 'FP GC%': PassedOligos.loc[FPIndex,'GC_Content'],
648 | 'FP Binding Start Site': PassedOligos.loc[FPIndex,'Binding_Site_Start_Index'],
649 | 'Reverse Primer (RP)': ComboSeqList[1],
650 | 'RP GC%': PassedOligos.loc[RPIndex,'GC_Content'],
651 | 'RP Binding Start Site': PassedOligos.loc[RPIndex,'Binding_Site_Start_Index'],
652 | 'Amplicon Size': PassedOligos.loc[RPIndex,'Binding_Site_Start_Index'] + RPrimerL - PassedOligos.loc[FPIndex,'Binding_Site_Start_Index'],
653 | 'Max Dimerisation Percentage Score':SSMaxBindingSites,
654 | 'Max Dimerisation String':MaxComboSSString,
655 | 'Forward Primer Length':FPrimerL,
656 | 'Reverse Primer Length':RPrimerL,
657 | "Minimum Primer 3' Identity Anchor": min([PassedOligos.loc[RPIndex,'5 prime conserved identity'], PassedOligos.loc[FPIndex,'3 prime conserved identity']])
658 | }
659 |
660 | MaxBackgroundScoresIndexes = [FPIndex,RPIndex]
661 |
662 | if AllParameter.ProbeRequired in ['EXO','NFO']:
663 | PassedComboRow['Probe (P)'] = ComboSeqList[2]
664 | PassedComboRow['Probe GC%'] = PassedOligos.loc[ProbeIndex,'GC_Content']
665 | PassedComboRow['Probe Binding Start Site'] = PassedOligos.loc[ProbeIndex,'Binding_Site_Start_Index']
666 | PassedComboRow['Probe Length'] = ProbeL
667 | MaxBackgroundScoresIndexes.append(ProbeIndex)
668 |
669 |
670 | if AllParameter.BackgroundCheck != 'NO':
671 |
672 | MaxBackgroundScoreBindingScore = 0
673 | MaxScoreBackSeq = ''
674 | for SucIndex in MaxBackgroundScoresIndexes:
675 | if PassedOligos.loc[SucIndex,'Max Background Cross Reactivity Score'] > MaxBackgroundScoreBindingScore:
676 | MaxBackgroundScoreBindingScore = PassedOligos.loc[SucIndex,'Max Background Cross Reactivity Score']
677 | MaxScoreBackSeq = PassedOligos.loc[SucIndex,'Max Background Cross Reactivity SeqID']
678 |
679 |
680 | PassedComboRow['Max Background Cross Reactivity Score'] = MaxBackgroundScoreBindingScore
681 | PassedComboRow['Max Background Binding Seq'] = MaxScoreBackSeq
682 |
683 |
684 | # Add Passed Row To DataFrame
685 | PassedSetsDataFrame = PassedSetsDataFrame.append(PassedComboRow,ignore_index=True)
686 |
687 | return PassedSetsDataFrame
688 |
689 | # Main Function To Generate Primer - Probe Combos
690 | def CheckingAlignedOutputFile(AllParameter):
691 |
692 |
693 | # Check If Binding Sites Already Exist
694 | if AllParameter.PriorBindingSite != 'NO':
695 |
696 | print('Reading In Oligo Binding Sites')
697 |
698 | PassedOligos = pd.read_csv('{}'.format(AllParameter.PriorBindingSite))
699 |
700 |
701 | # Filter on Parameters Passed In
702 | PassedOligos = PassedOligos[(PassedOligos['GC_Content']>=AllParameter.MinGC)&
703 | (PassedOligos['GC_Content']<=AllParameter.MaxGC)&
704 | (PassedOligos['Dimerisation Percentage Score']<=AllParameter.DimerisationThresh)&
705 | (PassedOligos['Identity_Score']>=AllParameter.IdentityThreshold)]
706 |
707 |
708 | # Filter on Primer + Probe Ranges - (Tidy Up At Later Date)
709 | PPLengthDict = {}
710 | PrimerRange=False
711 | ProbeRange = False
712 | for LL in [AllParameter.PrimerLength,AllParameter.ProbeLength]:
713 | if LL == AllParameter.PrimerLength:
714 | LLType = 'Primer'
715 | else:
716 | LLType = 'Probe'
717 |
718 | if '-' in str(LL):
719 | LLRangePrior = [int(LLLI.strip()) for LLLI in LL.split('-')]
720 | PPLengthDict['{}_Max'.format(LLType)] = max(LLRangePrior)
721 | PPLengthDict['{}_Min'.format(LLType)] = min(LLRangePrior)
722 | if LLType == 'Primer':
723 | PrimerRange = True
724 | else:
725 | ProbeRange = True
726 | else:
727 | PPLengthDict['{}_Len'.format(LLType)] = int(LL)
728 |
729 |
730 | if PrimerRange == True:
731 | PrimerPassedSubet = PassedOligos[(PassedOligos['Oligo_Type']=='Primer') &
732 | (PassedOligos['Oligo_Length']>=PPLengthDict['Primer_Min']) &
733 | (PassedOligos['Oligo_Length']<=PPLengthDict['Primer_Max']) ]
734 | else:
735 | PrimerPassedSubet = PassedOligos[(PassedOligos['Oligo_Type']=='Primer') &
736 | (PassedOligos['Oligo_Length']==PPLengthDict['Primer_Len'])]
737 |
738 |
739 | if ProbeRange == True:
740 | ProbePassedSubet = PassedOligos[(PassedOligos['Oligo_Type']=='Probe') &
741 | (PassedOligos['Oligo_Length']>=PPLengthDict['Probe_Min']) &
742 | (PassedOligos['Oligo_Length']<=PPLengthDict['Probe_Max']) ]
743 |
744 |
745 | else:
746 | ProbePassedSubet = PassedOligos[(PassedOligos['Oligo_Type']=='Probe') &
747 | (PassedOligos['Oligo_Length']==PPLengthDict['Probe_Len'])]
748 |
749 |
750 | PassedOligos = pd.concat([PrimerPassedSubet,ProbePassedSubet]).reset_index().drop(['index'],axis=1)
751 |
752 |
753 | # If Background Check is Present filter
754 | if AllParameter.BackgroundCheck != 'NO':
755 | PassedOligos = PassedOligos[PassedOligos['Max Background Cross Reactivity Score']<=AllParameter.CrossReactivityThresh]
756 |
757 |
758 | ##Check If No Primers Passed Subset
759 | if len(PrimerPassedSubet)==0:
760 | print('No Oligos Passed Filtering')
761 | sys.exit()
762 |
763 | if AllParameter.ProbeRequired!='NO':
764 | if len(ProbePassedSubet)==0:
765 | print('No Oligos Passed Filtering')
766 | sys.exit()
767 |
768 |
769 | #Create Binding DataFrame If It Doesnt Exist
770 | else:
771 |
772 | # Load In User Specified
773 | if AllParameter.PriorAlign != 'NO':
774 | print('Reading Alignment Summary')
775 | MergedAlignedDF = pd.read_csv('{}'.format(AllParameter.PriorAlign))
776 | HDFLST = list(range(len(MergedAlignedDF)))
777 | HomoDFInputIndexBlocks = [HDFLST[i:i + AllParameter.Threads] for i in range(0, len(HDFLST), AllParameter.Threads)]
778 |
779 |
780 | # Create Alignment DF if it doesnt exist
781 | else:
782 | print('Generating Alignment Summary')
783 |
784 |
785 | # Read in the aligned fasta sequences
786 | fastadict = FastaToDict(AllParameter.InputFile)
787 |
788 | # Extract Alignment Length and QC
789 | FirstSeq = True
790 | FastaSeqLength = 0
791 | for fastaseq in fastadict.values():
792 | if FirstSeq == True:
793 | FastaSeqLength = len(fastaseq)
794 | FirstSeq = False
795 | if len(fastaseq) != FastaSeqLength:
796 | sys.exit('ERROR: Alignment file error length of all sequences is not equal')
797 |
798 |
799 | # Generate Neccessary Alignment Summary DF
800 | HDFLST = list(range(FastaSeqLength))
801 | HomoDFInputIndexBlocks = [HDFLST[i:i + AllParameter.Threads] for i in range(0, len(HDFLST), AllParameter.Threads)]
802 | MTDFOVI = list(zip([fastadict]*len(HomoDFInputIndexBlocks),HomoDFInputIndexBlocks))
803 |
804 |
805 | with Pool(processes=AllParameter.Threads) as pool:
806 | AlignedDFMultiThreadOupt = pool.starmap(CreatingInputHomologyDF,MTDFOVI)
807 | MergedAlignedDF = pd.concat(AlignedDFMultiThreadOupt).reset_index().drop(['index'],axis=1)
808 | MergedAlignedDF = MergedAlignedDF.sort_values(by=['Index_Pos'])
809 | MergedAlignedDF.to_csv('{}_Alignment_Summary.csv'.format(AllParameter.RunID),index=None)
810 |
811 |
812 | print('Generating Primer/Probe Binding Site DataFrame')
813 | # Generating Primer/Probe Binding Site DataFrame
814 | PrimerProbeCheckParallelInput = list(zip([AllParameter]*len(HomoDFInputIndexBlocks),
815 | [MergedAlignedDF]*len(HomoDFInputIndexBlocks),
816 | HomoDFInputIndexBlocks))
817 |
818 | with Pool(processes=AllParameter.Threads) as pool:
819 | PotentialPrimerProbeOut = pool.starmap(IndentifyingAndFilteringOligos,PrimerProbeCheckParallelInput)
820 |
821 |
822 | PassedOligos = pd.concat(PotentialPrimerProbeOut).reset_index().drop(['index'],axis=1)
823 | if len(PassedOligos) == 0:
824 | print('No Oligos Passed Filtering')
825 | sys.exit()
826 | PassedOligos.to_csv('{}_PrimedRPA_Oligo_Binding_Sites.csv'.format(AllParameter.RunID),index=None)
827 |
828 |
829 |
830 | # Identify Primer-Probe Sets
831 | print('Identifying Valid Primer-Probe Combinations')
832 | FinalOutputDF = pd.DataFrame()
833 |
834 | # Determine all probe lengths available
835 | if AllParameter.ProbeRequired in ['EXO','NFO']:
836 | PossibleProbeLengths = PassedOligos[PassedOligos['Oligo_Type']=='Probe'].loc[:,'Oligo_Length'].unique().tolist()
837 |
838 | else:
839 | PossibleProbeLengths = [0]
840 |
841 | # Loop through possible FP lengths
842 | if AllParameter.ConservedAnchor == 'NO':
843 | AllParameter.ConservedAnchor = 0
844 | else:
845 | AllParameter.ConservedAnchor = int(AllParameter.ConservedAnchor)
846 |
847 |
848 | # Loop though Starting Forward Length
849 | for SFPL in PassedOligos[(PassedOligos['Oligo_Type']=='Primer')&(PassedOligos['3 prime conserved identity']>=AllParameter.ConservedAnchor)].loc[:,'Oligo_Length'].unique():
850 |
851 | # Identify all possible FP starting sites
852 | PossibleForwardPrimerSS = PassedOligos[(PassedOligos['Oligo_Type']=='Primer')&(PassedOligos['Oligo_Length']==SFPL)&(PassedOligos['3 prime conserved identity']>=AllParameter.ConservedAnchor)].loc[:,'Binding_Site_Start_Index'].tolist()
853 |
854 | # Loop through all possible RP lengths
855 | for SRPL in PassedOligos[(PassedOligos['Oligo_Type']=='Primer')&(PassedOligos['5 prime conserved identity']>=AllParameter.ConservedAnchor)].loc[:,'Oligo_Length'].unique():
856 |
857 | # Identify all possible RP starting sites
858 | PossibleReversePrimerSS = PassedOligos[(PassedOligos['Oligo_Type']=='Primer')&(PassedOligos['Oligo_Length']==SRPL)&(PassedOligos['5 prime conserved identity']>=AllParameter.ConservedAnchor)].loc[:,'Binding_Site_Start_Index'].tolist()
859 |
860 | # Split FP sites into tranches based on number of threads available.
861 | random.shuffle(PossibleForwardPrimerSS)
862 | PrimerStartSiteTranchesOne = [PossibleForwardPrimerSS[i:i + 2] for i in range(0, len(PossibleForwardPrimerSS), 2)]
863 | PrimerStartSiteTranchesTwo = [PrimerStartSiteTranchesOne[i:i + AllParameter.Threads] for i in range(0, len(PrimerStartSiteTranchesOne), AllParameter.Threads)]
864 |
865 | # Loop through possible probe lengths.
866 | for PPL in PossibleProbeLengths:
867 |
868 | if PPL == 0:
869 | PossibleProbeSS = []
870 |
871 | else:
872 | PossibleProbeSS = PassedOligos[(PassedOligos['Oligo_Type']=='Probe')&(PassedOligos['Oligo_Length']==PPL)].loc[:,'Binding_Site_Start_Index'].tolist()
873 |
874 | for PSST in PrimerStartSiteTranchesTwo:
875 | if len(FinalOutputDF) < AllParameter.MaxSets: ## Check this threshold setting.
876 | ComboSearchInput = list(zip(PSST,
877 | [PossibleReversePrimerSS]*len(PSST),
878 | [PossibleProbeSS]*len(PSST),
879 | [AllParameter]*len(PSST),
880 | [PassedOligos]*len(PSST),
881 | [SFPL]*len(PSST),
882 | [SRPL]*len(PSST),
883 | [PPL]*len(PSST)))
884 |
885 |
886 |
887 | with Pool(processes=AllParameter.Threads) as pool:
888 | SuccessfulSets = pool.starmap(ComboIdentifyier,ComboSearchInput)
889 |
890 | TempOutputDF = pd.concat(SuccessfulSets)
891 | FinalOutputDF = pd.concat([FinalOutputDF,TempOutputDF])
892 | if len(FinalOutputDF) != 0:
893 | FinalOutputDF.to_csv('{}_Output_Sets.csv'.format(AllParameter.RunID),index=None)
894 |
895 |
896 | print('PrimedRPA Complete')
897 | print('If helpful, please cite:\n\nHiggins M et al. Submitted. 2018\nDOI: 10.1093/bioinformatics/bty701')
898 |
899 |
900 | ########################################################################################################################
901 | ########################################################################################################################
902 | ########################################################################################################################
903 |
904 |
905 | print('\n\n')
906 | print('-------------------------------------------')
907 | print('----------------PrimedRPA------------------')
908 | print('-----Finding RPA Primer and Probe Sets-----')
909 | print('-------------Higgins M et al.--------------')
910 | print('-------------------------------------------\n\n')
911 |
912 |
913 |
914 | try:
915 | # Utilise Either Parameters File Or Command Line Interface
916 | if 'PrimedRPA_Parameters.txt' in sys.argv[1]:
917 |
918 | # Import and Extract Parameters
919 | parametersFile = sys.argv[1]
920 | try:
921 | paraFile = open(parametersFile,"r")
922 | iu = []
923 | for line in paraFile.readlines():
924 | if ">" in line:
925 | n = line.strip('\n')
926 | h = n.strip('>')
927 | iu.append(h)
928 | u = iu[1:]
929 |
930 | class AllParameter:
931 | RunID = str(u[0])
932 | PriorAlign = str(u[1])
933 | PriorBindingSite = str(u[2])
934 | InputFile = str(u[3])
935 | InputFileType = str(u[4])
936 | IdentityThreshold = int(u[5])/100
937 | ConservedAnchor = str(u[6]).strip()
938 | PrimerLength = u[7].strip()
939 | ProbeRequired = str(u[8]).upper()
940 | ProbeLength = u[9].strip()
941 | AmpliconSizeLimit = int(u[10])
942 | NucleotideRepeatLimit = int(u[11])
943 | MinGC = int(u[12])
944 | MaxGC = int(u[13])
945 | DimerisationThresh = int(u[14])
946 | BackgroundCheck = str(u[15])
947 | CrossReactivityThresh = int(u[16])
948 | HardCrossReactFilter = str(u[17])
949 | MaxSets = int(u[18])
950 | Threads = int(u[19])
951 | BackgroundSearchSensitivity = str(u[20])
952 | Evalue=int(u[21])
953 |
954 |
955 | except:
956 | print('Parameters File Could Not Be Opened\nCheck File Path.')
957 | sys.exit()
958 |
959 | else:
960 |
961 | parser = argparse.ArgumentParser()
962 | parser.add_argument('--RunID', help='Desired Run ID', required=True)
963 | parser.add_argument('--PriorAlign', help='Optional: Path to Prior Binding File',default='NO')
964 | parser.add_argument('--PriorBindingSite', help='Optional: Path to Prior Binding File',default='NO')
965 | parser.add_argument('--InputFile', help='Path to Input File',default='NO')
966 | parser.add_argument('--InputFileType', help='Options [SS,MS,MAS]')
967 | parser.add_argument('--IdentityThreshold', help='Desired Identity Threshold',default=0.99)
968 | parser.add_argument('--ConservedAnchor', help='Identity Anchor Required',type=str,default='NO')
969 | parser.add_argument('--PrimerLength', help='Desired Primer Length',type=str,default='30')
970 | parser.add_argument('--ProbeRequired', help='Options [NO,EXO,NFO]',type=str,default='NO')
971 | parser.add_argument('--ProbeLength', help='Desired Probe Length',type=str,default='50')
972 | parser.add_argument('--AmpliconSizeLimit', help='Amplicon Size Limit',type=int,default=500)
973 | parser.add_argument('--NucleotideRepeatLimit', help='Nucleotide Repeat Limit (i.e 5 = AAAAA)',type=int,default=5)
974 | parser.add_argument('--MinGC', help='Minimum GC Content',type=int,default=30)
975 | parser.add_argument('--MaxGC', help='Maximum GC Content',type=int,default=70)
976 | parser.add_argument('--DimerisationThresh', help='Percentage Dimerisation Tolerated',type=int,default=40)
977 | parser.add_argument('--BackgroundCheck', help='Options [NO, Path To Background Fasta File]',default='NO')
978 | parser.add_argument('--CrossReactivityThresh', help='Max Cross Reactivity Threshold',type=int,default=60)
979 | parser.add_argument('--HardCrossReactFilter', help='Hard Cross Reactivity Filter',type=str,default='NO')
980 | parser.add_argument('--MaxSets', help='Default Set To 100',type=int,default=100)
981 | parser.add_argument('--Threads', help='Default Set To 1',type=int,default=1)
982 | parser.add_argument('--BackgroundSearchSensitivity', help='Options [Basic or Advanced or Fast]',type=str,default='Basic')
983 | parser.add_argument('--Evalue', help='Default Set To 1000',type=int,default=1000)
984 |
985 | AllParameter = parser.parse_args()
986 |
987 |
988 | except:
989 | print('Please run PrimedRPA --help to see valid options')
990 | sys.exit()
991 |
992 |
993 | # Check Files Defined Exist
994 | FileLocationsCheckList = [AllParameter.PriorAlign,
995 | AllParameter.PriorBindingSite,
996 | AllParameter.BackgroundCheck,
997 | AllParameter.InputFile]
998 |
999 | for FL in FileLocationsCheckList:
1000 | if (FL != 'NO' and FL != ''):
1001 | if FL not in glob.glob(FL):
1002 | print('File Not Found: {}'.format(FL))
1003 | sys.exit()
1004 |
1005 |
1006 |
1007 | #Define tool dependancy paths
1008 | AllParameter.BlastnPath = 'blastn'
1009 | AllParameter.BlastnDBCreationPath = 'makeblastdb'
1010 | AllParameter.ClustalOPath = 'clustalo'
1011 | AllParameter.SamtoolsPath = 'samtools'
1012 |
1013 |
1014 | # Create Blastn Database if neccessary
1015 | if AllParameter.BackgroundCheck.upper() != 'NO':
1016 |
1017 | AllParameter.BlastnDBName = '{}_Blastn_DB_PrimedRPA'.format(AllParameter.BackgroundCheck.split('/')[-1].split('.')[0])
1018 | if os.path.exists(AllParameter.BlastnDBName) == False:
1019 | os.makedirs(AllParameter.BlastnDBName)
1020 | makeblastdbcommand = '{0} -in {1} -dbtype nucl -parse_seqids -out {2}/{2}'.format(AllParameter.BlastnDBCreationPath,
1021 | AllParameter.BackgroundCheck,
1022 | AllParameter.BlastnDBName)
1023 |
1024 | print('\nCreating Blastn Database:')
1025 | subprocess.call([makeblastdbcommand],shell=True)
1026 | print('\n')
1027 |
1028 | # Create directory to house blastn outputs
1029 | AllParameter.PrimerBlastnOutput = '{}/{}'.format(AllParameter.BlastnDBName,AllParameter.RunID)
1030 | if os.path.exists(AllParameter.PrimerBlastnOutput) == False:
1031 | os.mkdir(AllParameter.PrimerBlastnOutput)
1032 |
1033 |
1034 | # Check If Alignment Is Necessary
1035 | if (AllParameter.InputFileType == 'MS' and AllParameter.InputFile != 'NO') :
1036 |
1037 | # Check if MS Alignment already Exists in Working Directory
1038 | if AllParameter.InputFile.replace('.fasta','_Aligned.fasta') not in glob.glob(AllParameter.InputFile.replace('.fasta','_Aligned.fasta')):
1039 | RunningClustalo1(AllParameter.ClustalOPath,[AllParameter.InputFile], overwriteOutput=False)
1040 |
1041 | AllParameter.InputFile = AllParameter.InputFile.replace('.fasta','_Aligned.fasta')
1042 |
1043 |
1044 | # Run Primer, Probe Design process
1045 | if __name__ == '__main__':
1046 | CheckingAlignedOutputFile(AllParameter)
1047 |
--------------------------------------------------------------------------------