├── .github
└── workflows
│ ├── python-package.yml
│ └── python-publish.yml
├── .gitignore
├── LICENSE
├── README.md
├── pyproject.toml
├── setup.py
├── src
├── FastaUtils.py
├── __init__.py
└── assemblyStatistics.py
└── tests
├── __init__.py
├── sample.fasta
└── test_module.py
/.github/workflows/python-package.yml:
--------------------------------------------------------------------------------
1 | # This workflow will install Python dependencies, run tests and lint with a variety of Python versions
2 | # For more information see: https://docs.github.com/en/actions/automating-builds-and-tests/building-and-testing-python
3 |
4 | name: Python package
5 |
6 | on:
7 | push:
8 | branches: [ "master" ]
9 | pull_request:
10 | branches: [ "master" ]
11 |
12 | jobs:
13 | build:
14 |
15 | runs-on: ubuntu-latest
16 | strategy:
17 | fail-fast: false
18 | matrix:
19 | python-version: ["3.8", "3.9", "3.10"]
20 |
21 | steps:
22 | - uses: actions/checkout@v3
23 | - name: Set up Python ${{ matrix.python-version }}
24 | uses: actions/setup-python@v3
25 | with:
26 | python-version: ${{ matrix.python-version }}
27 | - name: Install dependencies
28 | run: |
29 | python -m pip install --upgrade pip
30 | python -m pip install flake8 pytest
31 | if [ -f requirements.txt ]; then pip install -r requirements.txt; fi
32 | - name: Lint with flake8
33 | run: |
34 | # stop the build if there are Python syntax errors or undefined names
35 | flake8 . --count --select=E9,F63,F7,F82 --show-source --statistics
36 | # exit-zero treats all errors as warnings. The GitHub editor is 127 chars wide
37 | flake8 . --count --exit-zero --max-complexity=10 --max-line-length=127 --statistics
38 | - name: Test with pytest
39 | run: |
40 | pytest
41 |
--------------------------------------------------------------------------------
/.github/workflows/python-publish.yml:
--------------------------------------------------------------------------------
1 | # This workflow will upload a Python Package using Twine when a release is created
2 | # For more information see: https://docs.github.com/en/actions/automating-builds-and-tests/building-and-testing-python#publishing-to-package-registries
3 |
4 | # This workflow uses actions that are not certified by GitHub.
5 | # They are provided by a third-party and are governed by
6 | # separate terms of service, privacy policy, and support
7 | # documentation.
8 |
9 | name: Upload Python Package
10 |
11 | on:
12 | release:
13 | types: [published]
14 |
15 | permissions:
16 | contents: read
17 |
18 | jobs:
19 | deploy:
20 |
21 | runs-on: ubuntu-latest
22 |
23 | steps:
24 | - uses: actions/checkout@v3
25 | - name: Set up Python
26 | uses: actions/setup-python@v3
27 | with:
28 | python-version: '3.x'
29 | - name: Install dependencies
30 | run: |
31 | python -m pip install --upgrade pip
32 | pip install build
33 | - name: Build package
34 | run: python -m build
35 | - name: Publish package
36 | uses: pypa/gh-action-pypi-publish@27b31702a0e7fc50959f5ad993c78deac1bdfc29
37 | with:
38 | user: __token__
39 | password: ${{ secrets.PYPI_API_TOKEN }}
40 |
--------------------------------------------------------------------------------
/.gitignore:
--------------------------------------------------------------------------------
1 | # Byte-compiled / optimized / DLL files
2 | __pycache__/
3 | *.py[cod]
4 |
5 | # C extensions
6 | *.so
7 |
8 | # Distribution / packaging
9 | .Python
10 | env/
11 | build/
12 | develop-eggs/
13 | dist/
14 | downloads/
15 | eggs/
16 | .eggs/
17 | lib/
18 | lib64/
19 | parts/
20 | sdist/
21 | var/
22 | *.egg-info/
23 | .installed.cfg
24 | *.egg
25 |
26 | # PyInstaller
27 | # Usually these files are written by a python script from a template
28 | # before PyInstaller builds the exe, so as to inject date/other infos into it.
29 | *.manifest
30 | *.spec
31 |
32 | # Installer logs
33 | pip-log.txt
34 | pip-delete-this-directory.txt
35 |
36 | # Unit test / coverage reports
37 | htmlcov/
38 | .tox/
39 | .coverage
40 | .coverage.*
41 | .cache
42 | nosetests.xml
43 | coverage.xml
44 | *,cover
45 |
46 | # Translations
47 | *.mo
48 | *.pot
49 |
50 | # Django stuff:
51 | *.log
52 |
53 | # Sphinx documentation
54 | docs/_build/
55 |
56 | # PyBuilder
57 | target/
58 |
--------------------------------------------------------------------------------
/LICENSE:
--------------------------------------------------------------------------------
1 | GNU GENERAL PUBLIC LICENSE
2 | Version 3, 29 June 2007
3 |
4 | Copyright (C) 2007 Free Software Foundation, Inc.
5 | Everyone is permitted to copy and distribute verbatim copies
6 | of this license document, but changing it is not allowed.
7 |
8 | Preamble
9 |
10 | The GNU General Public License is a free, copyleft license for
11 | software and other kinds of works.
12 |
13 | The licenses for most software and other practical works are designed
14 | to take away your freedom to share and change the works. By contrast,
15 | the GNU General Public License is intended to guarantee your freedom to
16 | share and change all versions of a program--to make sure it remains free
17 | software for all its users. We, the Free Software Foundation, use the
18 | GNU General Public License for most of our software; it applies also to
19 | any other work released this way by its authors. You can apply it to
20 | your programs, too.
21 |
22 | When we speak of free software, we are referring to freedom, not
23 | price. Our General Public Licenses are designed to make sure that you
24 | have the freedom to distribute copies of free software (and charge for
25 | them if you wish), that you receive source code or can get it if you
26 | want it, that you can change the software or use pieces of it in new
27 | free programs, and that you know you can do these things.
28 |
29 | To protect your rights, we need to prevent others from denying you
30 | these rights or asking you to surrender the rights. Therefore, you have
31 | certain responsibilities if you distribute copies of the software, or if
32 | you modify it: responsibilities to respect the freedom of others.
33 |
34 | For example, if you distribute copies of such a program, whether
35 | gratis or for a fee, you must pass on to the recipients the same
36 | freedoms that you received. You must make sure that they, too, receive
37 | or can get the source code. And you must show them these terms so they
38 | know their rights.
39 |
40 | Developers that use the GNU GPL protect your rights with two steps:
41 | (1) assert copyright on the software, and (2) offer you this License
42 | giving you legal permission to copy, distribute and/or modify it.
43 |
44 | For the developers' and authors' protection, the GPL clearly explains
45 | that there is no warranty for this free software. For both users' and
46 | authors' sake, the GPL requires that modified versions be marked as
47 | changed, so that their problems will not be attributed erroneously to
48 | authors of previous versions.
49 |
50 | Some devices are designed to deny users access to install or run
51 | modified versions of the software inside them, although the manufacturer
52 | can do so. This is fundamentally incompatible with the aim of
53 | protecting users' freedom to change the software. The systematic
54 | pattern of such abuse occurs in the area of products for individuals to
55 | use, which is precisely where it is most unacceptable. Therefore, we
56 | have designed this version of the GPL to prohibit the practice for those
57 | products. If such problems arise substantially in other domains, we
58 | stand ready to extend this provision to those domains in future versions
59 | of the GPL, as needed to protect the freedom of users.
60 |
61 | Finally, every program is threatened constantly by software patents.
62 | States should not allow patents to restrict development and use of
63 | software on general-purpose computers, but in those that do, we wish to
64 | avoid the special danger that patents applied to a free program could
65 | make it effectively proprietary. To prevent this, the GPL assures that
66 | patents cannot be used to render the program non-free.
67 |
68 | The precise terms and conditions for copying, distribution and
69 | modification follow.
70 |
71 | TERMS AND CONDITIONS
72 |
73 | 0. Definitions.
74 |
75 | "This License" refers to version 3 of the GNU General Public License.
76 |
77 | "Copyright" also means copyright-like laws that apply to other kinds of
78 | works, such as semiconductor masks.
79 |
80 | "The Program" refers to any copyrightable work licensed under this
81 | License. Each licensee is addressed as "you". "Licensees" and
82 | "recipients" may be individuals or organizations.
83 |
84 | To "modify" a work means to copy from or adapt all or part of the work
85 | in a fashion requiring copyright permission, other than the making of an
86 | exact copy. The resulting work is called a "modified version" of the
87 | earlier work or a work "based on" the earlier work.
88 |
89 | A "covered work" means either the unmodified Program or a work based
90 | on the Program.
91 |
92 | To "propagate" a work means to do anything with it that, without
93 | permission, would make you directly or secondarily liable for
94 | infringement under applicable copyright law, except executing it on a
95 | computer or modifying a private copy. Propagation includes copying,
96 | distribution (with or without modification), making available to the
97 | public, and in some countries other activities as well.
98 |
99 | To "convey" a work means any kind of propagation that enables other
100 | parties to make or receive copies. Mere interaction with a user through
101 | a computer network, with no transfer of a copy, is not conveying.
102 |
103 | An interactive user interface displays "Appropriate Legal Notices"
104 | to the extent that it includes a convenient and prominently visible
105 | feature that (1) displays an appropriate copyright notice, and (2)
106 | tells the user that there is no warranty for the work (except to the
107 | extent that warranties are provided), that licensees may convey the
108 | work under this License, and how to view a copy of this License. If
109 | the interface presents a list of user commands or options, such as a
110 | menu, a prominent item in the list meets this criterion.
111 |
112 | 1. Source Code.
113 |
114 | The "source code" for a work means the preferred form of the work
115 | for making modifications to it. "Object code" means any non-source
116 | form of a work.
117 |
118 | A "Standard Interface" means an interface that either is an official
119 | standard defined by a recognized standards body, or, in the case of
120 | interfaces specified for a particular programming language, one that
121 | is widely used among developers working in that language.
122 |
123 | The "System Libraries" of an executable work include anything, other
124 | than the work as a whole, that (a) is included in the normal form of
125 | packaging a Major Component, but which is not part of that Major
126 | Component, and (b) serves only to enable use of the work with that
127 | Major Component, or to implement a Standard Interface for which an
128 | implementation is available to the public in source code form. A
129 | "Major Component", in this context, means a major essential component
130 | (kernel, window system, and so on) of the specific operating system
131 | (if any) on which the executable work runs, or a compiler used to
132 | produce the work, or an object code interpreter used to run it.
133 |
134 | The "Corresponding Source" for a work in object code form means all
135 | the source code needed to generate, install, and (for an executable
136 | work) run the object code and to modify the work, including scripts to
137 | control those activities. However, it does not include the work's
138 | System Libraries, or general-purpose tools or generally available free
139 | programs which are used unmodified in performing those activities but
140 | which are not part of the work. For example, Corresponding Source
141 | includes interface definition files associated with source files for
142 | the work, and the source code for shared libraries and dynamically
143 | linked subprograms that the work is specifically designed to require,
144 | such as by intimate data communication or control flow between those
145 | subprograms and other parts of the work.
146 |
147 | The Corresponding Source need not include anything that users
148 | can regenerate automatically from other parts of the Corresponding
149 | Source.
150 |
151 | The Corresponding Source for a work in source code form is that
152 | same work.
153 |
154 | 2. Basic Permissions.
155 |
156 | All rights granted under this License are granted for the term of
157 | copyright on the Program, and are irrevocable provided the stated
158 | conditions are met. This License explicitly affirms your unlimited
159 | permission to run the unmodified Program. The output from running a
160 | covered work is covered by this License only if the output, given its
161 | content, constitutes a covered work. This License acknowledges your
162 | rights of fair use or other equivalent, as provided by copyright law.
163 |
164 | You may make, run and propagate covered works that you do not
165 | convey, without conditions so long as your license otherwise remains
166 | in force. You may convey covered works to others for the sole purpose
167 | of having them make modifications exclusively for you, or provide you
168 | with facilities for running those works, provided that you comply with
169 | the terms of this License in conveying all material for which you do
170 | not control copyright. Those thus making or running the covered works
171 | for you must do so exclusively on your behalf, under your direction
172 | and control, on terms that prohibit them from making any copies of
173 | your copyrighted material outside their relationship with you.
174 |
175 | Conveying under any other circumstances is permitted solely under
176 | the conditions stated below. Sublicensing is not allowed; section 10
177 | makes it unnecessary.
178 |
179 | 3. Protecting Users' Legal Rights From Anti-Circumvention Law.
180 |
181 | No covered work shall be deemed part of an effective technological
182 | measure under any applicable law fulfilling obligations under article
183 | 11 of the WIPO copyright treaty adopted on 20 December 1996, or
184 | similar laws prohibiting or restricting circumvention of such
185 | measures.
186 |
187 | When you convey a covered work, you waive any legal power to forbid
188 | circumvention of technological measures to the extent such circumvention
189 | is effected by exercising rights under this License with respect to
190 | the covered work, and you disclaim any intention to limit operation or
191 | modification of the work as a means of enforcing, against the work's
192 | users, your or third parties' legal rights to forbid circumvention of
193 | technological measures.
194 |
195 | 4. Conveying Verbatim Copies.
196 |
197 | You may convey verbatim copies of the Program's source code as you
198 | receive it, in any medium, provided that you conspicuously and
199 | appropriately publish on each copy an appropriate copyright notice;
200 | keep intact all notices stating that this License and any
201 | non-permissive terms added in accord with section 7 apply to the code;
202 | keep intact all notices of the absence of any warranty; and give all
203 | recipients a copy of this License along with the Program.
204 |
205 | You may charge any price or no price for each copy that you convey,
206 | and you may offer support or warranty protection for a fee.
207 |
208 | 5. Conveying Modified Source Versions.
209 |
210 | You may convey a work based on the Program, or the modifications to
211 | produce it from the Program, in the form of source code under the
212 | terms of section 4, provided that you also meet all of these conditions:
213 |
214 | a) The work must carry prominent notices stating that you modified
215 | it, and giving a relevant date.
216 |
217 | b) The work must carry prominent notices stating that it is
218 | released under this License and any conditions added under section
219 | 7. This requirement modifies the requirement in section 4 to
220 | "keep intact all notices".
221 |
222 | c) You must license the entire work, as a whole, under this
223 | License to anyone who comes into possession of a copy. This
224 | License will therefore apply, along with any applicable section 7
225 | additional terms, to the whole of the work, and all its parts,
226 | regardless of how they are packaged. This License gives no
227 | permission to license the work in any other way, but it does not
228 | invalidate such permission if you have separately received it.
229 |
230 | d) If the work has interactive user interfaces, each must display
231 | Appropriate Legal Notices; however, if the Program has interactive
232 | interfaces that do not display Appropriate Legal Notices, your
233 | work need not make them do so.
234 |
235 | A compilation of a covered work with other separate and independent
236 | works, which are not by their nature extensions of the covered work,
237 | and which are not combined with it such as to form a larger program,
238 | in or on a volume of a storage or distribution medium, is called an
239 | "aggregate" if the compilation and its resulting copyright are not
240 | used to limit the access or legal rights of the compilation's users
241 | beyond what the individual works permit. Inclusion of a covered work
242 | in an aggregate does not cause this License to apply to the other
243 | parts of the aggregate.
244 |
245 | 6. Conveying Non-Source Forms.
246 |
247 | You may convey a covered work in object code form under the terms
248 | of sections 4 and 5, provided that you also convey the
249 | machine-readable Corresponding Source under the terms of this License,
250 | in one of these ways:
251 |
252 | a) Convey the object code in, or embodied in, a physical product
253 | (including a physical distribution medium), accompanied by the
254 | Corresponding Source fixed on a durable physical medium
255 | customarily used for software interchange.
256 |
257 | b) Convey the object code in, or embodied in, a physical product
258 | (including a physical distribution medium), accompanied by a
259 | written offer, valid for at least three years and valid for as
260 | long as you offer spare parts or customer support for that product
261 | model, to give anyone who possesses the object code either (1) a
262 | copy of the Corresponding Source for all the software in the
263 | product that is covered by this License, on a durable physical
264 | medium customarily used for software interchange, for a price no
265 | more than your reasonable cost of physically performing this
266 | conveying of source, or (2) access to copy the
267 | Corresponding Source from a network server at no charge.
268 |
269 | c) Convey individual copies of the object code with a copy of the
270 | written offer to provide the Corresponding Source. This
271 | alternative is allowed only occasionally and noncommercially, and
272 | only if you received the object code with such an offer, in accord
273 | with subsection 6b.
274 |
275 | d) Convey the object code by offering access from a designated
276 | place (gratis or for a charge), and offer equivalent access to the
277 | Corresponding Source in the same way through the same place at no
278 | further charge. You need not require recipients to copy the
279 | Corresponding Source along with the object code. If the place to
280 | copy the object code is a network server, the Corresponding Source
281 | may be on a different server (operated by you or a third party)
282 | that supports equivalent copying facilities, provided you maintain
283 | clear directions next to the object code saying where to find the
284 | Corresponding Source. Regardless of what server hosts the
285 | Corresponding Source, you remain obligated to ensure that it is
286 | available for as long as needed to satisfy these requirements.
287 |
288 | e) Convey the object code using peer-to-peer transmission, provided
289 | you inform other peers where the object code and Corresponding
290 | Source of the work are being offered to the general public at no
291 | charge under subsection 6d.
292 |
293 | A separable portion of the object code, whose source code is excluded
294 | from the Corresponding Source as a System Library, need not be
295 | included in conveying the object code work.
296 |
297 | A "User Product" is either (1) a "consumer product", which means any
298 | tangible personal property which is normally used for personal, family,
299 | or household purposes, or (2) anything designed or sold for incorporation
300 | into a dwelling. In determining whether a product is a consumer product,
301 | doubtful cases shall be resolved in favor of coverage. For a particular
302 | product received by a particular user, "normally used" refers to a
303 | typical or common use of that class of product, regardless of the status
304 | of the particular user or of the way in which the particular user
305 | actually uses, or expects or is expected to use, the product. A product
306 | is a consumer product regardless of whether the product has substantial
307 | commercial, industrial or non-consumer uses, unless such uses represent
308 | the only significant mode of use of the product.
309 |
310 | "Installation Information" for a User Product means any methods,
311 | procedures, authorization keys, or other information required to install
312 | and execute modified versions of a covered work in that User Product from
313 | a modified version of its Corresponding Source. The information must
314 | suffice to ensure that the continued functioning of the modified object
315 | code is in no case prevented or interfered with solely because
316 | modification has been made.
317 |
318 | If you convey an object code work under this section in, or with, or
319 | specifically for use in, a User Product, and the conveying occurs as
320 | part of a transaction in which the right of possession and use of the
321 | User Product is transferred to the recipient in perpetuity or for a
322 | fixed term (regardless of how the transaction is characterized), the
323 | Corresponding Source conveyed under this section must be accompanied
324 | by the Installation Information. But this requirement does not apply
325 | if neither you nor any third party retains the ability to install
326 | modified object code on the User Product (for example, the work has
327 | been installed in ROM).
328 |
329 | The requirement to provide Installation Information does not include a
330 | requirement to continue to provide support service, warranty, or updates
331 | for a work that has been modified or installed by the recipient, or for
332 | the User Product in which it has been modified or installed. Access to a
333 | network may be denied when the modification itself materially and
334 | adversely affects the operation of the network or violates the rules and
335 | protocols for communication across the network.
336 |
337 | Corresponding Source conveyed, and Installation Information provided,
338 | in accord with this section must be in a format that is publicly
339 | documented (and with an implementation available to the public in
340 | source code form), and must require no special password or key for
341 | unpacking, reading or copying.
342 |
343 | 7. Additional Terms.
344 |
345 | "Additional permissions" are terms that supplement the terms of this
346 | License by making exceptions from one or more of its conditions.
347 | Additional permissions that are applicable to the entire Program shall
348 | be treated as though they were included in this License, to the extent
349 | that they are valid under applicable law. If additional permissions
350 | apply only to part of the Program, that part may be used separately
351 | under those permissions, but the entire Program remains governed by
352 | this License without regard to the additional permissions.
353 |
354 | When you convey a copy of a covered work, you may at your option
355 | remove any additional permissions from that copy, or from any part of
356 | it. (Additional permissions may be written to require their own
357 | removal in certain cases when you modify the work.) You may place
358 | additional permissions on material, added by you to a covered work,
359 | for which you have or can give appropriate copyright permission.
360 |
361 | Notwithstanding any other provision of this License, for material you
362 | add to a covered work, you may (if authorized by the copyright holders of
363 | that material) supplement the terms of this License with terms:
364 |
365 | a) Disclaiming warranty or limiting liability differently from the
366 | terms of sections 15 and 16 of this License; or
367 |
368 | b) Requiring preservation of specified reasonable legal notices or
369 | author attributions in that material or in the Appropriate Legal
370 | Notices displayed by works containing it; or
371 |
372 | c) Prohibiting misrepresentation of the origin of that material, or
373 | requiring that modified versions of such material be marked in
374 | reasonable ways as different from the original version; or
375 |
376 | d) Limiting the use for publicity purposes of names of licensors or
377 | authors of the material; or
378 |
379 | e) Declining to grant rights under trademark law for use of some
380 | trade names, trademarks, or service marks; or
381 |
382 | f) Requiring indemnification of licensors and authors of that
383 | material by anyone who conveys the material (or modified versions of
384 | it) with contractual assumptions of liability to the recipient, for
385 | any liability that these contractual assumptions directly impose on
386 | those licensors and authors.
387 |
388 | All other non-permissive additional terms are considered "further
389 | restrictions" within the meaning of section 10. If the Program as you
390 | received it, or any part of it, contains a notice stating that it is
391 | governed by this License along with a term that is a further
392 | restriction, you may remove that term. If a license document contains
393 | a further restriction but permits relicensing or conveying under this
394 | License, you may add to a covered work material governed by the terms
395 | of that license document, provided that the further restriction does
396 | not survive such relicensing or conveying.
397 |
398 | If you add terms to a covered work in accord with this section, you
399 | must place, in the relevant source files, a statement of the
400 | additional terms that apply to those files, or a notice indicating
401 | where to find the applicable terms.
402 |
403 | Additional terms, permissive or non-permissive, may be stated in the
404 | form of a separately written license, or stated as exceptions;
405 | the above requirements apply either way.
406 |
407 | 8. Termination.
408 |
409 | You may not propagate or modify a covered work except as expressly
410 | provided under this License. Any attempt otherwise to propagate or
411 | modify it is void, and will automatically terminate your rights under
412 | this License (including any patent licenses granted under the third
413 | paragraph of section 11).
414 |
415 | However, if you cease all violation of this License, then your
416 | license from a particular copyright holder is reinstated (a)
417 | provisionally, unless and until the copyright holder explicitly and
418 | finally terminates your license, and (b) permanently, if the copyright
419 | holder fails to notify you of the violation by some reasonable means
420 | prior to 60 days after the cessation.
421 |
422 | Moreover, your license from a particular copyright holder is
423 | reinstated permanently if the copyright holder notifies you of the
424 | violation by some reasonable means, this is the first time you have
425 | received notice of violation of this License (for any work) from that
426 | copyright holder, and you cure the violation prior to 30 days after
427 | your receipt of the notice.
428 |
429 | Termination of your rights under this section does not terminate the
430 | licenses of parties who have received copies or rights from you under
431 | this License. If your rights have been terminated and not permanently
432 | reinstated, you do not qualify to receive new licenses for the same
433 | material under section 10.
434 |
435 | 9. Acceptance Not Required for Having Copies.
436 |
437 | You are not required to accept this License in order to receive or
438 | run a copy of the Program. Ancillary propagation of a covered work
439 | occurring solely as a consequence of using peer-to-peer transmission
440 | to receive a copy likewise does not require acceptance. However,
441 | nothing other than this License grants you permission to propagate or
442 | modify any covered work. These actions infringe copyright if you do
443 | not accept this License. Therefore, by modifying or propagating a
444 | covered work, you indicate your acceptance of this License to do so.
445 |
446 | 10. Automatic Licensing of Downstream Recipients.
447 |
448 | Each time you convey a covered work, the recipient automatically
449 | receives a license from the original licensors, to run, modify and
450 | propagate that work, subject to this License. You are not responsible
451 | for enforcing compliance by third parties with this License.
452 |
453 | An "entity transaction" is a transaction transferring control of an
454 | organization, or substantially all assets of one, or subdividing an
455 | organization, or merging organizations. If propagation of a covered
456 | work results from an entity transaction, each party to that
457 | transaction who receives a copy of the work also receives whatever
458 | licenses to the work the party's predecessor in interest had or could
459 | give under the previous paragraph, plus a right to possession of the
460 | Corresponding Source of the work from the predecessor in interest, if
461 | the predecessor has it or can get it with reasonable efforts.
462 |
463 | You may not impose any further restrictions on the exercise of the
464 | rights granted or affirmed under this License. For example, you may
465 | not impose a license fee, royalty, or other charge for exercise of
466 | rights granted under this License, and you may not initiate litigation
467 | (including a cross-claim or counterclaim in a lawsuit) alleging that
468 | any patent claim is infringed by making, using, selling, offering for
469 | sale, or importing the Program or any portion of it.
470 |
471 | 11. Patents.
472 |
473 | A "contributor" is a copyright holder who authorizes use under this
474 | License of the Program or a work on which the Program is based. The
475 | work thus licensed is called the contributor's "contributor version".
476 |
477 | A contributor's "essential patent claims" are all patent claims
478 | owned or controlled by the contributor, whether already acquired or
479 | hereafter acquired, that would be infringed by some manner, permitted
480 | by this License, of making, using, or selling its contributor version,
481 | but do not include claims that would be infringed only as a
482 | consequence of further modification of the contributor version. For
483 | purposes of this definition, "control" includes the right to grant
484 | patent sublicenses in a manner consistent with the requirements of
485 | this License.
486 |
487 | Each contributor grants you a non-exclusive, worldwide, royalty-free
488 | patent license under the contributor's essential patent claims, to
489 | make, use, sell, offer for sale, import and otherwise run, modify and
490 | propagate the contents of its contributor version.
491 |
492 | In the following three paragraphs, a "patent license" is any express
493 | agreement or commitment, however denominated, not to enforce a patent
494 | (such as an express permission to practice a patent or covenant not to
495 | sue for patent infringement). To "grant" such a patent license to a
496 | party means to make such an agreement or commitment not to enforce a
497 | patent against the party.
498 |
499 | If you convey a covered work, knowingly relying on a patent license,
500 | and the Corresponding Source of the work is not available for anyone
501 | to copy, free of charge and under the terms of this License, through a
502 | publicly available network server or other readily accessible means,
503 | then you must either (1) cause the Corresponding Source to be so
504 | available, or (2) arrange to deprive yourself of the benefit of the
505 | patent license for this particular work, or (3) arrange, in a manner
506 | consistent with the requirements of this License, to extend the patent
507 | license to downstream recipients. "Knowingly relying" means you have
508 | actual knowledge that, but for the patent license, your conveying the
509 | covered work in a country, or your recipient's use of the covered work
510 | in a country, would infringe one or more identifiable patents in that
511 | country that you have reason to believe are valid.
512 |
513 | If, pursuant to or in connection with a single transaction or
514 | arrangement, you convey, or propagate by procuring conveyance of, a
515 | covered work, and grant a patent license to some of the parties
516 | receiving the covered work authorizing them to use, propagate, modify
517 | or convey a specific copy of the covered work, then the patent license
518 | you grant is automatically extended to all recipients of the covered
519 | work and works based on it.
520 |
521 | A patent license is "discriminatory" if it does not include within
522 | the scope of its coverage, prohibits the exercise of, or is
523 | conditioned on the non-exercise of one or more of the rights that are
524 | specifically granted under this License. You may not convey a covered
525 | work if you are a party to an arrangement with a third party that is
526 | in the business of distributing software, under which you make payment
527 | to the third party based on the extent of your activity of conveying
528 | the work, and under which the third party grants, to any of the
529 | parties who would receive the covered work from you, a discriminatory
530 | patent license (a) in connection with copies of the covered work
531 | conveyed by you (or copies made from those copies), or (b) primarily
532 | for and in connection with specific products or compilations that
533 | contain the covered work, unless you entered into that arrangement,
534 | or that patent license was granted, prior to 28 March 2007.
535 |
536 | Nothing in this License shall be construed as excluding or limiting
537 | any implied license or other defenses to infringement that may
538 | otherwise be available to you under applicable patent law.
539 |
540 | 12. No Surrender of Others' Freedom.
541 |
542 | If conditions are imposed on you (whether by court order, agreement or
543 | otherwise) that contradict the conditions of this License, they do not
544 | excuse you from the conditions of this License. If you cannot convey a
545 | covered work so as to satisfy simultaneously your obligations under this
546 | License and any other pertinent obligations, then as a consequence you may
547 | not convey it at all. For example, if you agree to terms that obligate you
548 | to collect a royalty for further conveying from those to whom you convey
549 | the Program, the only way you could satisfy both those terms and this
550 | License would be to refrain entirely from conveying the Program.
551 |
552 | 13. Use with the GNU Affero General Public License.
553 |
554 | Notwithstanding any other provision of this License, you have
555 | permission to link or combine any covered work with a work licensed
556 | under version 3 of the GNU Affero General Public License into a single
557 | combined work, and to convey the resulting work. The terms of this
558 | License will continue to apply to the part which is the covered work,
559 | but the special requirements of the GNU Affero General Public License,
560 | section 13, concerning interaction through a network will apply to the
561 | combination as such.
562 |
563 | 14. Revised Versions of this License.
564 |
565 | The Free Software Foundation may publish revised and/or new versions of
566 | the GNU General Public License from time to time. Such new versions will
567 | be similar in spirit to the present version, but may differ in detail to
568 | address new problems or concerns.
569 |
570 | Each version is given a distinguishing version number. If the
571 | Program specifies that a certain numbered version of the GNU General
572 | Public License "or any later version" applies to it, you have the
573 | option of following the terms and conditions either of that numbered
574 | version or of any later version published by the Free Software
575 | Foundation. If the Program does not specify a version number of the
576 | GNU General Public License, you may choose any version ever published
577 | by the Free Software Foundation.
578 |
579 | If the Program specifies that a proxy can decide which future
580 | versions of the GNU General Public License can be used, that proxy's
581 | public statement of acceptance of a version permanently authorizes you
582 | to choose that version for the Program.
583 |
584 | Later license versions may give you additional or different
585 | permissions. However, no additional obligations are imposed on any
586 | author or copyright holder as a result of your choosing to follow a
587 | later version.
588 |
589 | 15. Disclaimer of Warranty.
590 |
591 | THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY
592 | APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT
593 | HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY
594 | OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO,
595 | THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
596 | PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM
597 | IS WITH YOU. SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF
598 | ALL NECESSARY SERVICING, REPAIR OR CORRECTION.
599 |
600 | 16. Limitation of Liability.
601 |
602 | IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING
603 | WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES AND/OR CONVEYS
604 | THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY
605 | GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE
606 | USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF
607 | DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD
608 | PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS),
609 | EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF
610 | SUCH DAMAGES.
611 |
612 | 17. Interpretation of Sections 15 and 16.
613 |
614 | If the disclaimer of warranty and limitation of liability provided
615 | above cannot be given local legal effect according to their terms,
616 | reviewing courts shall apply local law that most closely approximates
617 | an absolute waiver of all civil liability in connection with the
618 | Program, unless a warranty or assumption of liability accompanies a
619 | copy of the Program in return for a fee.
620 |
621 | END OF TERMS AND CONDITIONS
622 |
623 | How to Apply These Terms to Your New Programs
624 |
625 | If you develop a new program, and you want it to be of the greatest
626 | possible use to the public, the best way to achieve this is to make it
627 | free software which everyone can redistribute and change under these terms.
628 |
629 | To do so, attach the following notices to the program. It is safest
630 | to attach them to the start of each source file to most effectively
631 | state the exclusion of warranty; and each file should have at least
632 | the "copyright" line and a pointer to where the full notice is found.
633 |
634 | {one line to give the program's name and a brief idea of what it does.}
635 | Copyright (C) {year} {name of author}
636 |
637 | This program is free software: you can redistribute it and/or modify
638 | it under the terms of the GNU General Public License as published by
639 | the Free Software Foundation, either version 3 of the License, or
640 | (at your option) any later version.
641 |
642 | This program is distributed in the hope that it will be useful,
643 | but WITHOUT ANY WARRANTY; without even the implied warranty of
644 | MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
645 | GNU General Public License for more details.
646 |
647 | You should have received a copy of the GNU General Public License
648 | along with this program. If not, see .
649 |
650 | Also add information on how to contact you by electronic and paper mail.
651 |
652 | If the program does terminal interaction, make it output a short
653 | notice like this when it starts in an interactive mode:
654 |
655 | {project} Copyright (C) {year} {fullname}
656 | This program comes with ABSOLUTELY NO WARRANTY; for details type `show w'.
657 | This is free software, and you are welcome to redistribute it
658 | under certain conditions; type `show c' for details.
659 |
660 | The hypothetical commands `show w' and `show c' should show the appropriate
661 | parts of the General Public License. Of course, your program's commands
662 | might be different; for a GUI interface, you would use an "about box".
663 |
664 | You should also get your employer (if you work as a programmer) or school,
665 | if any, to sign a "copyright disclaimer" for the program, if necessary.
666 | For more information on this, and how to apply and follow the GNU GPL, see
667 | .
668 |
669 | The GNU General Public License does not permit incorporating your program
670 | into proprietary programs. If your program is a subroutine library, you
671 | may consider it more useful to permit linking proprietary applications with
672 | the library. If this is what you want to do, use the GNU Lesser General
673 | Public License instead of this License. But first, please read
674 | .
675 |
676 |
--------------------------------------------------------------------------------
/README.md:
--------------------------------------------------------------------------------
1 | ## assemblyStatistics
2 | [](https://github.com/WenchaoLin/assemblyStatistics/actions/workflows/python-package.yml)
3 | [](https://github.com/WenchaoLin/assemblyStatistics/blob/master/LICENSE)
4 | [](https://github.com/chetanraj/awesome-github-badges)
5 |
6 | A script to evaluate the assembly of a given genome.
7 |
8 |
9 | 💙 If you like this project, give it a ⭐ and share it with friends!
10 |
11 |
12 | It provides various statistics regarding a Fasta file containing multiple sequences, such as sequence name, N50, N90, GC Content, N rate, etc., both large scaffolds (>1000 bp) and contigs across all sequences.
13 |
14 | 一个用于评估给定基因组的拼接结果的脚本,用于查看拼接结果的Scaffold, Contig统计信息。它提供了有关包含多个序列的Fasta文件的各种统计信息,如序列名称、N50、N90、GC含量、N比率、序列数量等。
15 |
16 |
17 |
18 | ## ⚙ USAGE
19 |
20 | ```
21 | assemblyStatistics -f test.fasta -l 100
22 | assemblyStatistics test.fasta
23 | ```
24 |
25 | ## ⚡ Quick install
26 |
27 | ```
28 | pip install assemblyStatistics
29 | ```
30 |
31 |
32 | ## 🔧 Options
33 |
34 | run `assemblyStatistics -h` or `assemblyStatistics --help` for options
35 |
36 | ```
37 | Usage: assemblyStatistics [options] -f INPUT.fasta
38 |
39 | A script to evaluate the assembly of a given fasta.
40 |
41 | Options:
42 | --version show program's version number and exit
43 | -h, --help show this help message and exit
44 | -f FILE, --fasta=FILE
45 | input fasta file
46 | -t FORMAT, --outfmt=FORMAT
47 | format of the output, choices = [txt, json]
48 | -l LENGTH, -L LENGTH, --length=LENGTH
49 | Threshold of length defined a sequence as Large
50 | [default = 1000]
51 | ```
52 |
53 |
54 | ## Sample output
55 |
56 | Default txt output(human readable text format)
57 |
58 | ```txt
59 |
60 | All scaffold sequences summary:
61 | --------------------------------------------------
62 | Counts of scaffold sequences 3
63 | Length of scaffold sequences 490
64 | Largest scaffold name seq1
65 | Largest scaffold length 210
66 | Scaffold N50 210
67 | Counts of N50 2
68 | Scaffold N90 70
69 | Counts of N90 3
70 | GC content(%) 42.86
71 | N Length 141
72 | N content (%) 28.78
73 |
74 | LARGE (> 100 bp) sequences summary:
75 | --------------------------------------------------
76 | Counts of LARGE sequences 2
77 | Length of LARGE sequences 420
78 | LARGE scaffold N50 210
79 | Counts of LARGE N50 1
80 | LARGE scaffold N90 210
81 | Counts of LARGE N90 2
82 | GC content(%) 33.33
83 | N Length 141
84 | N content (%) 33.57
85 |
86 | contigs summary:
87 | --------------------------------------------------
88 | Counts of contigs 7
89 | Maximum length of contigs 70
90 | contig N50 70
91 | Counts of contig N50 3
92 | contig N90 36
93 | Counts of contig N90 5
94 | ```
95 |
96 | JSON format output with command `assemblyStatistics -f sample.fasta -t json`
97 |
98 | ```json
99 | {
100 | "All scaffolds": {
101 | "Counts of scaffold sequences": 4,
102 | "Length of scaffold sequences": 605,
103 | "Largest scaffold name": "seq2",
104 | "Largest scaffold length": 271,
105 | "Scaffold N50": 269,
106 | "Counts of N50": 2,
107 | "Scaffold N90": 45,
108 | "Counts of N90": 3,
109 | "GC content(%)": 49.09090909090909,
110 | "N Length": 59,
111 | "N content (%)": 9.75206611570248
112 | },
113 | "LARGE sequences": {
114 | "threshold": 1000,
115 | "Counts of LARGE sequences": 0,
116 | "Length of LARGE sequences": 0
117 | },
118 | "Contigs": {
119 | "Counts of contigs": 8,
120 | "Maximum length": 225,
121 | "contig N50": 121,
122 | "Counts of contig N50": 2,
123 | "contig N90": 21,
124 | "Counts of contig N90": 6
125 | }
126 | }
127 | ```
128 |
129 | ## Feedback/Issues
130 |
131 | Please report any issues to the [issues page](https://github.com/WenchaoLin/assemblyStatistics/issues) or email linwenchao@yeah.net
132 |
133 | ## Todo
134 |
135 | - Get statistics from a list of files
136 | - Compressed format (.gz, .bz2 or .xz) support
137 | - Multiple output format support
--------------------------------------------------------------------------------
/pyproject.toml:
--------------------------------------------------------------------------------
1 | [build-system]
2 | requires = ["setuptools>=61.0"]
3 | build-backend = "setuptools.build_meta"
4 |
5 | [project]
6 | name = "assemblyStatistics"
7 | version = "1.1.3"
8 | authors = [
9 | { name="Wenchao Lin", email="linwenchao@yeah.net" },
10 | ]
11 | description = "A script to evaluate the assembly of a given genome."
12 | readme = "README.md"
13 | license = {file = "LICENSE"}
14 | requires-python = ">=3.7"
15 | keywords = ["assembly", "scaffolds"]
16 | classifiers = [
17 | "Programming Language :: Python :: 3",
18 | "License :: OSI Approved :: GNU General Public License v3 (GPLv3)",
19 | "Operating System :: OS Independent",
20 | "Programming Language :: Python",
21 | "Programming Language :: Python :: 3.6",
22 | "Programming Language :: Python :: 3.7",
23 | "Programming Language :: Python :: 3.8",
24 | ]
25 |
26 | [project.scripts]
27 | assemblyStatistics = "src.assemblyStatistics:main"
28 |
29 | [project.urls]
30 | "Homepage" = "https://github.com/WenchaoLin/assemblyStatistics"
31 | "Bug Tracker" = "https://github.com/WenchaoLin/assemblyStatistics/issues"
--------------------------------------------------------------------------------
/setup.py:
--------------------------------------------------------------------------------
1 | from setuptools import setup, find_packages
2 |
3 | file_path = 'README.md'
4 |
5 | setup(name='assemblyStatistics',
6 | version='1.1.3',
7 | description='A script to evaluate the assembly of a given genome.',
8 | long_description=open(file_path, encoding='utf-8').read(),
9 | long_description_content_type='text/markdown',
10 | author='Wenchao Lin',
11 | include_package_data=True,
12 | author_email='linwenchao@yeah.net',
13 | url='https://github.com/WenchaoLin/assemblyStatistics',
14 | packages = find_packages(),
15 | keywords=['bioinformatics', 'genome statics', 'scaffold N50'],
16 | )
17 |
--------------------------------------------------------------------------------
/src/FastaUtils.py:
--------------------------------------------------------------------------------
1 | #!/usr/bin/python
2 | ################################################################################
3 | #
4 | # Wenchaolin, 2015 @ Tianjin Biochip
5 | #
6 | # Module with a Class to represent a Fasta sequence,
7 | # and methods to load Fasta-formatted sequences from a file.
8 | #
9 | ################################################################################
10 | from __future__ import print_function, division, absolute_import, with_statement
11 |
12 |
13 | def say(*args, indent=40, decimal=2):
14 | """format output in left aligned table"""
15 | out_fmt = ''
16 | for v in args:
17 | if isinstance(v, float):
18 | out_fmt += '{:<%s.%sf}' % (indent, decimal)
19 | else:
20 | out_fmt += '{:<%s}' % indent
21 | out_fmt = out_fmt.format(*args)
22 | print(out_fmt)
23 | return out_fmt
24 |
25 |
26 | def seq_gc_content(sequence):
27 | """return gc content"""
28 | gc_content = (sequence.upper().count('G') + sequence.upper().count('C')) \
29 | / len(sequence) * 100
30 | return gc_content
31 |
32 |
33 | def seq_gc_skew(sequence):
34 | """return: gc skew in percent"""
35 | gc_content = seq_gc_content(sequence)
36 | if gc_content == 0:
37 | gc_skew = 0
38 | else:
39 | gc_skew = (sequence.upper().count('G') - sequence.upper().count('C')) \
40 | / (sequence.count('G') + sequence.count('C')) * 100
41 | return gc_skew
42 |
43 |
44 | def Nx0(listOfNumbers, x=50):
45 | """
46 | x is the Nx0 to be calculated, e.g. x = 50 for N50
47 | return Nx0 of an given list of numbers
48 | """
49 | listOfNumbers.sort(reverse=1) # sort the list in descending order
50 | theorNx0 = sum(listOfNumbers) * x / 100 # calculate the theoretical Nx0
51 |
52 | tot = 0
53 | Nx0 = 0
54 | CNx0 = 0
55 |
56 | for num in listOfNumbers:
57 | tot += num
58 | CNx0 += 1
59 | if tot >= theorNx0: # if the total is greater than or equal to the theoretical Nx0
60 | Nx0 = num
61 | break
62 | return (Nx0, CNx0)
63 |
64 |
65 | def SimpleFastaParser(handle):
66 | """Iterate over Fasta records as string tuples.
67 | Arguments:
68 | - handle - input stream opened in text mode
69 | For each record a tuple of two strings is returned, the FASTA title
70 | line (without the leading '>' character), and the sequence (with any
71 | whitespace removed). The title line is not divided up into an
72 | identifier (the first word) and comment or description.
73 | >>> with open("Fasta/dups.fasta") as handle:
74 | ... for values in SimpleFastaParser(handle):
75 | ... print(values)
76 | ...
77 | ('alpha', 'ACGTA')
78 | ('beta', 'CGTC')
79 | ('gamma', 'CCGCC')
80 | ('alpha (again - this is a duplicate entry to test the indexing code)', 'ACGTA')
81 | ('delta', 'CGCGC')
82 | """
83 | # Skip any text before the first record (e.g. blank lines, comments)
84 | for line in handle:
85 | if line[0] == ">":
86 | title = line[1:].rstrip()
87 | break
88 | else:
89 | # no break encountered - probably an empty file
90 | return
91 |
92 | lines = []
93 | for line in handle:
94 | if line[0] == ">":
95 | yield title, "".join(lines).replace(" ", "").replace("\r", "")
96 | lines = []
97 | title = line[1:].rstrip()
98 | continue
99 | lines.append(line.rstrip())
100 |
101 | yield title, "".join(lines).replace(" ", "").replace("\r", "")
102 |
103 |
104 | class FastaIO:
105 | """Base class for building SeqRecord iterators.
106 | You should write a parse method that returns a SeqRecord generator. You
107 | may wish to redefine the __init__ method as well.
108 | """
109 |
110 | def __init__(self, source):
111 | """Create a SequenceIterator object.
112 | Arguments:
113 | - source - input file stream, or path to input file
114 | """
115 |
116 | try:
117 | self.stream = open(source, "r")
118 | self.should_close_stream = True
119 | except Exception:
120 | "Open file error."
121 |
122 | try:
123 | self.records = self.parse(self.stream)
124 | except Exception:
125 | if self.should_close_stream:
126 | self.stream.close()
127 | raise
128 |
129 | def __next__(self):
130 | """Return the next entry."""
131 | try:
132 | return next(self.records)
133 | except Exception:
134 | if self.should_close_stream:
135 | self.stream.close()
136 | raise
137 |
138 | def __iter__(self):
139 | """Iterate over the entries as a SeqRecord objects.
140 | Example usage for Fasta files::
141 | with open("example.fasta","r") as myFile:
142 | myFastaReader = FastaIterator(myFile)
143 | for record in myFastaReader:
144 | print(record.id)
145 | print(record.seq)
146 | This method SHOULD NOT be overridden by any subclass. It should be
147 | left as is, which will call the subclass implementation of __next__
148 | to actually parse the file.
149 | """
150 | return self
151 |
152 | def __len__(self):
153 | """ Return the length of the sequence"""
154 | length = sum(1 for _ in self.records)
155 | return length
156 |
157 | def parse(self, handle):
158 | """Start parsing the file, and return a SeqRecord generator."""
159 | records = self.iterate(handle)
160 | return records
161 |
162 | def iterate(self, handle):
163 | """Parse the file and generate SeqRecord objects."""
164 |
165 | for title, sequence in SimpleFastaParser(handle):
166 | try:
167 | first_word = title.split(None, 1)[0]
168 | except IndexError:
169 | assert not title, repr(title)
170 | first_word = ""
171 | yield SeqRecord(sequence, id=first_word, name=first_word, description=title)
172 |
173 |
174 | class SeqRecord:
175 | """A SeqRecord object holds a sequence and information about it.
176 | Main attributes:
177 | - id - Identifier such as a locus tag (string)
178 | - seq - The sequence itself (Seq object or similar)
179 |
180 | Additional attributes:
181 | - description - Additional text (string)
182 | """
183 |
184 | def __init__(self, sequence, id=None, name=None, description=None):
185 |
186 | """Create a SeqRecord.
187 | Arguments:
188 | - sequence - Sequence, required
189 | - id - Sequence id, (first word after >)
190 | - name - Sequence name, (first word after >)
191 | - description - Sequence description
192 | """
193 |
194 | self.id = id
195 | self.name = name
196 | self.seq = sequence
197 | self.description = description
198 |
199 | @property
200 | def length(self):
201 | """return length."""
202 | return len(self.seq)
203 |
204 | @property
205 | def gcCount(self):
206 | """return: The GC count of the string"""
207 |
208 | return self.seq.count('C') + self.seq.count('c')+self.seq.count('G')+self.seq.count('g')
209 |
210 | def __len__(self):
211 | """ Return the length of the sequence"""
212 | return self.length
213 |
214 | def __str__(self):
215 | """Output FASTA format of sequence when 'print' method is called"""
216 | s = []
217 | for i in range(0, len(self), 80):
218 | s.append(self.seq[i:i+80])
219 |
220 | return ">%s\n%s" % (self.description, "\n".join(s))
221 |
222 | def rev_comp(self):
223 | """return: The reverse complement of the string"""
224 | complement = {'A': 'T', 'C': 'G', 'G': 'C', 'T': 'A', 'N': 'N'}
225 | return ''.join([complement[base.upper()] for base in self.seq[::-1]])
226 |
227 |
228 | if __name__ == '__main__':
229 | say('a','b',1, 1.0, indent=5, decimal=2)
230 |
--------------------------------------------------------------------------------
/src/__init__.py:
--------------------------------------------------------------------------------
1 | __author__ = "Wenchao Lin"
2 | __copyright__ = "Copyright 2023 @ TBC"
3 | __license__ = "GPL"
4 | __version__ = "1.1.3"
5 | __email__ = "linwenchao@yeah.net"
6 |
--------------------------------------------------------------------------------
/src/assemblyStatistics.py:
--------------------------------------------------------------------------------
1 | #!/usr/bin/env python
2 |
3 | import sys
4 | import re
5 | import json
6 | from optparse import OptionParser
7 | from src.FastaUtils import FastaIO, Nx0, say
8 | from src import __version__
9 |
10 |
11 | def run(options):
12 | """Main method for collecting all Fasta stats"""
13 |
14 | threshold = options.length
15 | outfmt = options.format
16 |
17 | largestScaffoldName = None
18 | largestScaffoldLength = 0
19 | all_seq_list = []
20 | large_seq_list = []
21 | contig_seq_list = []
22 |
23 | n_cnt, gc_cnt, lg_n_cnt, lg_gc_cnt = 0, 0, 0, 0
24 |
25 | seqObj = FastaIO(options.fasta)
26 | for seq in seqObj:
27 | name = seq.id
28 | length = seq.length
29 | sequence = seq.seq
30 | all_seq_list.append(length)
31 | contig_seq_list += map(len, re.split('[nN]+', sequence))
32 | n_cnt += sequence.upper().count('N')
33 | gc_cnt += seq.gcCount
34 |
35 | if length > largestScaffoldLength:
36 | largestScaffoldName = name
37 | largestScaffoldLength = length
38 |
39 | if length > threshold:
40 | large_seq_list.append(length)
41 | lg_gc_cnt += seq.gcCount
42 | lg_n_cnt += sequence.upper().count('N')
43 | res_dic = {}
44 | res_dic['All scaffolds'] = {}
45 | res_dic['LARGE sequences'] = {}
46 | res_dic['Contigs'] = {}
47 | res_dic['LARGE sequences']['threshold'] = threshold
48 | res_dic['All scaffolds']['Counts of scaffold sequences'] = len(all_seq_list)
49 | res_dic['All scaffolds']['Length of scaffold sequences'] = sum(all_seq_list)
50 | res_dic['All scaffolds']['Largest scaffold name'] = largestScaffoldName
51 | res_dic['All scaffolds']['Largest scaffold length'] = largestScaffoldLength
52 | res_dic['All scaffolds']['Scaffold N50'] = Nx0(all_seq_list, 50)[0]
53 | res_dic['All scaffolds']['Counts of N50'] = Nx0(all_seq_list, 50)[1]
54 | res_dic['All scaffolds']['Scaffold N90'] = Nx0(all_seq_list, 90)[0]
55 | res_dic['All scaffolds']['Counts of N90'] = Nx0(all_seq_list, 90)[1]
56 | res_dic['All scaffolds']['GC content(%)'] = gc_cnt / sum(all_seq_list) * 100.0
57 | res_dic['All scaffolds']['N Length'] = n_cnt
58 | res_dic['All scaffolds']['N content (%)'] = n_cnt / sum(all_seq_list) * 100.0
59 | if large_seq_list:
60 | res_dic['LARGE sequences']['Counts of LARGE sequences'] = len(large_seq_list)
61 | res_dic['LARGE sequences']['Length of LARGE sequences'] = sum(large_seq_list)
62 | res_dic['LARGE sequences']['LARGE N50'] = Nx0(large_seq_list, 50)[0]
63 | res_dic['LARGE sequences']['Counts of N50'] = Nx0(large_seq_list, 50)[1]
64 | res_dic['LARGE sequences']['LARGE N90'] = Nx0(large_seq_list, 90)[0]
65 | res_dic['LARGE sequences']['Counts of LARGE N90'] = Nx0(large_seq_list, 90)[1]
66 | res_dic['LARGE sequences']['GC content(%)'] = lg_gc_cnt / sum(large_seq_list) * 100.0
67 | res_dic['LARGE sequences']['N Length'] = lg_n_cnt
68 | res_dic['LARGE sequences']['N content (%)'] = lg_n_cnt / sum(large_seq_list) * 100.0
69 | else:
70 | res_dic['LARGE sequences']['Counts of LARGE sequences'] = 0
71 | res_dic['LARGE sequences']['Length of LARGE sequences'] = 0
72 | res_dic['Contigs']['Counts of contigs'] = len(contig_seq_list)
73 | res_dic['Contigs']['Maximum length'] = max(contig_seq_list)
74 | res_dic['Contigs']['contig N50'] = Nx0(contig_seq_list, 50)[0]
75 | res_dic['Contigs']['Counts of contig N50'] = Nx0(contig_seq_list, 50)[1]
76 | res_dic['Contigs']['contig N90'] = Nx0(contig_seq_list, 90)[0]
77 | res_dic['Contigs']['Counts of contig N90'] = Nx0(contig_seq_list, 90)[1]
78 |
79 | if outfmt.upper() == 'JSON':
80 | print(json.dumps(res_dic, indent=4))
81 |
82 | else:
83 | print('\nAll scaffold sequences summary:')
84 | print('-' * 50)
85 | say('Counts of scaffold sequences', len(all_seq_list))
86 | say('Length of scaffold sequences', sum(all_seq_list))
87 | say('Largest scaffold name', largestScaffoldName)
88 | say('Largest scaffold length', largestScaffoldLength)
89 | say('Scaffold N50 ', Nx0(all_seq_list, 50)[0])
90 | say('Counts of N50', Nx0(all_seq_list, 50)[1])
91 | say('Scaffold N90', Nx0(all_seq_list, 90)[0])
92 | say('Counts of N90', Nx0(all_seq_list, 90)[1])
93 | say('GC content(%)', gc_cnt / sum(all_seq_list) * 100.0)
94 | say('N Length', n_cnt)
95 | say('N content (%)', n_cnt / sum(all_seq_list) * 100.0)
96 | print('\nLARGE (> %s bp) sequences summary:' % threshold)
97 | print('-' * 50)
98 | if large_seq_list:
99 | say('Counts of LARGE sequences', len(large_seq_list))
100 | say('Length of LARGE sequences', sum(large_seq_list))
101 | say('LARGE scaffold N50', Nx0(large_seq_list, 50)[0])
102 | say('Counts of LARGE N50', Nx0(large_seq_list, 50)[1])
103 | say('LARGE scaffold N90', Nx0(large_seq_list, 90)[0])
104 | say('Counts of LARGE N90', Nx0(large_seq_list, 90)[1])
105 | say('GC content(%)', lg_gc_cnt / sum(large_seq_list) * 100.0)
106 | say('N Length', lg_n_cnt)
107 | say('N content (%)', lg_n_cnt / sum(large_seq_list) * 100.0)
108 | else:
109 | say('Counts of LARGE sequences', 0)
110 | say('Length of LARGE sequences', 0)
111 | print('\ncontigs summary:')
112 | print('-'*50)
113 | say('Counts of contigs', len(contig_seq_list))
114 | say('Maximum length of contigs', max(contig_seq_list))
115 | say('contig N50', Nx0(contig_seq_list, 50)[0])
116 | say('Counts of contig N50', Nx0(contig_seq_list, 50)[1])
117 | say('contig N90', Nx0(contig_seq_list, 90)[0])
118 | say('Counts of contig N90', Nx0(contig_seq_list, 90)[1])
119 |
120 | def main():
121 |
122 | """ parse options """
123 | usage = 'usage: %prog [options] -f INPUT.fasta'
124 | parser = OptionParser(prog='assemblyStatistics',
125 | description='A script to evaluate the assembly of a given fasta.',
126 | usage=usage,
127 | version=__version__,
128 | )
129 | parser.add_option('-f', '--fasta',
130 | dest='fasta', metavar='FILE',
131 | help='input fasta file'
132 | )
133 | parser.add_option('-t', '--outfmt',
134 | dest="format",
135 | type='choice',
136 | choices=['txt','json'],
137 | default='txt',
138 | help='format of the output, choices = [txt, json]'
139 | )
140 | parser.add_option('-l', '-L', '--length',
141 | dest='length', default=1000, type=int,
142 | help='Threshold of length defined a sequence as Large [default = 1000]'
143 | )
144 |
145 | (options, args) = parser.parse_args()
146 | if not options.fasta:
147 | try:
148 | options.fasta = args[0]
149 | except IndexError:
150 | parser.print_help()
151 | sys.exit()
152 |
153 | run(options)
154 |
155 |
156 | if __name__ == "__main__":
157 |
158 | main()
159 |
--------------------------------------------------------------------------------
/tests/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/WenchaoLin/assemblyStatistics/3417a5da83c23e7dc89585d925dfd6670c412bb3/tests/__init__.py
--------------------------------------------------------------------------------
/tests/sample.fasta:
--------------------------------------------------------------------------------
1 | >seq1
2 | GGGGGGGGGGCCCCCCCCCC
3 | >seq2
4 | TGAGTGAGACTACCCGGGTATCTAnnnnnnnnnnnnnnnnNNNNNNTCCCATTCGCTCCCCTA
5 | GCTTTCGTCCCTCAGTGTCAGTTTTGGCCTAGCAGAGCGCCTTCGCCA
6 | CCGGTGTTCTTCCTGATATCTACGCATTTCACCGCTACACCAGGAATTCCCTCT
7 | GCCCCGACCATACCCTAGCTTTGTAGTTTCCACTGCTTTGATCTGGTTGAGCCAGACTCTTTAACAG
8 | CAGACAAACAATGCCACCTGCGGACCCTTTACGCCCAAT
9 | >seq3
10 | TGAGTGAGACTACCCGGGTATCTAATCCCNNNNNNNNNNNNNNNNNNNNATTCGCTCCCCTA
11 | GCTTTCGTCCCTCAGTGTCAGTTTTGGCCTAGCAGAGCGCCTTCGCCA
12 | CCGGTGTTCTTCCTGATATCTACGnnnnnnnnNNNNNNCCAGGAATTCCCTCT
13 | GCCCCGACCATACCCTAGCTTTGTAGTTTCCACTGCTTTGATCTGGTTGAGCCAGACTCTTTAACAG
14 | CAGACAAACAATGCCACCTGCGGACCCTTTACGCCCAAT
15 | >seq4
16 | TGAGTGAGACTACCCGGGTATNNNCTAATCCCATTCGCTCCCCTA
--------------------------------------------------------------------------------
/tests/test_module.py:
--------------------------------------------------------------------------------
1 | import unittest
2 | from src.FastaUtils import Nx0, FastaIO, say
3 | # First party modules #
4 | import os
5 |
6 | this_dir = os.path.dirname(__file__)
7 |
8 |
9 | class MyTestCase(unittest.TestCase):
10 |
11 | def test_Nx0(self):
12 | data = [10, 20, 30, 40, 50]
13 | self.assertEqual(Nx0(data, 50), (40, 2))
14 |
15 | def test_FastaIO(self):
16 | seqs = FastaIO(os.path.join(this_dir, 'sample.fasta'))
17 | self.assertEqual(len(seqs), 4)
18 |
19 | def test_say(self):
20 | strings = say('a','b',1, 1.0, indent=5, decimal=2)
21 | self.assertIn(strings.strip(), 'a b 1 1.00')
22 |
23 |
24 | if __name__ == '__main__':
25 | unittest.main()
26 |
--------------------------------------------------------------------------------