├── .github └── workflows │ ├── python-package.yml │ └── python-publish.yml ├── .gitignore ├── LICENSE ├── README.md ├── pyproject.toml ├── setup.py ├── src ├── FastaUtils.py ├── __init__.py └── assemblyStatistics.py └── tests ├── __init__.py ├── sample.fasta └── test_module.py /.github/workflows/python-package.yml: -------------------------------------------------------------------------------- 1 | # This workflow will install Python dependencies, run tests and lint with a variety of Python versions 2 | # For more information see: https://docs.github.com/en/actions/automating-builds-and-tests/building-and-testing-python 3 | 4 | name: Python package 5 | 6 | on: 7 | push: 8 | branches: [ "master" ] 9 | pull_request: 10 | branches: [ "master" ] 11 | 12 | jobs: 13 | build: 14 | 15 | runs-on: ubuntu-latest 16 | strategy: 17 | fail-fast: false 18 | matrix: 19 | python-version: ["3.8", "3.9", "3.10"] 20 | 21 | steps: 22 | - uses: actions/checkout@v3 23 | - name: Set up Python ${{ matrix.python-version }} 24 | uses: actions/setup-python@v3 25 | with: 26 | python-version: ${{ matrix.python-version }} 27 | - name: Install dependencies 28 | run: | 29 | python -m pip install --upgrade pip 30 | python -m pip install flake8 pytest 31 | if [ -f requirements.txt ]; then pip install -r requirements.txt; fi 32 | - name: Lint with flake8 33 | run: | 34 | # stop the build if there are Python syntax errors or undefined names 35 | flake8 . --count --select=E9,F63,F7,F82 --show-source --statistics 36 | # exit-zero treats all errors as warnings. The GitHub editor is 127 chars wide 37 | flake8 . --count --exit-zero --max-complexity=10 --max-line-length=127 --statistics 38 | - name: Test with pytest 39 | run: | 40 | pytest 41 | -------------------------------------------------------------------------------- /.github/workflows/python-publish.yml: -------------------------------------------------------------------------------- 1 | # This workflow will upload a Python Package using Twine when a release is created 2 | # For more information see: https://docs.github.com/en/actions/automating-builds-and-tests/building-and-testing-python#publishing-to-package-registries 3 | 4 | # This workflow uses actions that are not certified by GitHub. 5 | # They are provided by a third-party and are governed by 6 | # separate terms of service, privacy policy, and support 7 | # documentation. 8 | 9 | name: Upload Python Package 10 | 11 | on: 12 | release: 13 | types: [published] 14 | 15 | permissions: 16 | contents: read 17 | 18 | jobs: 19 | deploy: 20 | 21 | runs-on: ubuntu-latest 22 | 23 | steps: 24 | - uses: actions/checkout@v3 25 | - name: Set up Python 26 | uses: actions/setup-python@v3 27 | with: 28 | python-version: '3.x' 29 | - name: Install dependencies 30 | run: | 31 | python -m pip install --upgrade pip 32 | pip install build 33 | - name: Build package 34 | run: python -m build 35 | - name: Publish package 36 | uses: pypa/gh-action-pypi-publish@27b31702a0e7fc50959f5ad993c78deac1bdfc29 37 | with: 38 | user: __token__ 39 | password: ${{ secrets.PYPI_API_TOKEN }} 40 | -------------------------------------------------------------------------------- /.gitignore: -------------------------------------------------------------------------------- 1 | # Byte-compiled / optimized / DLL files 2 | __pycache__/ 3 | *.py[cod] 4 | 5 | # C extensions 6 | *.so 7 | 8 | # Distribution / packaging 9 | .Python 10 | env/ 11 | build/ 12 | develop-eggs/ 13 | dist/ 14 | downloads/ 15 | eggs/ 16 | .eggs/ 17 | lib/ 18 | lib64/ 19 | parts/ 20 | sdist/ 21 | var/ 22 | *.egg-info/ 23 | .installed.cfg 24 | *.egg 25 | 26 | # PyInstaller 27 | # Usually these files are written by a python script from a template 28 | # before PyInstaller builds the exe, so as to inject date/other infos into it. 29 | *.manifest 30 | *.spec 31 | 32 | # Installer logs 33 | pip-log.txt 34 | pip-delete-this-directory.txt 35 | 36 | # Unit test / coverage reports 37 | htmlcov/ 38 | .tox/ 39 | .coverage 40 | .coverage.* 41 | .cache 42 | nosetests.xml 43 | coverage.xml 44 | *,cover 45 | 46 | # Translations 47 | *.mo 48 | *.pot 49 | 50 | # Django stuff: 51 | *.log 52 | 53 | # Sphinx documentation 54 | docs/_build/ 55 | 56 | # PyBuilder 57 | target/ 58 | -------------------------------------------------------------------------------- /LICENSE: -------------------------------------------------------------------------------- 1 | GNU GENERAL PUBLIC LICENSE 2 | Version 3, 29 June 2007 3 | 4 | Copyright (C) 2007 Free Software Foundation, Inc. 5 | Everyone is permitted to copy and distribute verbatim copies 6 | of this license document, but changing it is not allowed. 7 | 8 | Preamble 9 | 10 | The GNU General Public License is a free, copyleft license for 11 | software and other kinds of works. 12 | 13 | The licenses for most software and other practical works are designed 14 | to take away your freedom to share and change the works. By contrast, 15 | the GNU General Public License is intended to guarantee your freedom to 16 | share and change all versions of a program--to make sure it remains free 17 | software for all its users. We, the Free Software Foundation, use the 18 | GNU General Public License for most of our software; it applies also to 19 | any other work released this way by its authors. You can apply it to 20 | your programs, too. 21 | 22 | When we speak of free software, we are referring to freedom, not 23 | price. Our General Public Licenses are designed to make sure that you 24 | have the freedom to distribute copies of free software (and charge for 25 | them if you wish), that you receive source code or can get it if you 26 | want it, that you can change the software or use pieces of it in new 27 | free programs, and that you know you can do these things. 28 | 29 | To protect your rights, we need to prevent others from denying you 30 | these rights or asking you to surrender the rights. Therefore, you have 31 | certain responsibilities if you distribute copies of the software, or if 32 | you modify it: responsibilities to respect the freedom of others. 33 | 34 | For example, if you distribute copies of such a program, whether 35 | gratis or for a fee, you must pass on to the recipients the same 36 | freedoms that you received. You must make sure that they, too, receive 37 | or can get the source code. And you must show them these terms so they 38 | know their rights. 39 | 40 | Developers that use the GNU GPL protect your rights with two steps: 41 | (1) assert copyright on the software, and (2) offer you this License 42 | giving you legal permission to copy, distribute and/or modify it. 43 | 44 | For the developers' and authors' protection, the GPL clearly explains 45 | that there is no warranty for this free software. For both users' and 46 | authors' sake, the GPL requires that modified versions be marked as 47 | changed, so that their problems will not be attributed erroneously to 48 | authors of previous versions. 49 | 50 | Some devices are designed to deny users access to install or run 51 | modified versions of the software inside them, although the manufacturer 52 | can do so. This is fundamentally incompatible with the aim of 53 | protecting users' freedom to change the software. The systematic 54 | pattern of such abuse occurs in the area of products for individuals to 55 | use, which is precisely where it is most unacceptable. Therefore, we 56 | have designed this version of the GPL to prohibit the practice for those 57 | products. If such problems arise substantially in other domains, we 58 | stand ready to extend this provision to those domains in future versions 59 | of the GPL, as needed to protect the freedom of users. 60 | 61 | Finally, every program is threatened constantly by software patents. 62 | States should not allow patents to restrict development and use of 63 | software on general-purpose computers, but in those that do, we wish to 64 | avoid the special danger that patents applied to a free program could 65 | make it effectively proprietary. To prevent this, the GPL assures that 66 | patents cannot be used to render the program non-free. 67 | 68 | The precise terms and conditions for copying, distribution and 69 | modification follow. 70 | 71 | TERMS AND CONDITIONS 72 | 73 | 0. Definitions. 74 | 75 | "This License" refers to version 3 of the GNU General Public License. 76 | 77 | "Copyright" also means copyright-like laws that apply to other kinds of 78 | works, such as semiconductor masks. 79 | 80 | "The Program" refers to any copyrightable work licensed under this 81 | License. Each licensee is addressed as "you". "Licensees" and 82 | "recipients" may be individuals or organizations. 83 | 84 | To "modify" a work means to copy from or adapt all or part of the work 85 | in a fashion requiring copyright permission, other than the making of an 86 | exact copy. The resulting work is called a "modified version" of the 87 | earlier work or a work "based on" the earlier work. 88 | 89 | A "covered work" means either the unmodified Program or a work based 90 | on the Program. 91 | 92 | To "propagate" a work means to do anything with it that, without 93 | permission, would make you directly or secondarily liable for 94 | infringement under applicable copyright law, except executing it on a 95 | computer or modifying a private copy. Propagation includes copying, 96 | distribution (with or without modification), making available to the 97 | public, and in some countries other activities as well. 98 | 99 | To "convey" a work means any kind of propagation that enables other 100 | parties to make or receive copies. Mere interaction with a user through 101 | a computer network, with no transfer of a copy, is not conveying. 102 | 103 | An interactive user interface displays "Appropriate Legal Notices" 104 | to the extent that it includes a convenient and prominently visible 105 | feature that (1) displays an appropriate copyright notice, and (2) 106 | tells the user that there is no warranty for the work (except to the 107 | extent that warranties are provided), that licensees may convey the 108 | work under this License, and how to view a copy of this License. If 109 | the interface presents a list of user commands or options, such as a 110 | menu, a prominent item in the list meets this criterion. 111 | 112 | 1. Source Code. 113 | 114 | The "source code" for a work means the preferred form of the work 115 | for making modifications to it. "Object code" means any non-source 116 | form of a work. 117 | 118 | A "Standard Interface" means an interface that either is an official 119 | standard defined by a recognized standards body, or, in the case of 120 | interfaces specified for a particular programming language, one that 121 | is widely used among developers working in that language. 122 | 123 | The "System Libraries" of an executable work include anything, other 124 | than the work as a whole, that (a) is included in the normal form of 125 | packaging a Major Component, but which is not part of that Major 126 | Component, and (b) serves only to enable use of the work with that 127 | Major Component, or to implement a Standard Interface for which an 128 | implementation is available to the public in source code form. A 129 | "Major Component", in this context, means a major essential component 130 | (kernel, window system, and so on) of the specific operating system 131 | (if any) on which the executable work runs, or a compiler used to 132 | produce the work, or an object code interpreter used to run it. 133 | 134 | The "Corresponding Source" for a work in object code form means all 135 | the source code needed to generate, install, and (for an executable 136 | work) run the object code and to modify the work, including scripts to 137 | control those activities. However, it does not include the work's 138 | System Libraries, or general-purpose tools or generally available free 139 | programs which are used unmodified in performing those activities but 140 | which are not part of the work. For example, Corresponding Source 141 | includes interface definition files associated with source files for 142 | the work, and the source code for shared libraries and dynamically 143 | linked subprograms that the work is specifically designed to require, 144 | such as by intimate data communication or control flow between those 145 | subprograms and other parts of the work. 146 | 147 | The Corresponding Source need not include anything that users 148 | can regenerate automatically from other parts of the Corresponding 149 | Source. 150 | 151 | The Corresponding Source for a work in source code form is that 152 | same work. 153 | 154 | 2. Basic Permissions. 155 | 156 | All rights granted under this License are granted for the term of 157 | copyright on the Program, and are irrevocable provided the stated 158 | conditions are met. This License explicitly affirms your unlimited 159 | permission to run the unmodified Program. The output from running a 160 | covered work is covered by this License only if the output, given its 161 | content, constitutes a covered work. This License acknowledges your 162 | rights of fair use or other equivalent, as provided by copyright law. 163 | 164 | You may make, run and propagate covered works that you do not 165 | convey, without conditions so long as your license otherwise remains 166 | in force. You may convey covered works to others for the sole purpose 167 | of having them make modifications exclusively for you, or provide you 168 | with facilities for running those works, provided that you comply with 169 | the terms of this License in conveying all material for which you do 170 | not control copyright. Those thus making or running the covered works 171 | for you must do so exclusively on your behalf, under your direction 172 | and control, on terms that prohibit them from making any copies of 173 | your copyrighted material outside their relationship with you. 174 | 175 | Conveying under any other circumstances is permitted solely under 176 | the conditions stated below. Sublicensing is not allowed; section 10 177 | makes it unnecessary. 178 | 179 | 3. Protecting Users' Legal Rights From Anti-Circumvention Law. 180 | 181 | No covered work shall be deemed part of an effective technological 182 | measure under any applicable law fulfilling obligations under article 183 | 11 of the WIPO copyright treaty adopted on 20 December 1996, or 184 | similar laws prohibiting or restricting circumvention of such 185 | measures. 186 | 187 | When you convey a covered work, you waive any legal power to forbid 188 | circumvention of technological measures to the extent such circumvention 189 | is effected by exercising rights under this License with respect to 190 | the covered work, and you disclaim any intention to limit operation or 191 | modification of the work as a means of enforcing, against the work's 192 | users, your or third parties' legal rights to forbid circumvention of 193 | technological measures. 194 | 195 | 4. Conveying Verbatim Copies. 196 | 197 | You may convey verbatim copies of the Program's source code as you 198 | receive it, in any medium, provided that you conspicuously and 199 | appropriately publish on each copy an appropriate copyright notice; 200 | keep intact all notices stating that this License and any 201 | non-permissive terms added in accord with section 7 apply to the code; 202 | keep intact all notices of the absence of any warranty; and give all 203 | recipients a copy of this License along with the Program. 204 | 205 | You may charge any price or no price for each copy that you convey, 206 | and you may offer support or warranty protection for a fee. 207 | 208 | 5. Conveying Modified Source Versions. 209 | 210 | You may convey a work based on the Program, or the modifications to 211 | produce it from the Program, in the form of source code under the 212 | terms of section 4, provided that you also meet all of these conditions: 213 | 214 | a) The work must carry prominent notices stating that you modified 215 | it, and giving a relevant date. 216 | 217 | b) The work must carry prominent notices stating that it is 218 | released under this License and any conditions added under section 219 | 7. This requirement modifies the requirement in section 4 to 220 | "keep intact all notices". 221 | 222 | c) You must license the entire work, as a whole, under this 223 | License to anyone who comes into possession of a copy. This 224 | License will therefore apply, along with any applicable section 7 225 | additional terms, to the whole of the work, and all its parts, 226 | regardless of how they are packaged. This License gives no 227 | permission to license the work in any other way, but it does not 228 | invalidate such permission if you have separately received it. 229 | 230 | d) If the work has interactive user interfaces, each must display 231 | Appropriate Legal Notices; however, if the Program has interactive 232 | interfaces that do not display Appropriate Legal Notices, your 233 | work need not make them do so. 234 | 235 | A compilation of a covered work with other separate and independent 236 | works, which are not by their nature extensions of the covered work, 237 | and which are not combined with it such as to form a larger program, 238 | in or on a volume of a storage or distribution medium, is called an 239 | "aggregate" if the compilation and its resulting copyright are not 240 | used to limit the access or legal rights of the compilation's users 241 | beyond what the individual works permit. Inclusion of a covered work 242 | in an aggregate does not cause this License to apply to the other 243 | parts of the aggregate. 244 | 245 | 6. Conveying Non-Source Forms. 246 | 247 | You may convey a covered work in object code form under the terms 248 | of sections 4 and 5, provided that you also convey the 249 | machine-readable Corresponding Source under the terms of this License, 250 | in one of these ways: 251 | 252 | a) Convey the object code in, or embodied in, a physical product 253 | (including a physical distribution medium), accompanied by the 254 | Corresponding Source fixed on a durable physical medium 255 | customarily used for software interchange. 256 | 257 | b) Convey the object code in, or embodied in, a physical product 258 | (including a physical distribution medium), accompanied by a 259 | written offer, valid for at least three years and valid for as 260 | long as you offer spare parts or customer support for that product 261 | model, to give anyone who possesses the object code either (1) a 262 | copy of the Corresponding Source for all the software in the 263 | product that is covered by this License, on a durable physical 264 | medium customarily used for software interchange, for a price no 265 | more than your reasonable cost of physically performing this 266 | conveying of source, or (2) access to copy the 267 | Corresponding Source from a network server at no charge. 268 | 269 | c) Convey individual copies of the object code with a copy of the 270 | written offer to provide the Corresponding Source. This 271 | alternative is allowed only occasionally and noncommercially, and 272 | only if you received the object code with such an offer, in accord 273 | with subsection 6b. 274 | 275 | d) Convey the object code by offering access from a designated 276 | place (gratis or for a charge), and offer equivalent access to the 277 | Corresponding Source in the same way through the same place at no 278 | further charge. You need not require recipients to copy the 279 | Corresponding Source along with the object code. If the place to 280 | copy the object code is a network server, the Corresponding Source 281 | may be on a different server (operated by you or a third party) 282 | that supports equivalent copying facilities, provided you maintain 283 | clear directions next to the object code saying where to find the 284 | Corresponding Source. Regardless of what server hosts the 285 | Corresponding Source, you remain obligated to ensure that it is 286 | available for as long as needed to satisfy these requirements. 287 | 288 | e) Convey the object code using peer-to-peer transmission, provided 289 | you inform other peers where the object code and Corresponding 290 | Source of the work are being offered to the general public at no 291 | charge under subsection 6d. 292 | 293 | A separable portion of the object code, whose source code is excluded 294 | from the Corresponding Source as a System Library, need not be 295 | included in conveying the object code work. 296 | 297 | A "User Product" is either (1) a "consumer product", which means any 298 | tangible personal property which is normally used for personal, family, 299 | or household purposes, or (2) anything designed or sold for incorporation 300 | into a dwelling. In determining whether a product is a consumer product, 301 | doubtful cases shall be resolved in favor of coverage. For a particular 302 | product received by a particular user, "normally used" refers to a 303 | typical or common use of that class of product, regardless of the status 304 | of the particular user or of the way in which the particular user 305 | actually uses, or expects or is expected to use, the product. A product 306 | is a consumer product regardless of whether the product has substantial 307 | commercial, industrial or non-consumer uses, unless such uses represent 308 | the only significant mode of use of the product. 309 | 310 | "Installation Information" for a User Product means any methods, 311 | procedures, authorization keys, or other information required to install 312 | and execute modified versions of a covered work in that User Product from 313 | a modified version of its Corresponding Source. The information must 314 | suffice to ensure that the continued functioning of the modified object 315 | code is in no case prevented or interfered with solely because 316 | modification has been made. 317 | 318 | If you convey an object code work under this section in, or with, or 319 | specifically for use in, a User Product, and the conveying occurs as 320 | part of a transaction in which the right of possession and use of the 321 | User Product is transferred to the recipient in perpetuity or for a 322 | fixed term (regardless of how the transaction is characterized), the 323 | Corresponding Source conveyed under this section must be accompanied 324 | by the Installation Information. But this requirement does not apply 325 | if neither you nor any third party retains the ability to install 326 | modified object code on the User Product (for example, the work has 327 | been installed in ROM). 328 | 329 | The requirement to provide Installation Information does not include a 330 | requirement to continue to provide support service, warranty, or updates 331 | for a work that has been modified or installed by the recipient, or for 332 | the User Product in which it has been modified or installed. Access to a 333 | network may be denied when the modification itself materially and 334 | adversely affects the operation of the network or violates the rules and 335 | protocols for communication across the network. 336 | 337 | Corresponding Source conveyed, and Installation Information provided, 338 | in accord with this section must be in a format that is publicly 339 | documented (and with an implementation available to the public in 340 | source code form), and must require no special password or key for 341 | unpacking, reading or copying. 342 | 343 | 7. Additional Terms. 344 | 345 | "Additional permissions" are terms that supplement the terms of this 346 | License by making exceptions from one or more of its conditions. 347 | Additional permissions that are applicable to the entire Program shall 348 | be treated as though they were included in this License, to the extent 349 | that they are valid under applicable law. If additional permissions 350 | apply only to part of the Program, that part may be used separately 351 | under those permissions, but the entire Program remains governed by 352 | this License without regard to the additional permissions. 353 | 354 | When you convey a copy of a covered work, you may at your option 355 | remove any additional permissions from that copy, or from any part of 356 | it. (Additional permissions may be written to require their own 357 | removal in certain cases when you modify the work.) You may place 358 | additional permissions on material, added by you to a covered work, 359 | for which you have or can give appropriate copyright permission. 360 | 361 | Notwithstanding any other provision of this License, for material you 362 | add to a covered work, you may (if authorized by the copyright holders of 363 | that material) supplement the terms of this License with terms: 364 | 365 | a) Disclaiming warranty or limiting liability differently from the 366 | terms of sections 15 and 16 of this License; or 367 | 368 | b) Requiring preservation of specified reasonable legal notices or 369 | author attributions in that material or in the Appropriate Legal 370 | Notices displayed by works containing it; or 371 | 372 | c) Prohibiting misrepresentation of the origin of that material, or 373 | requiring that modified versions of such material be marked in 374 | reasonable ways as different from the original version; or 375 | 376 | d) Limiting the use for publicity purposes of names of licensors or 377 | authors of the material; or 378 | 379 | e) Declining to grant rights under trademark law for use of some 380 | trade names, trademarks, or service marks; or 381 | 382 | f) Requiring indemnification of licensors and authors of that 383 | material by anyone who conveys the material (or modified versions of 384 | it) with contractual assumptions of liability to the recipient, for 385 | any liability that these contractual assumptions directly impose on 386 | those licensors and authors. 387 | 388 | All other non-permissive additional terms are considered "further 389 | restrictions" within the meaning of section 10. If the Program as you 390 | received it, or any part of it, contains a notice stating that it is 391 | governed by this License along with a term that is a further 392 | restriction, you may remove that term. If a license document contains 393 | a further restriction but permits relicensing or conveying under this 394 | License, you may add to a covered work material governed by the terms 395 | of that license document, provided that the further restriction does 396 | not survive such relicensing or conveying. 397 | 398 | If you add terms to a covered work in accord with this section, you 399 | must place, in the relevant source files, a statement of the 400 | additional terms that apply to those files, or a notice indicating 401 | where to find the applicable terms. 402 | 403 | Additional terms, permissive or non-permissive, may be stated in the 404 | form of a separately written license, or stated as exceptions; 405 | the above requirements apply either way. 406 | 407 | 8. Termination. 408 | 409 | You may not propagate or modify a covered work except as expressly 410 | provided under this License. Any attempt otherwise to propagate or 411 | modify it is void, and will automatically terminate your rights under 412 | this License (including any patent licenses granted under the third 413 | paragraph of section 11). 414 | 415 | However, if you cease all violation of this License, then your 416 | license from a particular copyright holder is reinstated (a) 417 | provisionally, unless and until the copyright holder explicitly and 418 | finally terminates your license, and (b) permanently, if the copyright 419 | holder fails to notify you of the violation by some reasonable means 420 | prior to 60 days after the cessation. 421 | 422 | Moreover, your license from a particular copyright holder is 423 | reinstated permanently if the copyright holder notifies you of the 424 | violation by some reasonable means, this is the first time you have 425 | received notice of violation of this License (for any work) from that 426 | copyright holder, and you cure the violation prior to 30 days after 427 | your receipt of the notice. 428 | 429 | Termination of your rights under this section does not terminate the 430 | licenses of parties who have received copies or rights from you under 431 | this License. If your rights have been terminated and not permanently 432 | reinstated, you do not qualify to receive new licenses for the same 433 | material under section 10. 434 | 435 | 9. Acceptance Not Required for Having Copies. 436 | 437 | You are not required to accept this License in order to receive or 438 | run a copy of the Program. Ancillary propagation of a covered work 439 | occurring solely as a consequence of using peer-to-peer transmission 440 | to receive a copy likewise does not require acceptance. However, 441 | nothing other than this License grants you permission to propagate or 442 | modify any covered work. These actions infringe copyright if you do 443 | not accept this License. Therefore, by modifying or propagating a 444 | covered work, you indicate your acceptance of this License to do so. 445 | 446 | 10. Automatic Licensing of Downstream Recipients. 447 | 448 | Each time you convey a covered work, the recipient automatically 449 | receives a license from the original licensors, to run, modify and 450 | propagate that work, subject to this License. You are not responsible 451 | for enforcing compliance by third parties with this License. 452 | 453 | An "entity transaction" is a transaction transferring control of an 454 | organization, or substantially all assets of one, or subdividing an 455 | organization, or merging organizations. If propagation of a covered 456 | work results from an entity transaction, each party to that 457 | transaction who receives a copy of the work also receives whatever 458 | licenses to the work the party's predecessor in interest had or could 459 | give under the previous paragraph, plus a right to possession of the 460 | Corresponding Source of the work from the predecessor in interest, if 461 | the predecessor has it or can get it with reasonable efforts. 462 | 463 | You may not impose any further restrictions on the exercise of the 464 | rights granted or affirmed under this License. For example, you may 465 | not impose a license fee, royalty, or other charge for exercise of 466 | rights granted under this License, and you may not initiate litigation 467 | (including a cross-claim or counterclaim in a lawsuit) alleging that 468 | any patent claim is infringed by making, using, selling, offering for 469 | sale, or importing the Program or any portion of it. 470 | 471 | 11. Patents. 472 | 473 | A "contributor" is a copyright holder who authorizes use under this 474 | License of the Program or a work on which the Program is based. The 475 | work thus licensed is called the contributor's "contributor version". 476 | 477 | A contributor's "essential patent claims" are all patent claims 478 | owned or controlled by the contributor, whether already acquired or 479 | hereafter acquired, that would be infringed by some manner, permitted 480 | by this License, of making, using, or selling its contributor version, 481 | but do not include claims that would be infringed only as a 482 | consequence of further modification of the contributor version. For 483 | purposes of this definition, "control" includes the right to grant 484 | patent sublicenses in a manner consistent with the requirements of 485 | this License. 486 | 487 | Each contributor grants you a non-exclusive, worldwide, royalty-free 488 | patent license under the contributor's essential patent claims, to 489 | make, use, sell, offer for sale, import and otherwise run, modify and 490 | propagate the contents of its contributor version. 491 | 492 | In the following three paragraphs, a "patent license" is any express 493 | agreement or commitment, however denominated, not to enforce a patent 494 | (such as an express permission to practice a patent or covenant not to 495 | sue for patent infringement). To "grant" such a patent license to a 496 | party means to make such an agreement or commitment not to enforce a 497 | patent against the party. 498 | 499 | If you convey a covered work, knowingly relying on a patent license, 500 | and the Corresponding Source of the work is not available for anyone 501 | to copy, free of charge and under the terms of this License, through a 502 | publicly available network server or other readily accessible means, 503 | then you must either (1) cause the Corresponding Source to be so 504 | available, or (2) arrange to deprive yourself of the benefit of the 505 | patent license for this particular work, or (3) arrange, in a manner 506 | consistent with the requirements of this License, to extend the patent 507 | license to downstream recipients. "Knowingly relying" means you have 508 | actual knowledge that, but for the patent license, your conveying the 509 | covered work in a country, or your recipient's use of the covered work 510 | in a country, would infringe one or more identifiable patents in that 511 | country that you have reason to believe are valid. 512 | 513 | If, pursuant to or in connection with a single transaction or 514 | arrangement, you convey, or propagate by procuring conveyance of, a 515 | covered work, and grant a patent license to some of the parties 516 | receiving the covered work authorizing them to use, propagate, modify 517 | or convey a specific copy of the covered work, then the patent license 518 | you grant is automatically extended to all recipients of the covered 519 | work and works based on it. 520 | 521 | A patent license is "discriminatory" if it does not include within 522 | the scope of its coverage, prohibits the exercise of, or is 523 | conditioned on the non-exercise of one or more of the rights that are 524 | specifically granted under this License. You may not convey a covered 525 | work if you are a party to an arrangement with a third party that is 526 | in the business of distributing software, under which you make payment 527 | to the third party based on the extent of your activity of conveying 528 | the work, and under which the third party grants, to any of the 529 | parties who would receive the covered work from you, a discriminatory 530 | patent license (a) in connection with copies of the covered work 531 | conveyed by you (or copies made from those copies), or (b) primarily 532 | for and in connection with specific products or compilations that 533 | contain the covered work, unless you entered into that arrangement, 534 | or that patent license was granted, prior to 28 March 2007. 535 | 536 | Nothing in this License shall be construed as excluding or limiting 537 | any implied license or other defenses to infringement that may 538 | otherwise be available to you under applicable patent law. 539 | 540 | 12. No Surrender of Others' Freedom. 541 | 542 | If conditions are imposed on you (whether by court order, agreement or 543 | otherwise) that contradict the conditions of this License, they do not 544 | excuse you from the conditions of this License. If you cannot convey a 545 | covered work so as to satisfy simultaneously your obligations under this 546 | License and any other pertinent obligations, then as a consequence you may 547 | not convey it at all. For example, if you agree to terms that obligate you 548 | to collect a royalty for further conveying from those to whom you convey 549 | the Program, the only way you could satisfy both those terms and this 550 | License would be to refrain entirely from conveying the Program. 551 | 552 | 13. Use with the GNU Affero General Public License. 553 | 554 | Notwithstanding any other provision of this License, you have 555 | permission to link or combine any covered work with a work licensed 556 | under version 3 of the GNU Affero General Public License into a single 557 | combined work, and to convey the resulting work. The terms of this 558 | License will continue to apply to the part which is the covered work, 559 | but the special requirements of the GNU Affero General Public License, 560 | section 13, concerning interaction through a network will apply to the 561 | combination as such. 562 | 563 | 14. Revised Versions of this License. 564 | 565 | The Free Software Foundation may publish revised and/or new versions of 566 | the GNU General Public License from time to time. Such new versions will 567 | be similar in spirit to the present version, but may differ in detail to 568 | address new problems or concerns. 569 | 570 | Each version is given a distinguishing version number. If the 571 | Program specifies that a certain numbered version of the GNU General 572 | Public License "or any later version" applies to it, you have the 573 | option of following the terms and conditions either of that numbered 574 | version or of any later version published by the Free Software 575 | Foundation. If the Program does not specify a version number of the 576 | GNU General Public License, you may choose any version ever published 577 | by the Free Software Foundation. 578 | 579 | If the Program specifies that a proxy can decide which future 580 | versions of the GNU General Public License can be used, that proxy's 581 | public statement of acceptance of a version permanently authorizes you 582 | to choose that version for the Program. 583 | 584 | Later license versions may give you additional or different 585 | permissions. However, no additional obligations are imposed on any 586 | author or copyright holder as a result of your choosing to follow a 587 | later version. 588 | 589 | 15. Disclaimer of Warranty. 590 | 591 | THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY 592 | APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT 593 | HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY 594 | OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, 595 | THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR 596 | PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM 597 | IS WITH YOU. SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF 598 | ALL NECESSARY SERVICING, REPAIR OR CORRECTION. 599 | 600 | 16. Limitation of Liability. 601 | 602 | IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING 603 | WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES AND/OR CONVEYS 604 | THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY 605 | GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE 606 | USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF 607 | DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD 608 | PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS), 609 | EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF 610 | SUCH DAMAGES. 611 | 612 | 17. Interpretation of Sections 15 and 16. 613 | 614 | If the disclaimer of warranty and limitation of liability provided 615 | above cannot be given local legal effect according to their terms, 616 | reviewing courts shall apply local law that most closely approximates 617 | an absolute waiver of all civil liability in connection with the 618 | Program, unless a warranty or assumption of liability accompanies a 619 | copy of the Program in return for a fee. 620 | 621 | END OF TERMS AND CONDITIONS 622 | 623 | How to Apply These Terms to Your New Programs 624 | 625 | If you develop a new program, and you want it to be of the greatest 626 | possible use to the public, the best way to achieve this is to make it 627 | free software which everyone can redistribute and change under these terms. 628 | 629 | To do so, attach the following notices to the program. It is safest 630 | to attach them to the start of each source file to most effectively 631 | state the exclusion of warranty; and each file should have at least 632 | the "copyright" line and a pointer to where the full notice is found. 633 | 634 | {one line to give the program's name and a brief idea of what it does.} 635 | Copyright (C) {year} {name of author} 636 | 637 | This program is free software: you can redistribute it and/or modify 638 | it under the terms of the GNU General Public License as published by 639 | the Free Software Foundation, either version 3 of the License, or 640 | (at your option) any later version. 641 | 642 | This program is distributed in the hope that it will be useful, 643 | but WITHOUT ANY WARRANTY; without even the implied warranty of 644 | MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the 645 | GNU General Public License for more details. 646 | 647 | You should have received a copy of the GNU General Public License 648 | along with this program. If not, see . 649 | 650 | Also add information on how to contact you by electronic and paper mail. 651 | 652 | If the program does terminal interaction, make it output a short 653 | notice like this when it starts in an interactive mode: 654 | 655 | {project} Copyright (C) {year} {fullname} 656 | This program comes with ABSOLUTELY NO WARRANTY; for details type `show w'. 657 | This is free software, and you are welcome to redistribute it 658 | under certain conditions; type `show c' for details. 659 | 660 | The hypothetical commands `show w' and `show c' should show the appropriate 661 | parts of the General Public License. Of course, your program's commands 662 | might be different; for a GUI interface, you would use an "about box". 663 | 664 | You should also get your employer (if you work as a programmer) or school, 665 | if any, to sign a "copyright disclaimer" for the program, if necessary. 666 | For more information on this, and how to apply and follow the GNU GPL, see 667 | . 668 | 669 | The GNU General Public License does not permit incorporating your program 670 | into proprietary programs. If your program is a subroutine library, you 671 | may consider it more useful to permit linking proprietary applications with 672 | the library. If this is what you want to do, use the GNU Lesser General 673 | Public License instead of this License. But first, please read 674 | . 675 | 676 | -------------------------------------------------------------------------------- /README.md: -------------------------------------------------------------------------------- 1 | ## assemblyStatistics 2 | [![Python package](https://github.com/WenchaoLin/assemblyStatistics/actions/workflows/python-package.yml/badge.svg)](https://github.com/WenchaoLin/assemblyStatistics/actions/workflows/python-package.yml) 3 | [![License: GPL v3](https://img.shields.io/badge/License-GPL%20v3-brightgreen.svg)](https://github.com/WenchaoLin/assemblyStatistics/blob/master/LICENSE) 4 | [![Made With Love](https://img.shields.io/badge/Made%20With-Love-orange.svg)](https://github.com/chetanraj/awesome-github-badges) 5 | 6 | A script to evaluate the assembly of a given genome. 7 | 8 | 9 | 💙 If you like this project, give it a ⭐ and share it with friends! 10 | 11 | 12 | It provides various statistics regarding a Fasta file containing multiple sequences, such as sequence name, N50, N90, GC Content, N rate, etc., both large scaffolds (>1000 bp) and contigs across all sequences. 13 | 14 | 一个用于评估给定基因组的拼接结果的脚本,用于查看拼接结果的Scaffold, Contig统计信息。它提供了有关包含多个序列的Fasta文件的各种统计信息,如序列名称、N50、N90、GC含量、N比率、序列数量等。 15 | 16 | 17 | 18 | ## ⚙ USAGE 19 | 20 | ``` 21 | assemblyStatistics -f test.fasta -l 100 22 | assemblyStatistics test.fasta 23 | ``` 24 | 25 | ## ⚡ Quick install 26 | 27 | ``` 28 | pip install assemblyStatistics 29 | ``` 30 | 31 | 32 | ## 🔧 Options 33 | 34 | run `assemblyStatistics -h` or `assemblyStatistics --help` for options 35 | 36 | ``` 37 | Usage: assemblyStatistics [options] -f INPUT.fasta 38 | 39 | A script to evaluate the assembly of a given fasta. 40 | 41 | Options: 42 | --version show program's version number and exit 43 | -h, --help show this help message and exit 44 | -f FILE, --fasta=FILE 45 | input fasta file 46 | -t FORMAT, --outfmt=FORMAT 47 | format of the output, choices = [txt, json] 48 | -l LENGTH, -L LENGTH, --length=LENGTH 49 | Threshold of length defined a sequence as Large 50 | [default = 1000] 51 | ``` 52 | 53 | 54 | ## Sample output 55 | 56 | Default txt output(human readable text format) 57 | 58 | ```txt 59 | 60 | All scaffold sequences summary: 61 | -------------------------------------------------- 62 | Counts of scaffold sequences 3 63 | Length of scaffold sequences 490 64 | Largest scaffold name seq1 65 | Largest scaffold length 210 66 | Scaffold N50 210 67 | Counts of N50 2 68 | Scaffold N90 70 69 | Counts of N90 3 70 | GC content(%) 42.86 71 | N Length 141 72 | N content (%) 28.78 73 | 74 | LARGE (> 100 bp) sequences summary: 75 | -------------------------------------------------- 76 | Counts of LARGE sequences 2 77 | Length of LARGE sequences 420 78 | LARGE scaffold N50 210 79 | Counts of LARGE N50 1 80 | LARGE scaffold N90 210 81 | Counts of LARGE N90 2 82 | GC content(%) 33.33 83 | N Length 141 84 | N content (%) 33.57 85 | 86 | contigs summary: 87 | -------------------------------------------------- 88 | Counts of contigs 7 89 | Maximum length of contigs 70 90 | contig N50 70 91 | Counts of contig N50 3 92 | contig N90 36 93 | Counts of contig N90 5 94 | ``` 95 | 96 | JSON format output with command `assemblyStatistics -f sample.fasta -t json` 97 | 98 | ```json 99 | { 100 | "All scaffolds": { 101 | "Counts of scaffold sequences": 4, 102 | "Length of scaffold sequences": 605, 103 | "Largest scaffold name": "seq2", 104 | "Largest scaffold length": 271, 105 | "Scaffold N50": 269, 106 | "Counts of N50": 2, 107 | "Scaffold N90": 45, 108 | "Counts of N90": 3, 109 | "GC content(%)": 49.09090909090909, 110 | "N Length": 59, 111 | "N content (%)": 9.75206611570248 112 | }, 113 | "LARGE sequences": { 114 | "threshold": 1000, 115 | "Counts of LARGE sequences": 0, 116 | "Length of LARGE sequences": 0 117 | }, 118 | "Contigs": { 119 | "Counts of contigs": 8, 120 | "Maximum length": 225, 121 | "contig N50": 121, 122 | "Counts of contig N50": 2, 123 | "contig N90": 21, 124 | "Counts of contig N90": 6 125 | } 126 | } 127 | ``` 128 | 129 | ## Feedback/Issues 130 | 131 | Please report any issues to the [issues page](https://github.com/WenchaoLin/assemblyStatistics/issues) or email linwenchao@yeah.net 132 | 133 | ## Todo 134 | 135 | - Get statistics from a list of files 136 | - Compressed format (.gz, .bz2 or .xz) support 137 | - Multiple output format support -------------------------------------------------------------------------------- /pyproject.toml: -------------------------------------------------------------------------------- 1 | [build-system] 2 | requires = ["setuptools>=61.0"] 3 | build-backend = "setuptools.build_meta" 4 | 5 | [project] 6 | name = "assemblyStatistics" 7 | version = "1.1.3" 8 | authors = [ 9 | { name="Wenchao Lin", email="linwenchao@yeah.net" }, 10 | ] 11 | description = "A script to evaluate the assembly of a given genome." 12 | readme = "README.md" 13 | license = {file = "LICENSE"} 14 | requires-python = ">=3.7" 15 | keywords = ["assembly", "scaffolds"] 16 | classifiers = [ 17 | "Programming Language :: Python :: 3", 18 | "License :: OSI Approved :: GNU General Public License v3 (GPLv3)", 19 | "Operating System :: OS Independent", 20 | "Programming Language :: Python", 21 | "Programming Language :: Python :: 3.6", 22 | "Programming Language :: Python :: 3.7", 23 | "Programming Language :: Python :: 3.8", 24 | ] 25 | 26 | [project.scripts] 27 | assemblyStatistics = "src.assemblyStatistics:main" 28 | 29 | [project.urls] 30 | "Homepage" = "https://github.com/WenchaoLin/assemblyStatistics" 31 | "Bug Tracker" = "https://github.com/WenchaoLin/assemblyStatistics/issues" -------------------------------------------------------------------------------- /setup.py: -------------------------------------------------------------------------------- 1 | from setuptools import setup, find_packages 2 | 3 | file_path = 'README.md' 4 | 5 | setup(name='assemblyStatistics', 6 | version='1.1.3', 7 | description='A script to evaluate the assembly of a given genome.', 8 | long_description=open(file_path, encoding='utf-8').read(), 9 | long_description_content_type='text/markdown', 10 | author='Wenchao Lin', 11 | include_package_data=True, 12 | author_email='linwenchao@yeah.net', 13 | url='https://github.com/WenchaoLin/assemblyStatistics', 14 | packages = find_packages(), 15 | keywords=['bioinformatics', 'genome statics', 'scaffold N50'], 16 | ) 17 | -------------------------------------------------------------------------------- /src/FastaUtils.py: -------------------------------------------------------------------------------- 1 | #!/usr/bin/python 2 | ################################################################################ 3 | # 4 | # Wenchaolin, 2015 @ Tianjin Biochip 5 | # 6 | # Module with a Class to represent a Fasta sequence, 7 | # and methods to load Fasta-formatted sequences from a file. 8 | # 9 | ################################################################################ 10 | from __future__ import print_function, division, absolute_import, with_statement 11 | 12 | 13 | def say(*args, indent=40, decimal=2): 14 | """format output in left aligned table""" 15 | out_fmt = '' 16 | for v in args: 17 | if isinstance(v, float): 18 | out_fmt += '{:<%s.%sf}' % (indent, decimal) 19 | else: 20 | out_fmt += '{:<%s}' % indent 21 | out_fmt = out_fmt.format(*args) 22 | print(out_fmt) 23 | return out_fmt 24 | 25 | 26 | def seq_gc_content(sequence): 27 | """return gc content""" 28 | gc_content = (sequence.upper().count('G') + sequence.upper().count('C')) \ 29 | / len(sequence) * 100 30 | return gc_content 31 | 32 | 33 | def seq_gc_skew(sequence): 34 | """return: gc skew in percent""" 35 | gc_content = seq_gc_content(sequence) 36 | if gc_content == 0: 37 | gc_skew = 0 38 | else: 39 | gc_skew = (sequence.upper().count('G') - sequence.upper().count('C')) \ 40 | / (sequence.count('G') + sequence.count('C')) * 100 41 | return gc_skew 42 | 43 | 44 | def Nx0(listOfNumbers, x=50): 45 | """ 46 | x is the Nx0 to be calculated, e.g. x = 50 for N50 47 | return Nx0 of an given list of numbers 48 | """ 49 | listOfNumbers.sort(reverse=1) # sort the list in descending order 50 | theorNx0 = sum(listOfNumbers) * x / 100 # calculate the theoretical Nx0 51 | 52 | tot = 0 53 | Nx0 = 0 54 | CNx0 = 0 55 | 56 | for num in listOfNumbers: 57 | tot += num 58 | CNx0 += 1 59 | if tot >= theorNx0: # if the total is greater than or equal to the theoretical Nx0 60 | Nx0 = num 61 | break 62 | return (Nx0, CNx0) 63 | 64 | 65 | def SimpleFastaParser(handle): 66 | """Iterate over Fasta records as string tuples. 67 | Arguments: 68 | - handle - input stream opened in text mode 69 | For each record a tuple of two strings is returned, the FASTA title 70 | line (without the leading '>' character), and the sequence (with any 71 | whitespace removed). The title line is not divided up into an 72 | identifier (the first word) and comment or description. 73 | >>> with open("Fasta/dups.fasta") as handle: 74 | ... for values in SimpleFastaParser(handle): 75 | ... print(values) 76 | ... 77 | ('alpha', 'ACGTA') 78 | ('beta', 'CGTC') 79 | ('gamma', 'CCGCC') 80 | ('alpha (again - this is a duplicate entry to test the indexing code)', 'ACGTA') 81 | ('delta', 'CGCGC') 82 | """ 83 | # Skip any text before the first record (e.g. blank lines, comments) 84 | for line in handle: 85 | if line[0] == ">": 86 | title = line[1:].rstrip() 87 | break 88 | else: 89 | # no break encountered - probably an empty file 90 | return 91 | 92 | lines = [] 93 | for line in handle: 94 | if line[0] == ">": 95 | yield title, "".join(lines).replace(" ", "").replace("\r", "") 96 | lines = [] 97 | title = line[1:].rstrip() 98 | continue 99 | lines.append(line.rstrip()) 100 | 101 | yield title, "".join(lines).replace(" ", "").replace("\r", "") 102 | 103 | 104 | class FastaIO: 105 | """Base class for building SeqRecord iterators. 106 | You should write a parse method that returns a SeqRecord generator. You 107 | may wish to redefine the __init__ method as well. 108 | """ 109 | 110 | def __init__(self, source): 111 | """Create a SequenceIterator object. 112 | Arguments: 113 | - source - input file stream, or path to input file 114 | """ 115 | 116 | try: 117 | self.stream = open(source, "r") 118 | self.should_close_stream = True 119 | except Exception: 120 | "Open file error." 121 | 122 | try: 123 | self.records = self.parse(self.stream) 124 | except Exception: 125 | if self.should_close_stream: 126 | self.stream.close() 127 | raise 128 | 129 | def __next__(self): 130 | """Return the next entry.""" 131 | try: 132 | return next(self.records) 133 | except Exception: 134 | if self.should_close_stream: 135 | self.stream.close() 136 | raise 137 | 138 | def __iter__(self): 139 | """Iterate over the entries as a SeqRecord objects. 140 | Example usage for Fasta files:: 141 | with open("example.fasta","r") as myFile: 142 | myFastaReader = FastaIterator(myFile) 143 | for record in myFastaReader: 144 | print(record.id) 145 | print(record.seq) 146 | This method SHOULD NOT be overridden by any subclass. It should be 147 | left as is, which will call the subclass implementation of __next__ 148 | to actually parse the file. 149 | """ 150 | return self 151 | 152 | def __len__(self): 153 | """ Return the length of the sequence""" 154 | length = sum(1 for _ in self.records) 155 | return length 156 | 157 | def parse(self, handle): 158 | """Start parsing the file, and return a SeqRecord generator.""" 159 | records = self.iterate(handle) 160 | return records 161 | 162 | def iterate(self, handle): 163 | """Parse the file and generate SeqRecord objects.""" 164 | 165 | for title, sequence in SimpleFastaParser(handle): 166 | try: 167 | first_word = title.split(None, 1)[0] 168 | except IndexError: 169 | assert not title, repr(title) 170 | first_word = "" 171 | yield SeqRecord(sequence, id=first_word, name=first_word, description=title) 172 | 173 | 174 | class SeqRecord: 175 | """A SeqRecord object holds a sequence and information about it. 176 | Main attributes: 177 | - id - Identifier such as a locus tag (string) 178 | - seq - The sequence itself (Seq object or similar) 179 | 180 | Additional attributes: 181 | - description - Additional text (string) 182 | """ 183 | 184 | def __init__(self, sequence, id=None, name=None, description=None): 185 | 186 | """Create a SeqRecord. 187 | Arguments: 188 | - sequence - Sequence, required 189 | - id - Sequence id, (first word after >) 190 | - name - Sequence name, (first word after >) 191 | - description - Sequence description 192 | """ 193 | 194 | self.id = id 195 | self.name = name 196 | self.seq = sequence 197 | self.description = description 198 | 199 | @property 200 | def length(self): 201 | """return length.""" 202 | return len(self.seq) 203 | 204 | @property 205 | def gcCount(self): 206 | """return: The GC count of the string""" 207 | 208 | return self.seq.count('C') + self.seq.count('c')+self.seq.count('G')+self.seq.count('g') 209 | 210 | def __len__(self): 211 | """ Return the length of the sequence""" 212 | return self.length 213 | 214 | def __str__(self): 215 | """Output FASTA format of sequence when 'print' method is called""" 216 | s = [] 217 | for i in range(0, len(self), 80): 218 | s.append(self.seq[i:i+80]) 219 | 220 | return ">%s\n%s" % (self.description, "\n".join(s)) 221 | 222 | def rev_comp(self): 223 | """return: The reverse complement of the string""" 224 | complement = {'A': 'T', 'C': 'G', 'G': 'C', 'T': 'A', 'N': 'N'} 225 | return ''.join([complement[base.upper()] for base in self.seq[::-1]]) 226 | 227 | 228 | if __name__ == '__main__': 229 | say('a','b',1, 1.0, indent=5, decimal=2) 230 | -------------------------------------------------------------------------------- /src/__init__.py: -------------------------------------------------------------------------------- 1 | __author__ = "Wenchao Lin" 2 | __copyright__ = "Copyright 2023 @ TBC" 3 | __license__ = "GPL" 4 | __version__ = "1.1.3" 5 | __email__ = "linwenchao@yeah.net" 6 | -------------------------------------------------------------------------------- /src/assemblyStatistics.py: -------------------------------------------------------------------------------- 1 | #!/usr/bin/env python 2 | 3 | import sys 4 | import re 5 | import json 6 | from optparse import OptionParser 7 | from src.FastaUtils import FastaIO, Nx0, say 8 | from src import __version__ 9 | 10 | 11 | def run(options): 12 | """Main method for collecting all Fasta stats""" 13 | 14 | threshold = options.length 15 | outfmt = options.format 16 | 17 | largestScaffoldName = None 18 | largestScaffoldLength = 0 19 | all_seq_list = [] 20 | large_seq_list = [] 21 | contig_seq_list = [] 22 | 23 | n_cnt, gc_cnt, lg_n_cnt, lg_gc_cnt = 0, 0, 0, 0 24 | 25 | seqObj = FastaIO(options.fasta) 26 | for seq in seqObj: 27 | name = seq.id 28 | length = seq.length 29 | sequence = seq.seq 30 | all_seq_list.append(length) 31 | contig_seq_list += map(len, re.split('[nN]+', sequence)) 32 | n_cnt += sequence.upper().count('N') 33 | gc_cnt += seq.gcCount 34 | 35 | if length > largestScaffoldLength: 36 | largestScaffoldName = name 37 | largestScaffoldLength = length 38 | 39 | if length > threshold: 40 | large_seq_list.append(length) 41 | lg_gc_cnt += seq.gcCount 42 | lg_n_cnt += sequence.upper().count('N') 43 | res_dic = {} 44 | res_dic['All scaffolds'] = {} 45 | res_dic['LARGE sequences'] = {} 46 | res_dic['Contigs'] = {} 47 | res_dic['LARGE sequences']['threshold'] = threshold 48 | res_dic['All scaffolds']['Counts of scaffold sequences'] = len(all_seq_list) 49 | res_dic['All scaffolds']['Length of scaffold sequences'] = sum(all_seq_list) 50 | res_dic['All scaffolds']['Largest scaffold name'] = largestScaffoldName 51 | res_dic['All scaffolds']['Largest scaffold length'] = largestScaffoldLength 52 | res_dic['All scaffolds']['Scaffold N50'] = Nx0(all_seq_list, 50)[0] 53 | res_dic['All scaffolds']['Counts of N50'] = Nx0(all_seq_list, 50)[1] 54 | res_dic['All scaffolds']['Scaffold N90'] = Nx0(all_seq_list, 90)[0] 55 | res_dic['All scaffolds']['Counts of N90'] = Nx0(all_seq_list, 90)[1] 56 | res_dic['All scaffolds']['GC content(%)'] = gc_cnt / sum(all_seq_list) * 100.0 57 | res_dic['All scaffolds']['N Length'] = n_cnt 58 | res_dic['All scaffolds']['N content (%)'] = n_cnt / sum(all_seq_list) * 100.0 59 | if large_seq_list: 60 | res_dic['LARGE sequences']['Counts of LARGE sequences'] = len(large_seq_list) 61 | res_dic['LARGE sequences']['Length of LARGE sequences'] = sum(large_seq_list) 62 | res_dic['LARGE sequences']['LARGE N50'] = Nx0(large_seq_list, 50)[0] 63 | res_dic['LARGE sequences']['Counts of N50'] = Nx0(large_seq_list, 50)[1] 64 | res_dic['LARGE sequences']['LARGE N90'] = Nx0(large_seq_list, 90)[0] 65 | res_dic['LARGE sequences']['Counts of LARGE N90'] = Nx0(large_seq_list, 90)[1] 66 | res_dic['LARGE sequences']['GC content(%)'] = lg_gc_cnt / sum(large_seq_list) * 100.0 67 | res_dic['LARGE sequences']['N Length'] = lg_n_cnt 68 | res_dic['LARGE sequences']['N content (%)'] = lg_n_cnt / sum(large_seq_list) * 100.0 69 | else: 70 | res_dic['LARGE sequences']['Counts of LARGE sequences'] = 0 71 | res_dic['LARGE sequences']['Length of LARGE sequences'] = 0 72 | res_dic['Contigs']['Counts of contigs'] = len(contig_seq_list) 73 | res_dic['Contigs']['Maximum length'] = max(contig_seq_list) 74 | res_dic['Contigs']['contig N50'] = Nx0(contig_seq_list, 50)[0] 75 | res_dic['Contigs']['Counts of contig N50'] = Nx0(contig_seq_list, 50)[1] 76 | res_dic['Contigs']['contig N90'] = Nx0(contig_seq_list, 90)[0] 77 | res_dic['Contigs']['Counts of contig N90'] = Nx0(contig_seq_list, 90)[1] 78 | 79 | if outfmt.upper() == 'JSON': 80 | print(json.dumps(res_dic, indent=4)) 81 | 82 | else: 83 | print('\nAll scaffold sequences summary:') 84 | print('-' * 50) 85 | say('Counts of scaffold sequences', len(all_seq_list)) 86 | say('Length of scaffold sequences', sum(all_seq_list)) 87 | say('Largest scaffold name', largestScaffoldName) 88 | say('Largest scaffold length', largestScaffoldLength) 89 | say('Scaffold N50 ', Nx0(all_seq_list, 50)[0]) 90 | say('Counts of N50', Nx0(all_seq_list, 50)[1]) 91 | say('Scaffold N90', Nx0(all_seq_list, 90)[0]) 92 | say('Counts of N90', Nx0(all_seq_list, 90)[1]) 93 | say('GC content(%)', gc_cnt / sum(all_seq_list) * 100.0) 94 | say('N Length', n_cnt) 95 | say('N content (%)', n_cnt / sum(all_seq_list) * 100.0) 96 | print('\nLARGE (> %s bp) sequences summary:' % threshold) 97 | print('-' * 50) 98 | if large_seq_list: 99 | say('Counts of LARGE sequences', len(large_seq_list)) 100 | say('Length of LARGE sequences', sum(large_seq_list)) 101 | say('LARGE scaffold N50', Nx0(large_seq_list, 50)[0]) 102 | say('Counts of LARGE N50', Nx0(large_seq_list, 50)[1]) 103 | say('LARGE scaffold N90', Nx0(large_seq_list, 90)[0]) 104 | say('Counts of LARGE N90', Nx0(large_seq_list, 90)[1]) 105 | say('GC content(%)', lg_gc_cnt / sum(large_seq_list) * 100.0) 106 | say('N Length', lg_n_cnt) 107 | say('N content (%)', lg_n_cnt / sum(large_seq_list) * 100.0) 108 | else: 109 | say('Counts of LARGE sequences', 0) 110 | say('Length of LARGE sequences', 0) 111 | print('\ncontigs summary:') 112 | print('-'*50) 113 | say('Counts of contigs', len(contig_seq_list)) 114 | say('Maximum length of contigs', max(contig_seq_list)) 115 | say('contig N50', Nx0(contig_seq_list, 50)[0]) 116 | say('Counts of contig N50', Nx0(contig_seq_list, 50)[1]) 117 | say('contig N90', Nx0(contig_seq_list, 90)[0]) 118 | say('Counts of contig N90', Nx0(contig_seq_list, 90)[1]) 119 | 120 | def main(): 121 | 122 | """ parse options """ 123 | usage = 'usage: %prog [options] -f INPUT.fasta' 124 | parser = OptionParser(prog='assemblyStatistics', 125 | description='A script to evaluate the assembly of a given fasta.', 126 | usage=usage, 127 | version=__version__, 128 | ) 129 | parser.add_option('-f', '--fasta', 130 | dest='fasta', metavar='FILE', 131 | help='input fasta file' 132 | ) 133 | parser.add_option('-t', '--outfmt', 134 | dest="format", 135 | type='choice', 136 | choices=['txt','json'], 137 | default='txt', 138 | help='format of the output, choices = [txt, json]' 139 | ) 140 | parser.add_option('-l', '-L', '--length', 141 | dest='length', default=1000, type=int, 142 | help='Threshold of length defined a sequence as Large [default = 1000]' 143 | ) 144 | 145 | (options, args) = parser.parse_args() 146 | if not options.fasta: 147 | try: 148 | options.fasta = args[0] 149 | except IndexError: 150 | parser.print_help() 151 | sys.exit() 152 | 153 | run(options) 154 | 155 | 156 | if __name__ == "__main__": 157 | 158 | main() 159 | -------------------------------------------------------------------------------- /tests/__init__.py: -------------------------------------------------------------------------------- https://raw.githubusercontent.com/WenchaoLin/assemblyStatistics/3417a5da83c23e7dc89585d925dfd6670c412bb3/tests/__init__.py -------------------------------------------------------------------------------- /tests/sample.fasta: -------------------------------------------------------------------------------- 1 | >seq1 2 | GGGGGGGGGGCCCCCCCCCC 3 | >seq2 4 | TGAGTGAGACTACCCGGGTATCTAnnnnnnnnnnnnnnnnNNNNNNTCCCATTCGCTCCCCTA 5 | GCTTTCGTCCCTCAGTGTCAGTTTTGGCCTAGCAGAGCGCCTTCGCCA 6 | CCGGTGTTCTTCCTGATATCTACGCATTTCACCGCTACACCAGGAATTCCCTCT 7 | GCCCCGACCATACCCTAGCTTTGTAGTTTCCACTGCTTTGATCTGGTTGAGCCAGACTCTTTAACAG 8 | CAGACAAACAATGCCACCTGCGGACCCTTTACGCCCAAT 9 | >seq3 10 | TGAGTGAGACTACCCGGGTATCTAATCCCNNNNNNNNNNNNNNNNNNNNATTCGCTCCCCTA 11 | GCTTTCGTCCCTCAGTGTCAGTTTTGGCCTAGCAGAGCGCCTTCGCCA 12 | CCGGTGTTCTTCCTGATATCTACGnnnnnnnnNNNNNNCCAGGAATTCCCTCT 13 | GCCCCGACCATACCCTAGCTTTGTAGTTTCCACTGCTTTGATCTGGTTGAGCCAGACTCTTTAACAG 14 | CAGACAAACAATGCCACCTGCGGACCCTTTACGCCCAAT 15 | >seq4 16 | TGAGTGAGACTACCCGGGTATNNNCTAATCCCATTCGCTCCCCTA -------------------------------------------------------------------------------- /tests/test_module.py: -------------------------------------------------------------------------------- 1 | import unittest 2 | from src.FastaUtils import Nx0, FastaIO, say 3 | # First party modules # 4 | import os 5 | 6 | this_dir = os.path.dirname(__file__) 7 | 8 | 9 | class MyTestCase(unittest.TestCase): 10 | 11 | def test_Nx0(self): 12 | data = [10, 20, 30, 40, 50] 13 | self.assertEqual(Nx0(data, 50), (40, 2)) 14 | 15 | def test_FastaIO(self): 16 | seqs = FastaIO(os.path.join(this_dir, 'sample.fasta')) 17 | self.assertEqual(len(seqs), 4) 18 | 19 | def test_say(self): 20 | strings = say('a','b',1, 1.0, indent=5, decimal=2) 21 | self.assertIn(strings.strip(), 'a b 1 1.00') 22 | 23 | 24 | if __name__ == '__main__': 25 | unittest.main() 26 | --------------------------------------------------------------------------------