├── models ├── diversity_new.p ├── diversity_other_cells.p ├── edit_eff_other_cells_chrom.p ├── entropy_other_cells_chrom.p ├── exp_ins_length_other_cells.p ├── exp_deletion_length_other_cells.p ├── fraction_insertions_other_cells.p ├── Insertion_A_liklihood_other_cells.p ├── Insertion_C_liklihood_other_cells.p ├── Insertion_G_liklihood_other_cells.p ├── Insertion_T_liklihood_other_cells.p ├── entropy_classification_other_cells.p ├── exp_ins_length_other_cells_chrom.p ├── fraction_total_deletions_other_cells.p ├── exp_deletion_length_other_cells_chrom.p ├── fraction_total_insertions_other_cells.p ├── exp_deletion_length_classification_other_cells.p ├── exp_insertion_length_classification_other_cells.p ├── single_insertion_type_2class-classification_other_cells.p ├── single_insertion_type_4class-classification_other_cells.p ├── linear_model_nucleotide_coef.p ├── edit_eff_tcells_chrom.p └── diversity_regression.p ├── SPROUT_predict_batch.py ├── README.md ├── SPROUT_predict.py └── LICENSE /models/diversity_new.p: -------------------------------------------------------------------------------- https://raw.githubusercontent.com/amirmohan/SPROUT/HEAD/models/diversity_new.p -------------------------------------------------------------------------------- /models/diversity_other_cells.p: -------------------------------------------------------------------------------- https://raw.githubusercontent.com/amirmohan/SPROUT/HEAD/models/diversity_other_cells.p -------------------------------------------------------------------------------- /models/edit_eff_other_cells_chrom.p: -------------------------------------------------------------------------------- https://raw.githubusercontent.com/amirmohan/SPROUT/HEAD/models/edit_eff_other_cells_chrom.p -------------------------------------------------------------------------------- /models/entropy_other_cells_chrom.p: -------------------------------------------------------------------------------- https://raw.githubusercontent.com/amirmohan/SPROUT/HEAD/models/entropy_other_cells_chrom.p -------------------------------------------------------------------------------- /models/exp_ins_length_other_cells.p: -------------------------------------------------------------------------------- https://raw.githubusercontent.com/amirmohan/SPROUT/HEAD/models/exp_ins_length_other_cells.p -------------------------------------------------------------------------------- /models/exp_deletion_length_other_cells.p: -------------------------------------------------------------------------------- https://raw.githubusercontent.com/amirmohan/SPROUT/HEAD/models/exp_deletion_length_other_cells.p -------------------------------------------------------------------------------- /models/fraction_insertions_other_cells.p: -------------------------------------------------------------------------------- https://raw.githubusercontent.com/amirmohan/SPROUT/HEAD/models/fraction_insertions_other_cells.p -------------------------------------------------------------------------------- /models/Insertion_A_liklihood_other_cells.p: -------------------------------------------------------------------------------- https://raw.githubusercontent.com/amirmohan/SPROUT/HEAD/models/Insertion_A_liklihood_other_cells.p -------------------------------------------------------------------------------- /models/Insertion_C_liklihood_other_cells.p: -------------------------------------------------------------------------------- https://raw.githubusercontent.com/amirmohan/SPROUT/HEAD/models/Insertion_C_liklihood_other_cells.p -------------------------------------------------------------------------------- /models/Insertion_G_liklihood_other_cells.p: -------------------------------------------------------------------------------- https://raw.githubusercontent.com/amirmohan/SPROUT/HEAD/models/Insertion_G_liklihood_other_cells.p -------------------------------------------------------------------------------- /models/Insertion_T_liklihood_other_cells.p: -------------------------------------------------------------------------------- https://raw.githubusercontent.com/amirmohan/SPROUT/HEAD/models/Insertion_T_liklihood_other_cells.p -------------------------------------------------------------------------------- /models/entropy_classification_other_cells.p: -------------------------------------------------------------------------------- https://raw.githubusercontent.com/amirmohan/SPROUT/HEAD/models/entropy_classification_other_cells.p -------------------------------------------------------------------------------- /models/exp_ins_length_other_cells_chrom.p: -------------------------------------------------------------------------------- https://raw.githubusercontent.com/amirmohan/SPROUT/HEAD/models/exp_ins_length_other_cells_chrom.p -------------------------------------------------------------------------------- /models/fraction_total_deletions_other_cells.p: -------------------------------------------------------------------------------- https://raw.githubusercontent.com/amirmohan/SPROUT/HEAD/models/fraction_total_deletions_other_cells.p -------------------------------------------------------------------------------- /models/exp_deletion_length_other_cells_chrom.p: -------------------------------------------------------------------------------- https://raw.githubusercontent.com/amirmohan/SPROUT/HEAD/models/exp_deletion_length_other_cells_chrom.p -------------------------------------------------------------------------------- /models/fraction_total_insertions_other_cells.p: -------------------------------------------------------------------------------- https://raw.githubusercontent.com/amirmohan/SPROUT/HEAD/models/fraction_total_insertions_other_cells.p -------------------------------------------------------------------------------- /models/exp_deletion_length_classification_other_cells.p: -------------------------------------------------------------------------------- https://raw.githubusercontent.com/amirmohan/SPROUT/HEAD/models/exp_deletion_length_classification_other_cells.p -------------------------------------------------------------------------------- /models/exp_insertion_length_classification_other_cells.p: -------------------------------------------------------------------------------- https://raw.githubusercontent.com/amirmohan/SPROUT/HEAD/models/exp_insertion_length_classification_other_cells.p -------------------------------------------------------------------------------- /models/single_insertion_type_2class-classification_other_cells.p: -------------------------------------------------------------------------------- https://raw.githubusercontent.com/amirmohan/SPROUT/HEAD/models/single_insertion_type_2class-classification_other_cells.p -------------------------------------------------------------------------------- /models/single_insertion_type_4class-classification_other_cells.p: -------------------------------------------------------------------------------- https://raw.githubusercontent.com/amirmohan/SPROUT/HEAD/models/single_insertion_type_4class-classification_other_cells.p -------------------------------------------------------------------------------- /models/linear_model_nucleotide_coef.p: -------------------------------------------------------------------------------- 1 | cnumpy.core.multiarray 2 | _reconstruct 3 | p0 4 | (cnumpy 5 | ndarray 6 | p1 7 | (I0 8 | tp2 9 | S'b' 10 | p3 11 | tp4 12 | Rp5 13 | (I1 14 | (I92 15 | tp6 16 | cnumpy 17 | dtype 18 | p7 19 | (S'f8' 20 | p8 21 | I0 22 | I1 23 | tp9 24 | Rp10 25 | (I3 26 | S'<' 27 | p11 28 | NNNI-1 29 | I-1 30 | I0 31 | tp12 32 | bI00 33 | S'\x1a\xe9\'\xd6bP\x87\xbf\x8e\xe7\xaa+f\x9a\x84?\x9a\xde\xcd\xac)\x8a\x80\xbf\x80\xe1JW&@\x83?\xda\xd4\xecOH/r\xbf\xe8,\x8f~\xd7sc?\x12\x9d\x12\x07\x8a\x0f\x87\xbf"3eO8J\x8b?\xb8\x11\xaa\xa2\x15\xb8\x82?\xa6\x85qN\xe8F\x8d\xbf\x11\xe2+\xd6\xaecQ?\x9f\xf5\x03\xa2\xb9\xc4p?Z?\xaa~\x96\xcc9?\xb1\xd6\x84\xa9;\xc1\x82?8\x0b97\xcb9\x93\xbf1\xeb\xf7\x10\xf6\xe3\x82?1\xb0\x8d\x04\xd9\x88d?\xf7\xc4\x8ak\x92\xa9v\xbf\x06%\xcd\xbe\x9d\x9fz\xbf\xfa\x8b\x08\xd4a\x82\x83?\x819\x1fI\xd8\xc5\x90?g\xac\x81\x87\xb4\xad\x88\xbf\xd6\x05\xdd\'\t\xf2l\xbf)pX\x0c\x9c\x17J\xbf\x187\xe3\x0c\n;\x86\xbfa6c\xc5e$r\xbf\xc8\xcb\x98\xc6\xedRp?+lH\x0c\xc6#\x87?\xc8w\xaa\x181\xe2<\xbf\xb4)\xc9\xd0\x950\x89?\x88\t\x1c\xe5Y\x0e\x88\xbf\xa4\x84\xe4s1\x95\x1d\xbf{^\xcb\x84\xf1\xd1#\xbfB\xde=\xea\xdeXt?\xbfv\xf6C\x91C\x8e\xbf\x18\xbc\xea\x94if\x84?\xc1\xae\x96\x89\xc3\xa8\x81?\xdei!\xb5\x17\x02S\xbf}\xcd\x1aX(\xf8\x89\xbf\x0b\x91P\x8aO_u?\x93\xfcv\x1aJ\xf9w?8O\xee~\x93\x19~?\xc1\xdb\x1f\x89\xf7\xe6\\\xbf\x02\xa7\x8e\xdb\x8fl\x87\xbfo@Ch\x16\xfdm\xbf:n\xc0\xcd\xe0\xd35?I\xebU\xe7\x8b\xb2v?D\xab \x80}"b\xbf\xea\x1c[Lz\xdc\x90\xbf\xbe\xb8\xba\xabC\x02\x8b\xbf\x1a\xa6u\xa3b\xb7\xa0?Y\xcd\x96%I\x89h\xbf\xc3\xbf\x10\xe9\x94Q\xa1\xbf9#&G\xf8\xc1\x91?\x14B\xc4\x1b\xfe}P\xbfK\x9c\xb7l\x11\xe9\x91?\x00\x83\xefhT-\x9f\xbf\x1c\x97;Z\x8b\x8e\x85\xbf5T\x1e\xc2\tD\x9e?\x12\x03\xde\xa7 a\x87?1m\x02=J\xfdT\xbf\xbdM\x1b\x04\xc0\x8f\xab?\xca\xd0m\xd2)\x18{?\x08\xf3\x80\xec\xdaJ\xae\xbfr/\xff8\xa7I\xa2?\xfelzfWn\xaa\xbfp\xd3\nN\x8e5\xb4\xbf\\o\xc8d\xe6G\xb8?/6\xb0B\x8c\x87\x87?\xdb\xc2\xf6\x118C\xab\xbf\xa2vh\xd5bj\xb1?\xa6d\x0cS\xe1\xe6\x9a\xbf6\xc4\xe0\xe4\x98$\x97?\xb4\x04T\x99\xb2\x94\x93?\xc8\xb8F\xa4\x86D\xa0\xbf%\xbcNk|`\x84\xbf3P\xd1\xe7X\xed\xaa?\xebk\x98\x81$\x08\xab\xbfgq\xb64\xd6\xe5\xad?\xdaX\xef\x9a\n\xcb\xad\xbf\xce\x8cS\x05\x89\xebg\xbf\xb2\xf4\x81C\xb9t\x80?4h\xdby\xeaJ\x84?\xe8y\x08|\xc1\xc4\x8e\xbf\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00' 34 | p13 35 | tp14 36 | b. -------------------------------------------------------------------------------- /models/edit_eff_tcells_chrom.p: -------------------------------------------------------------------------------- 1 | ccopy_reg 2 | _reconstructor 3 | p0 4 | (csklearn.linear_model.base 5 | LinearRegression 6 | p1 7 | c__builtin__ 8 | object 9 | p2 10 | Ntp3 11 | Rp4 12 | (dp5 13 | S'normalize' 14 | p6 15 | I00 16 | sS'n_jobs' 17 | p7 18 | I1 19 | sS'rank_' 20 | p8 21 | I77 22 | sS'fit_intercept' 23 | p9 24 | I01 25 | sS'_residues' 26 | p10 27 | cnumpy.core.multiarray 28 | _reconstruct 29 | p11 30 | (cnumpy 31 | ndarray 32 | p12 33 | (I0 34 | tp13 35 | S'b' 36 | p14 37 | tp15 38 | Rp16 39 | (I1 40 | (I0 41 | tp17 42 | cnumpy 43 | dtype 44 | p18 45 | (S'f8' 46 | p19 47 | I0 48 | I1 49 | tp20 50 | Rp21 51 | (I3 52 | S'<' 53 | p22 54 | NNNI-1 55 | I-1 56 | I0 57 | tp23 58 | bI00 59 | S'' 60 | p24 61 | tp25 62 | bsS'coef_' 63 | p26 64 | g11 65 | (g12 66 | (I0 67 | tp27 68 | g14 69 | tp28 70 | Rp29 71 | (I1 72 | (I96 73 | tp30 74 | g21 75 | I00 76 | S'&\xb50\xde\xff\xc9k\xc2~\xb40\xde\xff\xc9k\xc2\r\xb50\xde\xff\xc9k\xc2J\xb40\xde\xff\xc9k\xc2ZR\x87\nK\x05Y\xc2\xa4Q\x87\nK\x05Y\xc2\xceR\x87\nK\x05Y\xc20Q\x87\nK\x05Y\xc2\xeb\xd7\xf3lvX\x81B\xd0\xd7\xf3lvX\x81B\xe8\xd7\xf3lvX\x81B\xf3\xd7\xf3lvX\x81B\x945?\xdb\xc1\xe9\x84B\xae5?\xdb\xc1\xe9\x84B\x885?\xdb\xc1\xe9\x84B\xc05?\xdb\xc1\xe9\x84B\xe0!\xd1\r6\x8c\x10B\x80\x19\xd1\r6\x8c\x10B \x10\xd1\r6\x8c\x10B\xa0 \xd1\r6\x8c\x10Br*aD\xd8\x0cu\xc2\x06+aD\xd8\x0cu\xc2\xc4*aD\xd8\x0cu\xc2\xcd*aD\xd8\x0cu\xc2\x0e\xc5\xffJ\xc9\x91zB\x16\xc5\xffJ\xc9\x91zB<\xc5\xffJ\xc9\x91zBh\xc5\xffJ\xc9\x91zB3\xfe\xa2\x98*\x08QB:\xff\xa2\x98*\x08QB\xe7\xfd\xa2\x98*\x08QBa\xfe\xa2\x98*\x08QBf\xe1\x1eO\'\x18{\xc24\xe1\x1eO\'\x18{\xc2\x7f\xe1\x1eO\'\x18{\xc2\x18\xe1\x1eO\'\x18{\xc2\xae\xc8j&5\x16~BK\xc8j&5\x16~B6\xc8j&5\x16~B\x9c\xc8j&5\x16~B\xe8S\x95oH\xf4ABPS\x95oH\xf4AB\x98R\x95oH\xf4AB\x00P\x95oH\xf4AB\xc1So\xee\xbc\xad\x97B\xc3So\xee\xbc\xad\x97B\xd8So\xee\xbc\xad\x97B\xd3So\xee\xbc\xad\x97B\x14(\x8ba\t\x1czB\x0c(\x8ba\t\x1czB\xe4(\x8ba\t\x1czB_(\x8ba\t\x1czB\x17\xc3"c\xc0>{\xc21\xc2"c\xc0>{\xc2\x87\xc2"c\xc0>{\xc28\xc2"c\xc0>{\xc20\xe7\x14\xb4nNvB\xaa\xe7\x14\xb4nNvB2\xe8\x14\xb4nNvB\x07\xe8\x14\xb4nNvB\xd0\xa28\xbc\x9e.i\xc2d\xa08\xbc\x9e.i\xc2Q\x9f8\xbc\x9e.i\xc2X\xa38\xbc\x9e.i\xc2:O\xe6\x81F\x00|B\xfeM\xe6\x81F\x00|B#O\xe6\x81F\x00|B\xf4P\xe6\x81F\x00|B\x023\xa5\xff\xa5\xcb\x8eB\x9a2\xa5\xff\xa5\xcb\x8eB\xb03\xa5\xff\xa5\xcb\x8eB\xd42\xa5\xff\xa5\xcb\x8eB\x88\xce\xa3\xf3Z\xf8l\xc2\x9c\xce\xa3\xf3Z\xf8l\xc2~\xd0\xa3\xf3Z\xf8l\xc2\xdf\xcf\xa3\xf3Z\xf8l\xc2d\x113(\xbcV\x81B}\x103(\xbcV\x81Bk\x113(\xbcV\x81B\x81\x103(\xbcV\x81B\x97\xf5\xc8\np\x16\x83\xc2v\xf5\xc8\np\x16\x83\xc2y\xf5\xc8\np\x16\x83\xc2\xc0\xf5\xc8\np\x16\x83\xc2\xc5\xc7(pD\xfd+?\xc9\\N\x93\xdd0\xf1>\n5\t\xf1q\xd0\xe2>\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x04%Fcz\x0b\x85?\xc8n\xfb\x80\xea|v\xbf\xca\x97\xac\x94\xe5\xa3\xb3\xbf\x92\xd6S:\x12\x85\x9d\xbf' 77 | p31 78 | tp32 79 | bsS'_sklearn_version' 80 | p33 81 | S'0.19.1' 82 | p34 83 | sS'copy_X' 84 | p35 85 | I01 86 | sS'intercept_' 87 | p36 88 | cnumpy.core.multiarray 89 | scalar 90 | p37 91 | (g21 92 | S"$M'Sg\xd1\xae\xc2" 93 | p38 94 | tp39 95 | Rp40 96 | sS'singular_' 97 | p41 98 | g11 99 | (g12 100 | (I0 101 | tp42 102 | g14 103 | tp43 104 | Rp44 105 | (I1 106 | (I96 107 | tp45 108 | g21 109 | I00 110 | S'\xf8 j\x08\x97\xc3D@\xe5a\xff\xce\xe8\xe8@@B<\x96\xb6\xe1}<@\x0b\xcd\xacy=L9@\xd9s\xc9k\xb2\xf48@q\rl\x81\'07@v\xc7$!NG6@\xc1\xd8\xa3?\xf8\xbc5@W\x01k\x9d~\x9e5@q*\xa8FVn5@\xe5\xd0\xfb\x88l\x035@\xc3\xe0)x\xe4\xb04@\x99\xe5\x14\x11\x0f\x144@\x7f\xa9\x153\xd8\xe83@\xae&~v|\xda3@G\x85\xb9\x17R\x933@\xfa!\x0c\xe6\x8er3@\xc8\x84\x18\xca\'63@\xf5\x8d\n=\xd4\x0f3@4\xe0\xe2y\xf6\xc02@\xe8\xb9QR\xcd\xa12@=`\xcc=\x9d\x902@\xc2q\x85\xc4\x14g2@\x14\xdc\x14\x84^\x002@)w\xb3\x95G\xca1@\x83\x8a\xc5\x9fT\xad1@LS\xdbS\xde\x8c1@5\xad\xa2\x05\xb6u1@\x89\x07\x0cb\xc0d1@\xdd\xdap\x9c\x9e41@H\x9e$\x9b\x92\x071@\xaa\x81MGA\x8e0@u\xfbe\x97!\x7f0@\xc4\xa1\xa0^*B0@\xfe\xf0q^\xa9.0@\xfb\x8c\xafj\x82\x130@\xff\xa1\x91)0\x020@\xba\xdc\xbd\xb84g/@=\xda\xec\x08\xbe0/@\x9c\xc7L\xf7~B\xb2\xf9\x11>L\xf7~B\xe8\xf9\x11>L\xf7~B\xae\xf9\x11>L\xf7~B\xbd:\x14:\xb0SxBq:\x14:\xb0SxB\xb0:\x14:\xb0SxBS:\x14:\xb0SxB\xbf\xda\xf1\x89%\x93pB\x0c\xdb\xf1\x89%\x93pB\xdb\xda\xf1\x89%\x93pB\xd0\xda\xf1\x89%\x93pB\x9c\x1a\xd9\xdf\xaf\x18t\xc2\x9d\x1a\xd9\xdf\xaf\x18t\xc29\x1a\xd9\xdf\xaf\x18t\xc2\xf1\x1a\xd9\xdf\xaf\x18t\xc2\xba\xfdV\xb4\xb6Q\x8f\xc2\xcd\xfdV\xb4\xb6Q\x8f\xc2\x9e\xfdV\xb4\xb6Q\x8f\xc2\xd4\xfdV\xb4\xb6Q\x8f\xc2B\xbf\xa8\x17`\x01\x86\xc2\x02\xbf\xa8\x17`\x01\x86\xc2"\xbf\xa8\x17`\x01\x86\xc2\x1a\xbf\xa8\x17`\x01\x86\xc2b\xcd|\xac\'\xf8\x95Bh\xcd|\xac\'\xf8\x95BW\xcd|\xac\'\xf8\x95BV\xcd|\xac\'\xf8\x95B,\xefi\xbfFy\x85B"\xefi\xbfFy\x85B?\xefi\xbfFy\x85B,\xefi\xbfFy\x85B\x9f\x8d\xccT\xdb\x1c{B\\\x8d\xccT\xdb\x1c{B\xae\x8d\xccT\xdb\x1c{BM\x8d\xccT\xdb\x1c{Bm\x1e=\x18\x12^\x80B\x84\x1e=\x18\x12^\x80B\xa0\x1e=\x18\x12^\x80B~\x1e=\x18\x12^\x80Bz\x84f\x9e\xef\x16\x8dB~\x84f\x9e\xef\x16\x8dB\x88\x84f\x9e\xef\x16\x8dB\x9f\x84f\x9e\xef\x16\x8dB\x053\x84\xdah\xb5\x94\xc2\xfb2\x84\xdah\xb5\x94\xc2\xfc2\x84\xdah\xb5\x94\xc2\xff2\x84\xdah\xb5\x94\xc2\xfd\xa5\xa8\xd0\x88f\x8a\xc2\x0e\xa6\xa8\xd0\x88f\x8a\xc2\\\xa6\xa8\xd0\x88f\x8a\xc2\x19\xa6\xa8\xd0\x88f\x8a\xc2\x08\x16Qy\xf2\xd8}B.\x15Qy\xf2\xd8}Bv\x15Qy\xf2\xd8}BJ\x15Qy\xf2\xd8}B\x96^\x93\xf8\xf3\x84\x8f\xc2\xda^\x93\xf8\xf3\x84\x8f\xc2\x1b_\x93\xf8\xf3\x84\x8f\xc2\xf4^\x93\xf8\xf3\x84\x8f\xc22\x14\xac\r\xd7\x02\x97\xc2\x94\x14\xac\r\xd7\x02\x97\xc2b\x14\xac\r\xd7\x02\x97\xc20\x14\xac\r\xd7\x02\x97\xc24^\xee\t\xa5\x84_\xc2xY\xee\t\xa5\x84_\xc2lX\xee\t\xa5\x84_\xc2\x16c\xee\t\xa5\x84_\xc2\xcb\xbb\x97\xd7X\xf2p\xc2\xb3\xba\x97\xd7X\xf2p\xc2\xc5\xbc\x97\xd7X\xf2p\xc2U\xbb\x97\xd7X\xf2p\xc2\xb0Pt\xd1\x9e\x92\x9c\xc2\xc2Pt\xd1\x9e\x92\x9c\xc2qPt\xd1\x9e\x92\x9c\xc2\x8dPt\xd1\x9e\x92\x9c\xc2\x01\n\x1b\xe5\xf8x\x90\xc2|\t\x1b\xe5\xf8x\x90\xc2\x07\n\x1b\xe5\xf8x\x90\xc2\x93\t\x1b\xe5\xf8x\x90\xc2\x1e\xad8\xaf\xbc^\x92B\xfc\xac8\xaf\xbc^\x92B\x06\xad8\xaf\xbc^\x92B\'\xad8\xaf\xbc^\x92B(\'\xa5\x10[\r\x82\xbf:\xfb\xd3\xce*G8?\xd6E\x8a\x9c\xa8\xf0e?\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\xa0\xdb\xb7\xa1\x8e\x14s\xbf\nz\x96\xe4\x97\xe1\x9d?\xae\xcc\x1a\xdb\xba\x0e\xbd?>X@_\xc1b\xb1?' 77 | p31 78 | tp32 79 | bsS'_sklearn_version' 80 | p33 81 | S'0.19.1' 82 | p34 83 | sS'copy_X' 84 | p35 85 | I01 86 | sS'intercept_' 87 | p36 88 | cnumpy.core.multiarray 89 | scalar 90 | p37 91 | (g21 92 | S'\x92x\x87\xae\x94\xcd\xa8B' 93 | p38 94 | tp39 95 | Rp40 96 | sS'singular_' 97 | p41 98 | g11 99 | (g12 100 | (I0 101 | tp42 102 | g14 103 | tp43 104 | Rp44 105 | (I1 106 | (I96 107 | tp45 108 | g21 109 | I00 110 | S"\xedX\xea\xf1\xb9\x81;@R\x84\x85\x8b\x03E9@\x9bC\xf5\x9d\xb839@\x1c3i$\xbfV7@\xacJ\\@i\x906@\xf2e\xefqY46@\xf2w\x15\xff\x96\xe55@\x90\x06Ee>\x985@u\x1b7\x0b\x03s5@\xfd\ng\xdf(#5@\x00\x05\x1f\xe0dy4@\n\xbe\xf6\xf9!Q4@\x07Oy\xe9\xcc\x0f4@\xd1\xdc\x88\xd8\xee\xe23@\t%>Y\x89o3@\x12\xf4\x9a\x01\x80?3@\xb7\x9fKz\xed\x1c3@h8\x8d\xeaU\xd82@\x925\xadA\x96\xba2@\xa7}\\\x89\xfbk2@A\xba6\xc8\xdc42@9~\xb3\x81Q\x072@4\xf2\x82\x85\xcc\xe31@u\xa0p\xce\xa4\xce1@Y\xaf\x89f'\xa11@\x96\x7f3\xb2\x9ey1@\xf2t@t\x8cR1@W\x99[\x9a\x8d\x131@\xda_\xcd\x80\x05\xe90@\xbdS!f8\xe60@\x9d\x07vdC\xb90@|\x18]\xcfv\x930@CB\xe8\xf6\x96j0@\xdf\xd7k\x7f\xe600@\xe1C5\x9d\xc3\x1d0@\xa8\x86K^p\xd1/@#\x85\r\xcf\xeb\x8b/@\x01\x07r\x1e&\x08/@\xd7\x08\x83.\\\xd1.@\x7ft\x95r\xb4\x9b.@\xc4y\xcf\x87@=.@1\x17f\xef\xdc\n.@s.\xb8\xf8\x8d\x8f-@+\xc9q\xf4HU-@~\x99\x15\\\xc85-@\xc19\xfd$\xfb\xb5,@^i\xc5k\x82v,@,W/\x87\x91),@CK\xaa_\xfci+@>\xac\x10\xcfz,+@\xd4\xd0\xb6S\xbb\xcd*@\xba\xf8hIn\x93*@}\x96L`\xe3{*@\x14@\x03\x8f\xf5\xa1)@\x08\x9c\x8e7\xe40)@%\xf4\x9e\xff\x87\xcc(@\x8d\x89d\xe0l\x89(@Fu\x00\x12\xfb\xa9'@\x14\x9c\xa3\xa5\x86\x0b'@\x83\xf8\xfc\xb25y&@?\xa5\xbf\xcb\xfe\xbb%@\xc2\xe4l\x1bp\xbd$@\x84\xe7a?q\x99#@=\xe8-e\xec\xcd @\xf4J\xb8\xecN=\x1b@|E\x9a\xbeG]\x17@\xcc\x1d\x8eK\x9d\xed\x15@\xde#\xc1S\xea\xd9-=\xad\xdcr\xc2U\x93\x17=l\x934$D\x84\x13=&a2:\x99\x02\x11=\x7f\xe5\xb8\x96\xd0\x86\x0e=njk:7r\x0c=\xf7_\xa5\xce\xe5\xa2\x0b=\xed\xf7\xfb\x99\xbe\xc2\n=\n\xab\xe2~\xb0\xfd\x06=[\x14\x97\xfc\xb4\x93\x05=\x0fA\xc1\xf5\x1e\xcd\x03=KI\x1eFn\x19\x03=\x15\x10\xa2s4P\x02=@\x93\xfa?WR\x00=,1\x8d\xc5\xc9\xd0\xfd<\xf2\x8d\x84d\xd5\xa7\xfb 3.38: 46 | print "Diversity \t\t\t\t\t\t\t\t\t %.2f (High)" %float(diversity) 47 | else: 48 | print "Diversity \t\t\t\t\t\t\t\t\t %.2f (Low)" % float(diversity) 49 | 50 | nucleotide_array = ['A', 'C', 'G', 'T'] 51 | print "Most likely inserted base pair \t\t\t\t %s" %nucleotide_array[int(single_bp_inserted.predict(sequence_pam_per_gene_grna)[0])] 52 | 53 | 54 | 55 | 56 | 57 | def prediction_function(spacer_pam,genomic_factor): 58 | m_frac_total_ins = pickle.load(open('models/fraction_total_insertions_other_cells.p', 'rb')) 59 | m_frac_total_del = pickle.load(open('models/fraction_total_deletions_other_cells.p', 'rb')) 60 | m_frac_mutant_ins = pickle.load(open('models/fraction_insertions_other_cells.p', 'rb')) 61 | m_avg_ins_length = pickle.load(open('models/exp_ins_length_other_cells_chrom.p', 'rb')) 62 | m_avg_del_length = pickle.load(open('models/exp_deletion_length_other_cells_chrom.p', 'rb')) 63 | m_diversity = pickle.load(open('models/entropy_other_cells_chrom.p', 'rb')) 64 | m_single_bp_inserted = pickle.load(open('models/single_insertion_type_4class-classification_other_cells.p', 'rb')) 65 | m_edit_eff = pickle.load(open('models/edit_eff_other_cells_chrom.p', 'rb')) 66 | 67 | sequence_pam_per_gene_grna = np.zeros((1, 23, 4), dtype=bool) 68 | for ind,basepair in enumerate(spacer_pam): 69 | sequence_pam_per_gene_grna[0,ind,one_hot_index(basepair)] = 1 70 | 71 | sequence_pam_per_gene_grna = np.reshape(sequence_pam_per_gene_grna , (1,-1)) 72 | 73 | sequence_pam_genomic_per_gene_grna = np.transpose(np.concatenate(( np.transpose(sequence_pam_per_gene_grna),np.transpose(genomic_factor)))) 74 | 75 | 76 | print "\nHere are the repair outcomes that SPROUT predicts for this guide:" 77 | frac_total_ins = 100 * float(m_frac_total_ins.predict(sequence_pam_per_gene_grna)[0]) 78 | frac_mutant_ins = 100 * float(m_frac_mutant_ins.predict(sequence_pam_per_gene_grna)[0]) 79 | 80 | print "Fraction of total reads with insertion \t\t %.0f %%" %frac_total_ins 81 | print "Insertion to deletion ratio \t\t\t\t %.0f %%" % (100*(frac_mutant_ins / float((100 - frac_mutant_ins)))) 82 | print "Average insertion length \t\t\t\t\t %.1f bps" %float(m_avg_ins_length.predict(sequence_pam_genomic_per_gene_grna)[0]) 83 | print "Average deletion length \t\t\t\t\t %.1f bps" %float(m_avg_del_length.predict(sequence_pam_genomic_per_gene_grna)[0]) 84 | 85 | diversity = m_diversity.predict(sequence_pam_genomic_per_gene_grna)[0] 86 | if diversity > 3.38: 87 | print "Diversity \t\t\t\t\t\t\t\t\t %.2f (High)" %float(diversity) 88 | else: 89 | print "Diversity \t\t\t\t\t\t\t\t\t %.2f (Low)" % float(diversity) 90 | 91 | nucleotide_array = ['A', 'C', 'G', 'T'] 92 | print "Most likely inserted base pair \t\t\t\t %s" %nucleotide_array[int(m_single_bp_inserted.predict(sequence_pam_per_gene_grna)[0])] 93 | 94 | print "Edit efficiency \t\t\t\t\t\t\t %.0f %%" % (100*float(m_edit_eff.predict(sequence_pam_genomic_per_gene_grna)[0])) 95 | 96 | 97 | #input_indicator = raw_input("Which input format do you prefer? \n(1) sgRNA sequence only\n(2) sgRNA sequence + genomic features (chromatin, etc.)\n(3) location on the genome and cell type \n\nSelected option:\n") 98 | 99 | 100 | file = open('guide_batch.txt', 'r') 101 | for line in file: 102 | spacer_pam = line.strip('\n') 103 | print 104 | print '>',spacer_pam 105 | #spacer_pam = raw_input("\nInput the sgRNA sequence followed by the PAM sequence:\n") 106 | proceed_flag = 1 107 | 108 | if len(spacer_pam)<23: 109 | print "Sequence is too short." 110 | proceed_flag = 0 111 | 112 | if spacer_pam.count('A')+spacer_pam.count('T')+spacer_pam.count('C')+spacer_pam.count('G') != len(spacer_pam): 113 | print "Sequence should contains four characters A, T, C, and G." 114 | proceed_flag = 0 115 | 116 | if proceed_flag == 1: 117 | simple_prediction_function(spacer_pam) 118 | 119 | -------------------------------------------------------------------------------- /README.md: -------------------------------------------------------------------------------- 1 | # SPROUT 2 | 3 | SPROUT is a machine learning algorithm to predict the repair outcome of a **CRISPR-CAS9 knockout experiment**. SPROUT accepts the DNA sequence of the *guide* as input as well as other *genomic factors*. It then predicts various statistics of the repair outcome, including: the fraction of mutant reads with an insertion/deletion, fraction of total reads with insertion/deletion, average insertion length given an insertion, average deletion length given a deletion, diversity, most likely inserted base pair and finally the edit (mutation) efficiency of the CRISPR outcome. In this repository we provide the codes neccessary to run the SPROUT algorithm as well as the set of trained models for users who want to run SPROUT in the batch mode. We have also provided an easy-to-use [SPROUT website]() with graphical interfance for general users with limited access to computing resources. 4 | 5 | Details of SPROUT is provided in the manuscript ["Systematic Characterization of Genome Editing in Primary T cells Reveals Proximal Genomic Insertions and Enables Machine Learning Prediction of CRISPR-Cas9 DNA Repair Outcomes"](). 6 | 7 | 8 | This repository provides the SPROUT package which includes the scripts required to predict the DNA repair outcome as well as a complete set of trained SPROUT models. The trained models are stored in the `model` folder of the repository. The main script of the package is the `SPROUT_predict` script which loads the pretrained models, asks for input query depending on the mode selected, and outputs the predicted statistics of the repair outcome. 9 | 10 | 11 | # Quickstart Guide 12 | 13 | To use the light-weight prediction tool run the `SPROUT_prediction` script and follow the instruction. The only software requirement is python 2.7.X. or later. SPROUT pipeline conveniently works in three modes depending on what input format is available to the user. Here we detail each operating mode: 14 | 15 | **Mode (1)** The first mode takes the DNA sequence of the guide and PAM sequence (23 base pair sequence) as the input. No other input is required for this operational mode. This is ideal for nucleotide-only guide design purposes. The code asks for one of the three input operating modes. 16 | 17 | ``` 18 | Which input format do you prefer? 19 | (1) sgRNA sequence only 20 | (2) sgRNA sequence + genomic features (chromatin, etc.) 21 | (3) location on the genome and cell type 22 | ``` 23 | For the basic mode input the digit 1. 24 | 25 | ``` 26 | Selected option: 27 | 1 28 | ``` 29 | Now the code asks for the sgRNA sequence followed by the PAM sequence. 30 | 31 | ``` 32 | Input the sgRNA sequence followed by the PAM sequence: 33 | TATGCATGCATCGACGATCGGGG 34 | ``` 35 | 36 | The software output SPROUT's prediction results as detailed in the manuscript. 37 | 38 | ``` 39 | Here are the repair outcomes that SPROUT predicts for this guide: 40 | 41 | Fraction of total reads with insertion 19 % 42 | 43 | Insertion to deletion ratio 27 % 44 | 45 | Average insertion length 1.1 bps 46 | 47 | Average deletion length 12.0 bps 48 | 49 | Diversity 2.25 (Low) 50 | 51 | Most likely inserted base pair A 52 | ``` 53 | 54 | **Mode (2)** The second mode accepts the input guide sequence as well as the 33 genomic features as listed in the main text. The input format is a string with 33 features, separated by comma. The ordering of features are as follows: 55 | 56 | ``` 57 | GC, CpG, priPhCons, mamPhCons, verPhCons, priPhyloP, mamPhyloP, verPhyloP, GerpN, GerpS, GerpRS, bStatistic, fitCons, cHmmTssA, cHmmTssAFlnk, cHmmTxFlnk, cHmmTx, cHmmTxWk, cHmmEnhG, cHmmEnh, cHmmZnfRpts, cHmmHet, cHmmTssBiv ,cHmmBivFlnk, cHmmEnhBiv, cHmmReprPC, cHmmReprPCWk, cHmmQuies, EncExp, EncH3K27Ac, EncH3K4Me1, EncH3K4Me3, EncNucleo. 58 | ``` 59 | 60 | Details of the features are described in `Supplementary Fig. 5` as adapted from the **ENCODE project** detailed ["here"](). This operation mode of SRPOUT is ideal when both the guide sequence and the genomic factors are known, measured or extracted a priori. As demonstrated in the manuscript the chromatin facots do not effect 61 | 62 | ``` 63 | Selected option: 64 | 2 65 | 66 | Input the sgRNA sequence followed by the PAM sequence: 67 | TATGCATGCATATATATATAGGG 68 | ``` 69 | 70 | ``` 71 | Input the genomic factors separated by ',': 72 | 0,0.5,0,0,0.5,0,0,0.5,0,0,0.5,0,0,0.5,0,0,0.5,0,0,0.5,0,0,0.5,0,0,0.5,0,0,0.5,0,0,0.5,0 73 | ``` 74 | And the software output the predicted summary statistics. 75 | 76 | 77 | ``` 78 | Here are the repair outcomes that SPROUT predicts for this guide: 79 | 80 | Fraction of total reads with insertion 22 % 81 | 82 | Insertion to deletion ratio 58 % 83 | 84 | Average insertion length 0.8 bps 85 | 86 | Average deletion length 11.5 bps 87 | 88 | Diversity 2.92 (Low) 89 | 90 | Most likely inserted base pair T 91 | 92 | Edit efficiency 55 % 93 | ``` 94 | 95 | 96 | **Mode (3)** (Currently under construction) The third operation mode asks the coordinate of the cut site and the cell type as the input. The SPROUT software extracts the guide sequence as well as the PAM from the human refrence genome (hg38.fa). The input coordinate should be the index of the starting nucleotide of the guide sequence (from the 3’ end). Once the guide is extracted, the softwares does a few tests to validate the guide and PAM sequences. Then, the software extracts the genomic factors given the cell type from a server. Finally, the SPROUT software predicts the out given the input sequence and chromatin facotrs. 97 | 98 | 99 | ``` 100 | Selected option: 101 | 3 102 | 103 | What is the target cell type? 104 | T-cells 105 | 106 | Which chromosome the cut site locates? 107 | 1 108 | 109 | What location the cut site is in that chromosome? 110 | 1234567 111 | 112 | This is the selected guide sequence: 113 | CGTTGAGTTCGAGCTCCGATGGG 114 | 115 | Here are the repair outcomes that SPROUT predicts for this guide: 116 | 117 | Fraction of total reads with insertion 17 % 118 | 119 | Insertion to deletion ratio 50 % 120 | 121 | Average insertion length 1.0 bps 122 | 123 | Average deletion length 8.3 bps 124 | 125 | Diversity 2.49 (Low) 126 | 127 | Most likely inserted base pair G 128 | ``` 129 | 130 | 131 | -------------------------------------------------------------------------------- /SPROUT_predict.py: -------------------------------------------------------------------------------- 1 | ## Amirali Aghazadeh, Aug 2018, Stanford University 2 | import numpy as np 3 | import pickle 4 | import sys 5 | 6 | def one_hot_index(nucleotide): 7 | if nucleotide == 'g': 8 | nucleotide = 'G' 9 | elif nucleotide == 'a': 10 | nucleotide = 'A' 11 | elif nucleotide == 'c': 12 | nucleotide = 'C' 13 | elif nucleotide == 't': 14 | nucleotide = 'T' 15 | nucleotide_array = ['A', 'C', 'G', 'T'] 16 | return nucleotide_array.index(nucleotide) 17 | 18 | def simple_prediction_function(spacer_pam): 19 | m_frac_total_ins = pickle.load(open('models/fraction_total_insertions_other_cells.p', 'rb')) 20 | m_frac_total_del = pickle.load(open('models/fraction_total_deletions_other_cells.p', 'rb')) 21 | m_frac_mutant_ins = pickle.load(open('models/fraction_insertions_other_cells.p', 'rb')) 22 | m_avg_ins_length = pickle.load(open('models/exp_ins_length_other_cells.p', 'rb')) 23 | m_avg_del_length = pickle.load(open('models/exp_deletion_length_other_cells.p', 'rb')) 24 | m_diversity = pickle.load(open('models/diversity_other_cells.p', 'rb')) 25 | single_bp_inserted = pickle.load(open('models/single_insertion_type_4class-classification_other_cells.p', 'rb')) 26 | 27 | sequence_pam_per_gene_grna = np.zeros((1, 23, 4), dtype=bool) 28 | for ind,basepair in enumerate(spacer_pam): 29 | sequence_pam_per_gene_grna[0,ind,one_hot_index(basepair)] = 1 30 | 31 | sequence_pam_per_gene_grna = np.reshape(sequence_pam_per_gene_grna , (1,-1)) 32 | 33 | 34 | print "\nHere are the repair outcomes that SPROUT predicts for this guide:" 35 | frac_total_ins = 100 * float(m_frac_total_ins.predict(sequence_pam_per_gene_grna)[0]) 36 | frac_mutant_ins = 100 * float(m_frac_mutant_ins.predict(sequence_pam_per_gene_grna)[0]) 37 | 38 | print "Fraction of total reads with insertion \t\t %.0f %%" %frac_total_ins 39 | #print "Fraction of total reads with deletion \t\t %.0f %%" % (frac_total_ins*(100/(frac_mutant_ins) -1)) 40 | print "Insertion to deletion ratio \t\t\t\t %.0f %%" % (100*(frac_mutant_ins / float((100 - frac_mutant_ins)))) 41 | print "Average insertion length \t\t\t\t\t %.1f bps" %float(m_avg_ins_length.predict(sequence_pam_per_gene_grna)[0]) 42 | print "Average deletion length \t\t\t\t\t %.1f bps" %float(m_avg_del_length.predict(sequence_pam_per_gene_grna)[0]) 43 | 44 | diversity = m_diversity.predict(sequence_pam_per_gene_grna)[0] 45 | if diversity > 3.38: 46 | print "Diversity \t\t\t\t\t\t\t\t\t %.2f (High)" %float(diversity) 47 | else: 48 | print "Diversity \t\t\t\t\t\t\t\t\t %.2f (Low)" % float(diversity) 49 | 50 | nucleotide_array = ['A', 'C', 'G', 'T'] 51 | print "Most likely inserted base pair \t\t\t\t %s" %nucleotide_array[int(single_bp_inserted.predict(sequence_pam_per_gene_grna)[0])] 52 | 53 | 54 | 55 | 56 | 57 | def prediction_function(spacer_pam,genomic_factor): 58 | m_frac_total_ins = pickle.load(open('models/fraction_total_insertions_other_cells.p', 'rb')) 59 | m_frac_total_del = pickle.load(open('models/fraction_total_deletions_other_cells.p', 'rb')) 60 | m_frac_mutant_ins = pickle.load(open('models/fraction_insertions_other_cells.p', 'rb')) 61 | m_avg_ins_length = pickle.load(open('models/exp_ins_length_other_cells_chrom.p', 'rb')) 62 | m_avg_del_length = pickle.load(open('models/exp_deletion_length_other_cells_chrom.p', 'rb')) 63 | m_diversity = pickle.load(open('models/entropy_other_cells_chrom.p', 'rb')) 64 | m_single_bp_inserted = pickle.load(open('models/single_insertion_type_4class-classification_other_cells.p', 'rb')) 65 | m_edit_eff = pickle.load(open('models/edit_eff_other_cells_chrom.p', 'rb')) 66 | 67 | sequence_pam_per_gene_grna = np.zeros((1, 23, 4), dtype=bool) 68 | for ind,basepair in enumerate(spacer_pam): 69 | sequence_pam_per_gene_grna[0,ind,one_hot_index(basepair)] = 1 70 | 71 | sequence_pam_per_gene_grna = np.reshape(sequence_pam_per_gene_grna , (1,-1)) 72 | 73 | sequence_pam_genomic_per_gene_grna = np.transpose(np.concatenate(( np.transpose(sequence_pam_per_gene_grna),np.transpose(genomic_factor)))) 74 | 75 | 76 | print "\nHere are the repair outcomes that SPROUT predicts for this guide:" 77 | frac_total_ins = 100 * float(m_frac_total_ins.predict(sequence_pam_per_gene_grna)[0]) 78 | frac_mutant_ins = 100 * float(m_frac_mutant_ins.predict(sequence_pam_per_gene_grna)[0]) 79 | 80 | print "Fraction of total reads with insertion \t\t %.0f %%" %frac_total_ins 81 | print "Insertion to deletion ratio \t\t\t\t %.0f %%" % (100*(frac_mutant_ins / float((100 - frac_mutant_ins)))) 82 | print "Average insertion length \t\t\t\t\t %.1f bps" %float(m_avg_ins_length.predict(sequence_pam_genomic_per_gene_grna)[0]) 83 | print "Average deletion length \t\t\t\t\t %.1f bps" %float(m_avg_del_length.predict(sequence_pam_genomic_per_gene_grna)[0]) 84 | 85 | diversity = m_diversity.predict(sequence_pam_genomic_per_gene_grna)[0] 86 | if diversity > 3.38: 87 | print "Diversity \t\t\t\t\t\t\t\t\t %.2f (High)" %float(diversity) 88 | else: 89 | print "Diversity \t\t\t\t\t\t\t\t\t %.2f (Low)" % float(diversity) 90 | 91 | nucleotide_array = ['A', 'C', 'G', 'T'] 92 | print "Most likely inserted base pair \t\t\t\t %s" %nucleotide_array[int(m_single_bp_inserted.predict(sequence_pam_per_gene_grna)[0])] 93 | 94 | print "Edit efficiency \t\t\t\t\t\t\t %.0f %%" % (100*float(m_edit_eff.predict(sequence_pam_genomic_per_gene_grna)[0])) 95 | 96 | 97 | input_indicator = raw_input("Which input format do you prefer? \n(1) sgRNA sequence only\n(2) sgRNA sequence + genomic features (chromatin, etc.)\n(3) location on the genome and cell type \n\nSelected option:\n") 98 | if input_indicator == '1': 99 | spacer_pam = raw_input("\nInput the sgRNA sequence followed by the PAM sequence:\n") 100 | proceed_flag = 1 101 | 102 | if len(spacer_pam)<23: 103 | print "Sequence is too short." 104 | proceed_flag = 0 105 | 106 | if spacer_pam.count('A')+spacer_pam.count('T')+spacer_pam.count('C')+spacer_pam.count('G') != len(spacer_pam): 107 | print "Sequence should contains four characters A, T, C, and G." 108 | proceed_flag = 0 109 | 110 | if proceed_flag == 1: 111 | simple_prediction_function(spacer_pam) 112 | 113 | 114 | if input_indicator == '2': 115 | proceed_flag = 1 116 | spacer_pam = raw_input("\nInput the sgRNA sequence followed by the PAM sequence:\n") 117 | 118 | if len(spacer_pam)<23: 119 | print "Sequence is too short." 120 | proceed_flag = 0 121 | 122 | if spacer_pam.count('A')+spacer_pam.count('T')+spacer_pam.count('C')+spacer_pam.count('G') != len(spacer_pam): 123 | print "Sequence should contains four characters A, T, C, and G." 124 | proceed_flag = 0 125 | 126 | chrom_factor = raw_input("\nInput the genomic factors separated by ',':\n") 127 | chrom_factor = np.asarray(chrom_factor.split(',')) 128 | if len(chrom_factor)!=33: 129 | print "Number of genomic feaures do not match. Please enter 33 features." 130 | 131 | else: 132 | chrom_factor_float = [] 133 | for ind,item in enumerate(chrom_factor): 134 | chrom_factor_float.append(float(item)) 135 | 136 | chrom_factor_float = np.expand_dims(chrom_factor_float, axis=0) 137 | prediction_function(spacer_pam,chrom_factor_float) 138 | 139 | 140 | 141 | if input_indicator == '3': 142 | cell_type = raw_input("\nWhat is the target cell type?\n") 143 | chr = raw_input("\nWhich chromosome the cut site locates?\n") 144 | position = int(raw_input("\nWhat location the cut site is in that chromosome?\n")) 145 | 146 | 147 | flag = 0 148 | with open('/Users/amirali/Software/refgenome/hg38.fa', 'r') as inF: 149 | for ind,line in enumerate(inF): 150 | if '>chr%s\n'%chr in line: 151 | indstart = ind 152 | flag = 1 153 | if flag == 1 and ind == (indstart + position / 50): 154 | targetline1 = line 155 | if flag == 1 and ind == (indstart + position / 50 + 1): 156 | targetline2 = line 157 | 158 | if position%50 < 50-23: 159 | guide = targetline1[position%50:position%50+23] 160 | else: 161 | guide = targetline1[position%50:] + targetline2[:23-position%50] 162 | 163 | print "\nThis is the selected guide sequence:" 164 | print guide 165 | 166 | if guide.count('A')+guide.count('T')+guide.count('C')+guide.count('G') != 23: 167 | print "The sequence is invalid. It contains characters out of the four A, T, C, and G nucleotide." 168 | elif guide[-2:] != 'GG': 169 | print "The PAM sequence is invalid. PAM should be in NGG format." 170 | else: 171 | print simple_prediction_function(guide) 172 | 173 | 174 | 175 | 176 | 177 | 178 | 179 | -------------------------------------------------------------------------------- /LICENSE: -------------------------------------------------------------------------------- 1 | Apache License 2 | Version 2.0, January 2004 3 | http://www.apache.org/licenses/ 4 | 5 | TERMS AND CONDITIONS FOR USE, REPRODUCTION, AND DISTRIBUTION 6 | 7 | 1. Definitions. 8 | 9 | "License" shall mean the terms and conditions for use, reproduction, 10 | and distribution as defined by Sections 1 through 9 of this document. 11 | 12 | "Licensor" shall mean the copyright owner or entity authorized by 13 | the copyright owner that is granting the License. 14 | 15 | "Legal Entity" shall mean the union of the acting entity and all 16 | other entities that control, are controlled by, or are under common 17 | control with that entity. For the purposes of this definition, 18 | "control" means (i) the power, direct or indirect, to cause the 19 | direction or management of such entity, whether by contract or 20 | otherwise, or (ii) ownership of fifty percent (50%) or more of the 21 | outstanding shares, or (iii) beneficial ownership of such entity. 22 | 23 | "You" (or "Your") shall mean an individual or Legal Entity 24 | exercising permissions granted by this License. 25 | 26 | "Source" form shall mean the preferred form for making modifications, 27 | including but not limited to software source code, documentation 28 | source, and configuration files. 29 | 30 | "Object" form shall mean any form resulting from mechanical 31 | transformation or translation of a Source form, including but 32 | not limited to compiled object code, generated documentation, 33 | and conversions to other media types. 34 | 35 | "Work" shall mean the work of authorship, whether in Source or 36 | Object form, made available under the License, as indicated by a 37 | copyright notice that is included in or attached to the work 38 | (an example is provided in the Appendix below). 39 | 40 | "Derivative Works" shall mean any work, whether in Source or Object 41 | form, that is based on (or derived from) the Work and for which the 42 | editorial revisions, annotations, elaborations, or other modifications 43 | represent, as a whole, an original work of authorship. For the purposes 44 | of this License, Derivative Works shall not include works that remain 45 | separable from, or merely link (or bind by name) to the interfaces of, 46 | the Work and Derivative Works thereof. 47 | 48 | "Contribution" shall mean any work of authorship, including 49 | the original version of the Work and any modifications or additions 50 | to that Work or Derivative Works thereof, that is intentionally 51 | submitted to Licensor for inclusion in the Work by the copyright owner 52 | or by an individual or Legal Entity authorized to submit on behalf of 53 | the copyright owner. For the purposes of this definition, "submitted" 54 | means any form of electronic, verbal, or written communication sent 55 | to the Licensor or its representatives, including but not limited to 56 | communication on electronic mailing lists, source code control systems, 57 | and issue tracking systems that are managed by, or on behalf of, the 58 | Licensor for the purpose of discussing and improving the Work, but 59 | excluding communication that is conspicuously marked or otherwise 60 | designated in writing by the copyright owner as "Not a Contribution." 61 | 62 | "Contributor" shall mean Licensor and any individual or Legal Entity 63 | on behalf of whom a Contribution has been received by Licensor and 64 | subsequently incorporated within the Work. 65 | 66 | 2. Grant of Copyright License. Subject to the terms and conditions of 67 | this License, each Contributor hereby grants to You a perpetual, 68 | worldwide, non-exclusive, no-charge, royalty-free, irrevocable 69 | copyright license to reproduce, prepare Derivative Works of, 70 | publicly display, publicly perform, sublicense, and distribute the 71 | Work and such Derivative Works in Source or Object form. 72 | 73 | 3. Grant of Patent License. Subject to the terms and conditions of 74 | this License, each Contributor hereby grants to You a perpetual, 75 | worldwide, non-exclusive, no-charge, royalty-free, irrevocable 76 | (except as stated in this section) patent license to make, have made, 77 | use, offer to sell, sell, import, and otherwise transfer the Work, 78 | where such license applies only to those patent claims licensable 79 | by such Contributor that are necessarily infringed by their 80 | Contribution(s) alone or by combination of their Contribution(s) 81 | with the Work to which such Contribution(s) was submitted. If You 82 | institute patent litigation against any entity (including a 83 | cross-claim or counterclaim in a lawsuit) alleging that the Work 84 | or a Contribution incorporated within the Work constitutes direct 85 | or contributory patent infringement, then any patent licenses 86 | granted to You under this License for that Work shall terminate 87 | as of the date such litigation is filed. 88 | 89 | 4. Redistribution. You may reproduce and distribute copies of the 90 | Work or Derivative Works thereof in any medium, with or without 91 | modifications, and in Source or Object form, provided that You 92 | meet the following conditions: 93 | 94 | (a) You must give any other recipients of the Work or 95 | Derivative Works a copy of this License; and 96 | 97 | (b) You must cause any modified files to carry prominent notices 98 | stating that You changed the files; and 99 | 100 | (c) You must retain, in the Source form of any Derivative Works 101 | that You distribute, all copyright, patent, trademark, and 102 | attribution notices from the Source form of the Work, 103 | excluding those notices that do not pertain to any part of 104 | the Derivative Works; and 105 | 106 | (d) If the Work includes a "NOTICE" text file as part of its 107 | distribution, then any Derivative Works that You distribute must 108 | include a readable copy of the attribution notices contained 109 | within such NOTICE file, excluding those notices that do not 110 | pertain to any part of the Derivative Works, in at least one 111 | of the following places: within a NOTICE text file distributed 112 | as part of the Derivative Works; within the Source form or 113 | documentation, if provided along with the Derivative Works; or, 114 | within a display generated by the Derivative Works, if and 115 | wherever such third-party notices normally appear. The contents 116 | of the NOTICE file are for informational purposes only and 117 | do not modify the License. You may add Your own attribution 118 | notices within Derivative Works that You distribute, alongside 119 | or as an addendum to the NOTICE text from the Work, provided 120 | that such additional attribution notices cannot be construed 121 | as modifying the License. 122 | 123 | You may add Your own copyright statement to Your modifications and 124 | may provide additional or different license terms and conditions 125 | for use, reproduction, or distribution of Your modifications, or 126 | for any such Derivative Works as a whole, provided Your use, 127 | reproduction, and distribution of the Work otherwise complies with 128 | the conditions stated in this License. 129 | 130 | 5. Submission of Contributions. Unless You explicitly state otherwise, 131 | any Contribution intentionally submitted for inclusion in the Work 132 | by You to the Licensor shall be under the terms and conditions of 133 | this License, without any additional terms or conditions. 134 | Notwithstanding the above, nothing herein shall supersede or modify 135 | the terms of any separate license agreement you may have executed 136 | with Licensor regarding such Contributions. 137 | 138 | 6. Trademarks. This License does not grant permission to use the trade 139 | names, trademarks, service marks, or product names of the Licensor, 140 | except as required for reasonable and customary use in describing the 141 | origin of the Work and reproducing the content of the NOTICE file. 142 | 143 | 7. Disclaimer of Warranty. Unless required by applicable law or 144 | agreed to in writing, Licensor provides the Work (and each 145 | Contributor provides its Contributions) on an "AS IS" BASIS, 146 | WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or 147 | implied, including, without limitation, any warranties or conditions 148 | of TITLE, NON-INFRINGEMENT, MERCHANTABILITY, or FITNESS FOR A 149 | PARTICULAR PURPOSE. You are solely responsible for determining the 150 | appropriateness of using or redistributing the Work and assume any 151 | risks associated with Your exercise of permissions under this License. 152 | 153 | 8. Limitation of Liability. In no event and under no legal theory, 154 | whether in tort (including negligence), contract, or otherwise, 155 | unless required by applicable law (such as deliberate and grossly 156 | negligent acts) or agreed to in writing, shall any Contributor be 157 | liable to You for damages, including any direct, indirect, special, 158 | incidental, or consequential damages of any character arising as a 159 | result of this License or out of the use or inability to use the 160 | Work (including but not limited to damages for loss of goodwill, 161 | work stoppage, computer failure or malfunction, or any and all 162 | other commercial damages or losses), even if such Contributor 163 | has been advised of the possibility of such damages. 164 | 165 | 9. Accepting Warranty or Additional Liability. While redistributing 166 | the Work or Derivative Works thereof, You may choose to offer, 167 | and charge a fee for, acceptance of support, warranty, indemnity, 168 | or other liability obligations and/or rights consistent with this 169 | License. However, in accepting such obligations, You may act only 170 | on Your own behalf and on Your sole responsibility, not on behalf 171 | of any other Contributor, and only if You agree to indemnify, 172 | defend, and hold each Contributor harmless for any liability 173 | incurred by, or claims asserted against, such Contributor by reason 174 | of your accepting any such warranty or additional liability. 175 | 176 | END OF TERMS AND CONDITIONS 177 | 178 | APPENDIX: How to apply the Apache License to your work. 179 | 180 | To apply the Apache License to your work, attach the following 181 | boilerplate notice, with the fields enclosed by brackets "[]" 182 | replaced with your own identifying information. (Don't include 183 | the brackets!) The text should be enclosed in the appropriate 184 | comment syntax for the file format. We also recommend that a 185 | file or class name and description of purpose be included on the 186 | same "printed page" as the copyright notice for easier 187 | identification within third-party archives. 188 | 189 | Copyright [yyyy] [name of copyright owner] 190 | 191 | Licensed under the Apache License, Version 2.0 (the "License"); 192 | you may not use this file except in compliance with the License. 193 | You may obtain a copy of the License at 194 | 195 | http://www.apache.org/licenses/LICENSE-2.0 196 | 197 | Unless required by applicable law or agreed to in writing, software 198 | distributed under the License is distributed on an "AS IS" BASIS, 199 | WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. 200 | See the License for the specific language governing permissions and 201 | limitations under the License. 202 | --------------------------------------------------------------------------------