├── difference ├── .gitignore ├── src │ ├── commonMain │ │ └── kotlin │ │ │ └── dev │ │ │ └── andrewbailey │ │ │ └── diff │ │ │ ├── impl │ │ │ ├── MyersDiffOperation.kt │ │ │ ├── Snake.kt │ │ │ ├── Region.kt │ │ │ ├── Point.kt │ │ │ ├── CircularIntArray.kt │ │ │ ├── Extensions.kt │ │ │ └── MyersDiffAlgorithm.kt │ │ │ ├── Difference.kt │ │ │ ├── DiffOperation.kt │ │ │ ├── DiffResult.kt │ │ │ └── DiffGenerator.kt │ ├── jvmTest │ │ └── kotlin │ │ │ └── dev │ │ │ └── andrewbailey │ │ │ └── diff │ │ │ └── DiffReceiverTest.kt │ ├── jvmMain │ │ └── kotlin │ │ │ └── dev │ │ │ └── andrewbailey │ │ │ └── diff │ │ │ └── DiffReceiver.kt │ └── commonTest │ │ └── kotlin │ │ └── dev │ │ └── andrewbailey │ │ └── diff │ │ ├── impl │ │ └── MyersDiffAlgorithmTest.kt │ │ └── DiffGeneratorTest.kt └── build.gradle ├── android-perf-test ├── .gitignore ├── signing-key.jks ├── src │ ├── main │ │ └── AndroidManifest.xml │ └── androidTest │ │ ├── AndroidManifest.xml │ │ └── java │ │ └── dev │ │ └── andrewbailey │ │ └── diff │ │ └── DiffBenchmarkTest.kt ├── proguard-rules.pro ├── benchmark-proguard-rules.pro └── build.gradle ├── settings.gradle ├── gradle ├── wrapper │ ├── gradle-wrapper.jar │ └── gradle-wrapper.properties └── publish.gradle ├── .gitignore ├── .editorconfig ├── .github └── workflows │ ├── commit-verifications.yml │ └── publish.yml ├── LICENSE ├── gradle.properties ├── gradlew.bat ├── gradlew └── README.md /difference/.gitignore: -------------------------------------------------------------------------------- 1 | /build 2 | -------------------------------------------------------------------------------- /android-perf-test/.gitignore: -------------------------------------------------------------------------------- 1 | /build 2 | -------------------------------------------------------------------------------- /settings.gradle: -------------------------------------------------------------------------------- 1 | rootProject.name='Difference' 2 | include ':difference' 3 | include ':android-perf-test' 4 | -------------------------------------------------------------------------------- /android-perf-test/signing-key.jks: -------------------------------------------------------------------------------- https://raw.githubusercontent.com/andrewbailey/Difference/HEAD/android-perf-test/signing-key.jks -------------------------------------------------------------------------------- /gradle/wrapper/gradle-wrapper.jar: -------------------------------------------------------------------------------- https://raw.githubusercontent.com/andrewbailey/Difference/HEAD/gradle/wrapper/gradle-wrapper.jar -------------------------------------------------------------------------------- /android-perf-test/src/main/AndroidManifest.xml: -------------------------------------------------------------------------------- 1 | 2 | 3 | -------------------------------------------------------------------------------- /.gitignore: -------------------------------------------------------------------------------- 1 | *.iml 2 | .gradle 3 | /local.properties 4 | /.idea/ 5 | .DS_Store 6 | /build 7 | /captures 8 | .externalNativeBuild 9 | .cxx 10 | *.klib 11 | -------------------------------------------------------------------------------- /gradle/wrapper/gradle-wrapper.properties: -------------------------------------------------------------------------------- 1 | #Tue Jan 21 21:18:25 EST 2025 2 | distributionBase=GRADLE_USER_HOME 3 | distributionPath=wrapper/dists 4 | distributionUrl=https\://services.gradle.org/distributions/gradle-8.10.2-bin.zip 5 | zipStoreBase=GRADLE_USER_HOME 6 | zipStorePath=wrapper/dists 7 | -------------------------------------------------------------------------------- /.editorconfig: -------------------------------------------------------------------------------- 1 | root = true 2 | 3 | [*.{kt,kts}] 4 | ij_kotlin_allow_trailing_comma_on_call_site=false 5 | ij_kotlin_allow_trailing_comma=false 6 | ktlint_code_style = android_studio 7 | ktlint_class_signature_rule_force_multiline_when_parameter_count_greater_or_equal_than=2 8 | ktlint_function_signature_rule_force_multiline_when_parameter_count_greater_or_equal_than=3 9 | -------------------------------------------------------------------------------- /difference/src/commonMain/kotlin/dev/andrewbailey/diff/impl/MyersDiffOperation.kt: -------------------------------------------------------------------------------- 1 | package dev.andrewbailey.diff.impl 2 | 3 | internal sealed class MyersDiffOperation { 4 | 5 | data class Insert(val value: T) : MyersDiffOperation() 6 | 7 | data object Delete : MyersDiffOperation() 8 | 9 | data object Skip : MyersDiffOperation() 10 | } 11 | -------------------------------------------------------------------------------- /difference/src/commonMain/kotlin/dev/andrewbailey/diff/impl/Snake.kt: -------------------------------------------------------------------------------- 1 | package dev.andrewbailey.diff.impl 2 | 3 | internal data class Snake( 4 | val start: Point, 5 | val end: Point 6 | ) : Comparable { 7 | override fun compareTo(other: Snake): Int = if (start.x == other.start.x) { 8 | start.y - other.start.y 9 | } else { 10 | start.x - other.start.x 11 | } 12 | } 13 | -------------------------------------------------------------------------------- /difference/src/commonMain/kotlin/dev/andrewbailey/diff/impl/Region.kt: -------------------------------------------------------------------------------- 1 | package dev.andrewbailey.diff.impl 2 | 3 | internal data class Region( 4 | val left: Int, 5 | val top: Int, 6 | val right: Int, 7 | val bottom: Int 8 | ) { 9 | val width: Int 10 | get() = right - left 11 | 12 | val height: Int 13 | get() = bottom - top 14 | 15 | val size: Int 16 | get() = width + height 17 | 18 | val delta: Int 19 | get() = width - height 20 | } 21 | -------------------------------------------------------------------------------- /.github/workflows/commit-verifications.yml: -------------------------------------------------------------------------------- 1 | name: Difference CI 2 | 3 | on: [push] 4 | 5 | jobs: 6 | build: 7 | runs-on: ubuntu-latest 8 | 9 | steps: 10 | - name: Checkout code 11 | uses: actions/checkout@v1 12 | 13 | - name: Set up JDK 17 14 | uses: actions/setup-java@v1 15 | with: 16 | java-version: 17 17 | 18 | - name: Run all unit tests 19 | run: ./gradlew allTests 20 | 21 | - name: Kotlin lint 22 | run: ./gradlew ktlintCheck 23 | -------------------------------------------------------------------------------- /difference/src/commonMain/kotlin/dev/andrewbailey/diff/impl/Point.kt: -------------------------------------------------------------------------------- 1 | package dev.andrewbailey.diff.impl 2 | 3 | import kotlin.jvm.JvmInline 4 | 5 | @JvmInline 6 | internal value class Point(private val packed: Long) { 7 | val x: Int get() = (packed and 0xFFFFFFFF).toInt() 8 | val y: Int get() = (packed shr 32).toInt() 9 | 10 | constructor(x: Int, y: Int) : this( 11 | (x.toLong() and 0xFFFFFFFF) or (y.toLong() shl 32) 12 | ) 13 | 14 | inline operator fun component1() = x 15 | inline operator fun component2() = y 16 | } 17 | -------------------------------------------------------------------------------- /android-perf-test/src/androidTest/AndroidManifest.xml: -------------------------------------------------------------------------------- 1 | 2 | 5 | 6 | 7 | 8 | 9 | 14 | 15 | 16 | -------------------------------------------------------------------------------- /difference/src/commonMain/kotlin/dev/andrewbailey/diff/impl/CircularIntArray.kt: -------------------------------------------------------------------------------- 1 | package dev.andrewbailey.diff.impl 2 | 3 | import kotlin.jvm.JvmInline 4 | 5 | @JvmInline 6 | internal value class CircularIntArray(val array: IntArray) { 7 | 8 | constructor(size: Int) : this(IntArray(size)) 9 | 10 | inline operator fun get(index: Int): Int = array[toLinearIndex(index)] 11 | 12 | inline operator fun set(index: Int, value: Int) { 13 | array[toLinearIndex(index)] = value 14 | } 15 | 16 | private inline fun toLinearIndex(index: Int): Int { 17 | val moddedIndex = index % array.size 18 | return if (moddedIndex < 0) { 19 | moddedIndex + array.size 20 | } else { 21 | moddedIndex 22 | } 23 | } 24 | } 25 | -------------------------------------------------------------------------------- /android-perf-test/proguard-rules.pro: -------------------------------------------------------------------------------- 1 | # Add project specific ProGuard rules here. 2 | # You can control the set of applied configuration files using the 3 | # proguardFiles setting in build.gradle. 4 | # 5 | # For more details, see 6 | # http://developer.android.com/guide/developing/tools/proguard.html 7 | 8 | # If your project uses WebView with JS, uncomment the following 9 | # and specify the fully qualified class name to the JavaScript interface 10 | # class: 11 | #-keepclassmembers class fqcn.of.javascript.interface.for.webview { 12 | # public *; 13 | #} 14 | 15 | # Uncomment this to preserve the line number information for 16 | # debugging stack traces. 17 | #-keepattributes SourceFile,LineNumberTable 18 | 19 | # If you keep the line number information, uncomment this to 20 | # hide the original source file name. 21 | #-renamesourcefileattribute SourceFile 22 | -------------------------------------------------------------------------------- /difference/src/commonMain/kotlin/dev/andrewbailey/diff/impl/Extensions.kt: -------------------------------------------------------------------------------- 1 | package dev.andrewbailey.diff.impl 2 | 3 | import kotlin.math.abs 4 | 5 | internal inline fun Int.isEven() = abs(this) % 2 == 0 6 | 7 | internal inline fun Int.isOdd() = abs(this) % 2 == 1 8 | 9 | internal inline fun MutableList.push(item: T) { 10 | add(item) 11 | } 12 | 13 | internal inline fun MutableList.pop(): T = removeAt(size - 1) 14 | 15 | internal inline fun List.fastForEach(action: (T) -> Unit) { 16 | @Suppress("ReplaceManualRangeWithIndicesCalls") 17 | for (i in 0 until size) { 18 | action(this[i]) 19 | } 20 | } 21 | 22 | internal inline fun List.fastForEachIndexed(action: (Int, T) -> Unit) { 23 | @Suppress("ReplaceManualRangeWithIndicesCalls") 24 | for (i in 0 until size) { 25 | action(i, this[i]) 26 | } 27 | } 28 | -------------------------------------------------------------------------------- /LICENSE: -------------------------------------------------------------------------------- 1 | MIT License 2 | 3 | Copyright (c) 2020 Andrew Bailey 4 | 5 | Permission is hereby granted, free of charge, to any person obtaining a copy 6 | of this software and associated documentation files (the "Software"), to deal 7 | in the Software without restriction, including without limitation the rights 8 | to use, copy, modify, merge, publish, distribute, sublicense, and/or sell 9 | copies of the Software, and to permit persons to whom the Software is 10 | furnished to do so, subject to the following conditions: 11 | 12 | The above copyright notice and this permission notice shall be included in all 13 | copies or substantial portions of the Software. 14 | 15 | THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR 16 | IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, 17 | FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE 18 | AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER 19 | LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, 20 | OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE 21 | SOFTWARE. 22 | -------------------------------------------------------------------------------- /android-perf-test/benchmark-proguard-rules.pro: -------------------------------------------------------------------------------- 1 | # Add project specific ProGuard rules here. 2 | # You can control the set of applied configuration files using the 3 | # proguardFiles setting in build.gradle. 4 | # 5 | # For more details, see 6 | # http://developer.android.com/guide/developing/tools/proguard.html 7 | 8 | # If your project uses WebView with JS, uncomment the following 9 | # and specify the fully qualified class name to the JavaScript interface 10 | # class: 11 | #-keepclassmembers class fqcn.of.javascript.interface.for.webview { 12 | # public *; 13 | #} 14 | 15 | # Uncomment this to preserve the line number information for 16 | # debugging stack traces. 17 | #-keepattributes SourceFile,LineNumberTable 18 | 19 | # If you keep the line number information, uncomment this to 20 | # hide the original source file name. 21 | #-renamesourcefileattribute SourceFile 22 | 23 | -dontobfuscate 24 | 25 | -ignorewarnings 26 | 27 | -keepattributes *Annotation* 28 | 29 | -dontnote junit.framework.** 30 | -dontnote junit.runner.** 31 | 32 | -dontwarn androidx.test.** 33 | -dontwarn org.junit.** 34 | -dontwarn org.hamcrest.** 35 | -dontwarn com.squareup.javawriter.JavaWriter 36 | 37 | -keepclasseswithmembers @org.junit.runner.RunWith public class * 38 | -------------------------------------------------------------------------------- /.github/workflows/publish.yml: -------------------------------------------------------------------------------- 1 | name: Publish 2 | 3 | on: 4 | release: 5 | types: 6 | - created 7 | 8 | jobs: 9 | publish: 10 | runs-on: macos-latest 11 | 12 | steps: 13 | - name: Checkout code 14 | uses: actions/checkout@v1 15 | 16 | - name: Set up JDK 17 17 | uses: actions/setup-java@v1 18 | with: 19 | java-version: 17 20 | 21 | - name: Publish JVM, JS, Linux, and Apple libraries to Maven 22 | run: ./gradlew publishAllPublicationsToSonatypeRepository 23 | env: 24 | SONATYPE_USERNAME: ${{ secrets.SONATYPE_USERNAME }} 25 | SONATYPE_PASSWORD: ${{ secrets.SONATYPE_PASSWORD }} 26 | SIGNING_KEY: ${{ secrets.SIGNING_KEY }} 27 | 28 | publish-windows: 29 | runs-on: windows-latest 30 | 31 | steps: 32 | - name: Checkout code 33 | uses: actions/checkout@v1 34 | 35 | - name: Set up JDK 17 36 | uses: actions/setup-java@v1 37 | with: 38 | java-version: 17 39 | 40 | - name: Publish Windows x64 library to Maven 41 | run: ./gradlew publishMingwX64PublicationToSonatypeRepository 42 | env: 43 | SONATYPE_USERNAME: ${{ secrets.SONATYPE_USERNAME }} 44 | SONATYPE_PASSWORD: ${{ secrets.SONATYPE_PASSWORD }} 45 | SIGNING_KEY: ${{ secrets.SIGNING_KEY }} 46 | -------------------------------------------------------------------------------- /gradle.properties: -------------------------------------------------------------------------------- 1 | # Project-wide Gradle settings. 2 | # IDE (e.g. Android Studio) users: 3 | # Gradle settings configured through the IDE *will override* 4 | # any settings specified in this file. 5 | # For more details on how to configure your build environment visit 6 | # http://www.gradle.org/docs/current/userguide/build_environment.html 7 | # Specifies the JVM arguments used for the daemon process. 8 | # The setting is particularly useful for tweaking memory settings. 9 | org.gradle.jvmargs=-Xmx1536m 10 | # When configured, Gradle will run in incubating parallel mode. 11 | # This option should only be used with decoupled projects. More details, visit 12 | # http://www.gradle.org/docs/current/userguide/multi_project_builds.html#sec:decoupled_projects 13 | # org.gradle.parallel=true 14 | # AndroidX package structure to make it clearer which packages are bundled with the 15 | # Android operating system, and which are packaged with your app's APK 16 | # https://developer.android.com/topic/libraries/support-library/androidx-rn 17 | android.useAndroidX=true 18 | # Automatically convert third-party libraries to use AndroidX 19 | android.enableJetifier=true 20 | # Kotlin code style for this project: "official" or "obsolete": 21 | kotlin.code.style=official 22 | android.enableAdditionalTestOutput=true 23 | 24 | GROUP=dev.andrewbailey.difference 25 | VERSION_NAME=1.1.1 26 | 27 | POM_ARTIFACT_ID=difference 28 | POM_NAME=Difference 29 | 30 | POM_DESCRIPTION=A Kotlin Multiplatform diffing library 31 | 32 | POM_URL=https://github.com/andrewbailey/difference/ 33 | POM_SCM_URL=https://github.com/andrewbailey/difference/ 34 | POM_SCM_CONNECTION=scm:git:git://github.com/andrewbailey/difference.git 35 | POM_SCM_DEV_CONNECTION=scm:git:ssh://git@github.com/andrewbailey/difference.git 36 | 37 | POM_LICENCE_NAME=MIT License 38 | POM_LICENCE_URL=https://opensource.org/licenses/MIT 39 | POM_LICENCE_DIST=repo 40 | 41 | POM_DEVELOPER_ID=andrewbailey 42 | POM_DEVELOPER_NAME=Andrew Bailey 43 | -------------------------------------------------------------------------------- /gradle/publish.gradle: -------------------------------------------------------------------------------- 1 | apply plugin: 'maven-publish' 2 | apply plugin: 'signing' 3 | 4 | publishing { 5 | publications.all { 6 | pom.withXml { 7 | def root = asNode() 8 | 9 | root.children().last() + { 10 | resolveStrategy = Closure.DELEGATE_FIRST 11 | 12 | description POM_DESCRIPTION 13 | name POM_NAME 14 | url POM_URL 15 | licenses { 16 | license { 17 | name POM_LICENCE_NAME 18 | url POM_LICENCE_URL 19 | distribution POM_LICENCE_DIST 20 | } 21 | } 22 | scm { 23 | url POM_SCM_URL 24 | connection POM_SCM_CONNECTION 25 | developerConnection POM_SCM_DEV_CONNECTION 26 | } 27 | developers { 28 | developer { 29 | id POM_DEVELOPER_ID 30 | name POM_DEVELOPER_NAME 31 | } 32 | } 33 | } 34 | } 35 | } 36 | 37 | publications { 38 | kotlinMultiplatform { 39 | artifactId = POM_ARTIFACT_ID 40 | } 41 | 42 | jvm { 43 | artifact(javadocJar) 44 | } 45 | } 46 | 47 | repositories { 48 | maven { 49 | name 'sonatype' 50 | url 'https://oss.sonatype.org/service/local/staging/deploy/maven2/' 51 | credentials { 52 | username System.env.SONATYPE_USERNAME 53 | password System.env.SONATYPE_PASSWORD 54 | } 55 | } 56 | } 57 | } 58 | 59 | signing { 60 | def signingKey = System.env.SIGNING_KEY 61 | def signingPassword = "" 62 | useInMemoryPgpKeys(signingKey, signingPassword) 63 | publishing.publications.all { 64 | sign it 65 | } 66 | } 67 | -------------------------------------------------------------------------------- /android-perf-test/build.gradle: -------------------------------------------------------------------------------- 1 | apply plugin: 'com.android.library' 2 | apply plugin: "androidx.benchmark" 3 | apply plugin: 'kotlin-android' 4 | 5 | android { 6 | compileOptions { 7 | sourceCompatibility = 1.8 8 | targetCompatibility = 1.8 9 | } 10 | 11 | kotlinOptions { 12 | jvmTarget = "1.8" 13 | } 14 | 15 | defaultConfig { 16 | minSdkVersion 21 17 | targetSdkVersion 34 18 | compileSdk 34 19 | versionCode 1 20 | versionName "1.0" 21 | namespace "dev.andrewbailey.diff" 22 | 23 | testInstrumentationRunner 'androidx.benchmark.junit4.AndroidBenchmarkRunner' 24 | testInstrumentationRunnerArgument 'androidx.benchmark.suppressErrors', 'UNLOCKED' 25 | } 26 | 27 | signingConfigs { 28 | release { 29 | storeFile file("signing-key.jks") 30 | storePassword "password" 31 | keyAlias "key0" 32 | keyPassword "password" 33 | 34 | // Optional, specify signing versions used 35 | v1SigningEnabled true 36 | v2SigningEnabled true 37 | } 38 | } 39 | 40 | testBuildType = "release" 41 | buildTypes { 42 | debug { 43 | debuggable false 44 | minifyEnabled true 45 | proguardFiles getDefaultProguardFile("proguard-android-optimize.txt"), "benchmark-proguard-rules.pro" 46 | } 47 | release { 48 | isDefault = true 49 | debuggable false 50 | signingConfig signingConfigs.release 51 | } 52 | } 53 | } 54 | 55 | dependencies { 56 | implementation fileTree(dir: 'libs', include: ['*.jar']) 57 | implementation project(':difference') 58 | implementation "org.jetbrains.kotlin:kotlin-stdlib:$kotlin_version" 59 | testImplementation 'junit:junit:4.13.2' 60 | androidTestImplementation 'androidx.test:runner:1.6.2' 61 | androidTestImplementation 'androidx.test.ext:junit:1.2.1' 62 | androidTestImplementation "androidx.benchmark:benchmark-junit4:1.3.3" 63 | } 64 | -------------------------------------------------------------------------------- /difference/src/commonMain/kotlin/dev/andrewbailey/diff/Difference.kt: -------------------------------------------------------------------------------- 1 | @file:JvmName("Difference") 2 | 3 | package dev.andrewbailey.diff 4 | 5 | import kotlin.jvm.JvmName 6 | 7 | /** 8 | * Constructs a diff between the [original] and [updated] list inputs. The returned [DiffResult] 9 | * represents a sequence of operations which, if applied in order on the [original] list will 10 | * yield the [updated] list. The returned list always contains the minimum number of operations 11 | * required to transform the original input to the updated input. 12 | * 13 | * Optionally, move operations can be enabled or disabled by specifying [detectMoves]. If disabled, 14 | * the diff result will only include add and delete operations, which may cause the same item to 15 | * be deleted and re-inserted. If movement detection is enabled, all objects shared between the 16 | * two lists will either remain in place or be moved within the list instead of removing and 17 | * reinserting them. 18 | * 19 | * Internally, this function performs the Eugene-Myers diffing algorithm. the worst case runtime 20 | * of the algorithm takes on the order of O((M+N)×D + D log D) operations. M and N are the lengths 21 | * of the two input lists, and D is the smallest number of operations that it takes to modify the 22 | * original list into the updated one. If move detection is enabled, add another O(D²) to that 23 | * runtime. 24 | * 25 | * @param original The "before" state of the list to be diffed. For optimal performance, it is 26 | * critical that this data structure supports efficient random reads. 27 | * @param updated The "after" state of the list to be diffed. For optimal performance, it is 28 | * critical that this data structure supports efficient random reads. 29 | * @param detectMoves Whether or not to detect moved objects as such. When disabled, the returned 30 | * diff will only contain insert and delete operations. Enabled by default. 31 | * @return A [DiffResult] containing a shortest possible sequence of operations that can transform 32 | * the "before" state of the list into the "after" state of the list. 33 | */ 34 | fun differenceOf( 35 | original: List, 36 | updated: List, 37 | detectMoves: Boolean = true 38 | ) = DiffGenerator.generateDiff(original, updated, detectMoves) 39 | -------------------------------------------------------------------------------- /difference/build.gradle: -------------------------------------------------------------------------------- 1 | apply plugin: 'org.jetbrains.kotlin.multiplatform' 2 | apply plugin: 'org.jetbrains.dokka' 3 | 4 | kotlin { 5 | jvm { 6 | withJava() 7 | mavenPublication { 8 | artifactId = 'difference-jvm' 9 | } 10 | } 11 | 12 | js { 13 | browser() 14 | nodejs() 15 | } 16 | 17 | iosX64 { 18 | mavenPublication { 19 | artifactId = 'difference-ios-x64' 20 | } 21 | } 22 | iosArm64 { 23 | mavenPublication { 24 | artifactId = 'difference-ios-arm64' 25 | } 26 | } 27 | iosSimulatorArm64 { 28 | mavenPublication { 29 | artifactId = 'difference-ios-simulator-arm64' 30 | } 31 | } 32 | linuxX64 { 33 | mavenPublication { 34 | artifactId = 'difference-linux-x64' 35 | } 36 | } 37 | macosX64 { 38 | mavenPublication { 39 | artifactId = 'difference-macos-x64' 40 | } 41 | } 42 | macosArm64 { 43 | mavenPublication { 44 | artifactId = 'difference-macos-arm64' 45 | } 46 | } 47 | mingwX64 { 48 | mavenPublication { 49 | artifactId = 'difference-mingw-x64' 50 | } 51 | } 52 | 53 | sourceSets { 54 | commonMain { 55 | dependencies { 56 | implementation kotlin('stdlib-common') 57 | } 58 | } 59 | commonTest { 60 | dependencies { 61 | implementation kotlin('test-common') 62 | implementation kotlin('test-annotations-common') 63 | } 64 | } 65 | jvmMain { 66 | dependencies { 67 | implementation kotlin('stdlib-jdk8') 68 | } 69 | } 70 | jvmTest { 71 | dependencies { 72 | implementation kotlin('test') 73 | implementation kotlin('test-junit') 74 | } 75 | } 76 | jsMain { 77 | dependencies { 78 | implementation kotlin('stdlib-js') 79 | } 80 | } 81 | jsTest { 82 | dependencies { 83 | implementation kotlin('test') 84 | implementation kotlin('test-js') 85 | } 86 | } 87 | } 88 | } 89 | 90 | dokkaHtml { 91 | outputDirectory = file("$rootDir/docs/1.x") 92 | } 93 | 94 | tasks.register('javadocJar', Jar) { 95 | dependsOn dokkaHtml 96 | archiveClassifier = 'javadoc' 97 | from file("$rootDir/docs/1.x") 98 | } 99 | 100 | apply from: "$rootDir/gradle/publish.gradle" 101 | -------------------------------------------------------------------------------- /difference/src/jvmTest/kotlin/dev/andrewbailey/diff/DiffReceiverTest.kt: -------------------------------------------------------------------------------- 1 | package dev.andrewbailey.diff 2 | 3 | import kotlin.random.Random 4 | import kotlin.test.assertEquals 5 | import org.junit.Test 6 | 7 | class DiffReceiverTest { 8 | 9 | @Test 10 | fun `applyDiff on original value returns updated value`() { 11 | val original = generateList() 12 | val updated = generateModifiedList(original) 13 | 14 | val diff = differenceOf(original, updated, false) 15 | 16 | val appliedResult = original.toMutableList() 17 | 18 | object : DiffReceiver() { 19 | override fun remove(index: Int) { 20 | appliedResult.removeAt(index) 21 | } 22 | 23 | override fun insert(item: String, index: Int) { 24 | appliedResult.add(index, item) 25 | } 26 | 27 | override fun move(oldIndex: Int, newIndex: Int) { 28 | appliedResult.add( 29 | element = appliedResult.removeAt(oldIndex), 30 | index = if (newIndex < oldIndex) { 31 | newIndex 32 | } else { 33 | newIndex - 1 34 | } 35 | ) 36 | } 37 | }.applyDiff(diff) 38 | 39 | assertEquals( 40 | message = "Applying the diff to the input did not yield the updated value.", 41 | expected = updated, 42 | actual = appliedResult 43 | ) 44 | } 45 | 46 | private fun generateList(): List { 47 | val random = Random(319163183995026179) 48 | return List(500) { random.nextInt().toString() } 49 | } 50 | 51 | private fun generateModifiedList(originalData: List): List { 52 | val random = Random(3260128955430943624) 53 | val modifiedList = originalData.toMutableList() 54 | 55 | repeat(250) { 56 | when (random.nextInt(0, 3)) { 57 | 0 -> { // Delete 58 | modifiedList.removeAt( 59 | index = random.nextInt(0, modifiedList.size) 60 | ) 61 | } 62 | 1 -> { // Insert 63 | modifiedList.add( 64 | index = random.nextInt(0, modifiedList.size + 1), 65 | element = random.nextInt().toString() 66 | ) 67 | } 68 | 2 -> { // Move 69 | val item = modifiedList.removeAt( 70 | index = random.nextInt(0, modifiedList.size) 71 | ) 72 | modifiedList.add( 73 | index = random.nextInt(0, modifiedList.size + 1), 74 | element = item 75 | ) 76 | } 77 | } 78 | } 79 | 80 | return modifiedList 81 | } 82 | } 83 | -------------------------------------------------------------------------------- /difference/src/jvmMain/kotlin/dev/andrewbailey/diff/DiffReceiver.kt: -------------------------------------------------------------------------------- 1 | package dev.andrewbailey.diff 2 | 3 | import dev.andrewbailey.diff.DiffOperation.Add 4 | import dev.andrewbailey.diff.DiffOperation.AddAll 5 | import dev.andrewbailey.diff.DiffOperation.Move 6 | import dev.andrewbailey.diff.DiffOperation.MoveRange 7 | import dev.andrewbailey.diff.DiffOperation.Remove 8 | import dev.andrewbailey.diff.DiffOperation.RemoveRange 9 | import dev.andrewbailey.diff.impl.fastForEach 10 | import dev.andrewbailey.diff.impl.fastForEachIndexed 11 | 12 | /** 13 | * This class serves as a convenience class for Java users who may find it tedious to call 14 | * [DiffResult.applyDiff], since Java users have to rely on Kotlin's `FunctionN` interfaces and 15 | * don't have access to Kotlin's named arguments and default arguments. 16 | * 17 | * If you're using Difference directly in Kotlin, then there's no reason for you to use this class 18 | * since the [DiffResult.applyDiff] is a more idiomatic way to use a difference result. 19 | */ 20 | abstract class DiffReceiver { 21 | 22 | fun applyDiff(diff: DiffResult) { 23 | diff.operations.fastForEach { operation -> 24 | when (operation) { 25 | is Remove -> { 26 | remove(operation.index) 27 | } 28 | is RemoveRange -> { 29 | removeRange(operation.startIndex, operation.endIndex) 30 | } 31 | is Add -> { 32 | insert(operation.item, operation.index) 33 | } 34 | is AddAll -> { 35 | insertAll(operation.items, operation.index) 36 | } 37 | is Move -> { 38 | move(operation.fromIndex, operation.toIndex) 39 | } 40 | is MoveRange -> { 41 | moveRange(operation.fromIndex, operation.toIndex, operation.itemCount) 42 | } 43 | } 44 | } 45 | } 46 | 47 | abstract fun remove(index: Int) 48 | 49 | open fun removeRange(start: Int, end: Int) { 50 | repeat(times = end - start) { 51 | remove(start) 52 | } 53 | } 54 | 55 | abstract fun insert(item: T, index: Int) 56 | 57 | open fun insertAll(items: List, index: Int) { 58 | items.fastForEachIndexed { itemIndex, item -> 59 | insert(item, index + itemIndex) 60 | } 61 | } 62 | 63 | open fun move(oldIndex: Int, newIndex: Int): Unit = throw UnsupportedOperationException( 64 | "The received diff included move operations, but this receiver does not support moving " + 65 | "elements. You should either disable movement detection when generating the " + 66 | "diff, or override the `DiffReceiver.move()` function." 67 | ) 68 | 69 | open fun moveRange( 70 | oldIndex: Int, 71 | newIndex: Int, 72 | count: Int 73 | ) { 74 | when { 75 | newIndex < oldIndex -> { 76 | (0 until count).forEach { item -> 77 | move(oldIndex + item, newIndex + item) 78 | } 79 | } 80 | newIndex > oldIndex -> { 81 | repeat(count) { 82 | move(oldIndex, newIndex) 83 | } 84 | } 85 | } 86 | } 87 | } 88 | -------------------------------------------------------------------------------- /gradlew.bat: -------------------------------------------------------------------------------- 1 | @rem 2 | @rem Copyright 2015 the original author or authors. 3 | @rem 4 | @rem Licensed under the Apache License, Version 2.0 (the "License"); 5 | @rem you may not use this file except in compliance with the License. 6 | @rem You may obtain a copy of the License at 7 | @rem 8 | @rem https://www.apache.org/licenses/LICENSE-2.0 9 | @rem 10 | @rem Unless required by applicable law or agreed to in writing, software 11 | @rem distributed under the License is distributed on an "AS IS" BASIS, 12 | @rem WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. 13 | @rem See the License for the specific language governing permissions and 14 | @rem limitations under the License. 15 | @rem 16 | 17 | @if "%DEBUG%" == "" @echo off 18 | @rem ########################################################################## 19 | @rem 20 | @rem Gradle startup script for Windows 21 | @rem 22 | @rem ########################################################################## 23 | 24 | @rem Set local scope for the variables with windows NT shell 25 | if "%OS%"=="Windows_NT" setlocal 26 | 27 | set DIRNAME=%~dp0 28 | if "%DIRNAME%" == "" set DIRNAME=. 29 | set APP_BASE_NAME=%~n0 30 | set APP_HOME=%DIRNAME% 31 | 32 | @rem Resolve any "." and ".." in APP_HOME to make it shorter. 33 | for %%i in ("%APP_HOME%") do set APP_HOME=%%~fi 34 | 35 | @rem Add default JVM options here. You can also use JAVA_OPTS and GRADLE_OPTS to pass JVM options to this script. 36 | set DEFAULT_JVM_OPTS="-Xmx64m" "-Xms64m" 37 | 38 | @rem Find java.exe 39 | if defined JAVA_HOME goto findJavaFromJavaHome 40 | 41 | set JAVA_EXE=java.exe 42 | %JAVA_EXE% -version >NUL 2>&1 43 | if "%ERRORLEVEL%" == "0" goto init 44 | 45 | echo. 46 | echo ERROR: JAVA_HOME is not set and no 'java' command could be found in your PATH. 47 | echo. 48 | echo Please set the JAVA_HOME variable in your environment to match the 49 | echo location of your Java installation. 50 | 51 | goto fail 52 | 53 | :findJavaFromJavaHome 54 | set JAVA_HOME=%JAVA_HOME:"=% 55 | set JAVA_EXE=%JAVA_HOME%/bin/java.exe 56 | 57 | if exist "%JAVA_EXE%" goto init 58 | 59 | echo. 60 | echo ERROR: JAVA_HOME is set to an invalid directory: %JAVA_HOME% 61 | echo. 62 | echo Please set the JAVA_HOME variable in your environment to match the 63 | echo location of your Java installation. 64 | 65 | goto fail 66 | 67 | :init 68 | @rem Get command-line arguments, handling Windows variants 69 | 70 | if not "%OS%" == "Windows_NT" goto win9xME_args 71 | 72 | :win9xME_args 73 | @rem Slurp the command line arguments. 74 | set CMD_LINE_ARGS= 75 | set _SKIP=2 76 | 77 | :win9xME_args_slurp 78 | if "x%~1" == "x" goto execute 79 | 80 | set CMD_LINE_ARGS=%* 81 | 82 | :execute 83 | @rem Setup the command line 84 | 85 | set CLASSPATH=%APP_HOME%\gradle\wrapper\gradle-wrapper.jar 86 | 87 | 88 | @rem Execute Gradle 89 | "%JAVA_EXE%" %DEFAULT_JVM_OPTS% %JAVA_OPTS% %GRADLE_OPTS% "-Dorg.gradle.appname=%APP_BASE_NAME%" -classpath "%CLASSPATH%" org.gradle.wrapper.GradleWrapperMain %CMD_LINE_ARGS% 90 | 91 | :end 92 | @rem End local scope for the variables with windows NT shell 93 | if "%ERRORLEVEL%"=="0" goto mainEnd 94 | 95 | :fail 96 | rem Set variable GRADLE_EXIT_CONSOLE if you need the _script_ return code instead of 97 | rem the _cmd.exe /c_ return code! 98 | if not "" == "%GRADLE_EXIT_CONSOLE%" exit 1 99 | exit /b 1 100 | 101 | :mainEnd 102 | if "%OS%"=="Windows_NT" endlocal 103 | 104 | :omega 105 | -------------------------------------------------------------------------------- /android-perf-test/src/androidTest/java/dev/andrewbailey/diff/DiffBenchmarkTest.kt: -------------------------------------------------------------------------------- 1 | package dev.andrewbailey.diff 2 | 3 | import androidx.benchmark.junit4.BenchmarkRule 4 | import androidx.benchmark.junit4.measureRepeated 5 | import androidx.test.ext.junit.runners.AndroidJUnit4 6 | import kotlin.random.Random 7 | import org.junit.Rule 8 | import org.junit.Test 9 | import org.junit.runner.RunWith 10 | 11 | @RunWith(AndroidJUnit4::class) 12 | class DiffBenchmarkTest { 13 | 14 | @get:Rule 15 | val benchmarkRule = BenchmarkRule() 16 | 17 | @Test 18 | fun verySmallDiffWithoutMoves() = runBenchmarkScenario( 19 | seed = 4459894567797046261, 20 | numberOfItems = 100, 21 | numberOfOperations = 10, 22 | detectMoves = false 23 | ) 24 | 25 | @Test 26 | fun verySmallDiffWithMoves() = runBenchmarkScenario( 27 | seed = 4459894567797046261, 28 | numberOfItems = 100, 29 | numberOfOperations = 10, 30 | detectMoves = true 31 | ) 32 | 33 | @Test 34 | fun smallDiffWithoutMoves() = runBenchmarkScenario( 35 | seed = -5791837575014754264, 36 | numberOfItems = 1000, 37 | numberOfOperations = 100, 38 | detectMoves = false 39 | ) 40 | 41 | @Test 42 | fun smallDiffWithMoves() = runBenchmarkScenario( 43 | seed = -5791837575014754264, 44 | numberOfItems = 1000, 45 | numberOfOperations = 100, 46 | detectMoves = true 47 | ) 48 | 49 | @Test 50 | fun mediumDiffWithoutMoves() = runBenchmarkScenario( 51 | seed = -797670750388632780, 52 | numberOfItems = 5000, 53 | numberOfOperations = 500, 54 | detectMoves = false 55 | ) 56 | 57 | @Test 58 | fun mediumDiffWithMoves() = runBenchmarkScenario( 59 | seed = -797670750388632780, 60 | numberOfItems = 5000, 61 | numberOfOperations = 500, 62 | detectMoves = true 63 | ) 64 | 65 | @Test 66 | fun largeDiffWithoutMoves() = runBenchmarkScenario( 67 | seed = 8208385239328551378, 68 | numberOfItems = 10000, 69 | numberOfOperations = 1000, 70 | detectMoves = false 71 | ) 72 | 73 | @Test 74 | fun largeDiffWithMoves() = runBenchmarkScenario( 75 | seed = 8208385239328551378, 76 | numberOfItems = 10000, 77 | numberOfOperations = 1000, 78 | detectMoves = true 79 | ) 80 | 81 | private fun runBenchmarkScenario( 82 | seed: Long, 83 | numberOfItems: Int, 84 | numberOfOperations: Int, 85 | detectMoves: Boolean 86 | ) { 87 | val original = generateList( 88 | numberOfItems = numberOfItems, 89 | seed = seed 90 | ) 91 | 92 | val updated = generateModifiedList( 93 | originalData = original, 94 | numberOfOperations = numberOfOperations, 95 | seed = seed 96 | ) 97 | 98 | benchmarkRule.measureRepeated { 99 | differenceOf( 100 | original = original, 101 | updated = updated, 102 | detectMoves = detectMoves 103 | ) 104 | } 105 | } 106 | 107 | private fun generateList(numberOfItems: Int, seed: Long): List { 108 | val random = Random(seed) 109 | return List(numberOfItems) { random.nextInt() } 110 | } 111 | 112 | private fun generateModifiedList( 113 | originalData: List, 114 | numberOfOperations: Int, 115 | seed: Long 116 | ): List { 117 | val random = Random(seed) 118 | val modifiedList = originalData.toMutableList() 119 | 120 | repeat(numberOfOperations) { 121 | when (random.nextInt(0, 3)) { 122 | 0 -> { // Delete 123 | modifiedList.removeAt( 124 | index = random.nextInt(0, modifiedList.size) 125 | ) 126 | } 127 | 1 -> { // Insert 128 | modifiedList.add( 129 | index = random.nextInt(0, modifiedList.size + 1), 130 | element = random.nextInt() 131 | ) 132 | } 133 | 2 -> { // Move 134 | val item = modifiedList.removeAt( 135 | index = random.nextInt(0, modifiedList.size) 136 | ) 137 | modifiedList.add( 138 | index = random.nextInt(0, modifiedList.size + 1), 139 | element = item 140 | ) 141 | } 142 | } 143 | } 144 | 145 | return modifiedList 146 | } 147 | } 148 | -------------------------------------------------------------------------------- /difference/src/commonTest/kotlin/dev/andrewbailey/diff/impl/MyersDiffAlgorithmTest.kt: -------------------------------------------------------------------------------- 1 | package dev.andrewbailey.diff.impl 2 | 3 | import dev.andrewbailey.diff.impl.MyersDiffOperation.Delete 4 | import dev.andrewbailey.diff.impl.MyersDiffOperation.Insert 5 | import dev.andrewbailey.diff.impl.MyersDiffOperation.Skip 6 | import kotlin.test.Test 7 | import kotlin.test.assertEquals 8 | 9 | class MyersDiffAlgorithmTest { 10 | 11 | @Test 12 | fun generateDiff_withEmptyInputs_returnsEmptySequence() { 13 | assertEquals( 14 | expected = emptyList(), 15 | actual = MyersDiffAlgorithm( 16 | original = emptyList(), 17 | updated = emptyList() 18 | ).generateDiff().toList() 19 | ) 20 | } 21 | 22 | @Test 23 | fun generateDiff_withEmptyStart_returnsAdditions() { 24 | assertEquals( 25 | expected = listOf(Insert("A"), Insert("B"), Insert("C")), 26 | actual = MyersDiffAlgorithm( 27 | original = emptyList(), 28 | updated = listOf("A", "B", "C") 29 | ).generateDiff().toList() 30 | ) 31 | } 32 | 33 | @Test 34 | fun generateDiff_withEmptyEnd_returnsDeletions() { 35 | assertEquals( 36 | expected = listOf(Delete, Delete, Delete), 37 | actual = MyersDiffAlgorithm( 38 | original = listOf("A", "B", "C"), 39 | updated = emptyList() 40 | ).generateDiff().toList() 41 | ) 42 | } 43 | 44 | @Test 45 | fun generateDiff_withSameStartAndEnd_returnsSkips() { 46 | assertEquals( 47 | expected = listOf(Skip, Skip, Skip, Skip), 48 | actual = MyersDiffAlgorithm( 49 | original = listOf("A", "B", "C", "D"), 50 | updated = listOf("A", "B", "C", "D") 51 | ).generateDiff().toList() 52 | ) 53 | } 54 | 55 | @Test 56 | fun generateDiff_withSimpleExample() { 57 | val original = "ABCABAC".toList() 58 | val updated = "CBABAC".toList() 59 | 60 | val diff = MyersDiffAlgorithm(original, updated).generateDiff().toList() 61 | 62 | assertEquals( 63 | expected = listOf( 64 | Delete, 65 | Delete, 66 | Skip, 67 | Insert(value = 'B'), 68 | Skip, 69 | Skip, 70 | Skip, 71 | Skip 72 | ), 73 | actual = diff 74 | ) 75 | } 76 | 77 | @Test 78 | fun generateDiff_withDnaExample() { 79 | val original = "tgtcgctctcaagatggcgtcttattacgaaaggagccagtccgggttgc".toList() 80 | val updated = "ggctggggttttcgcacggcgctccctccgcggttgtatctcaggcgaca".toList() 81 | 82 | val diff = MyersDiffAlgorithm(original, updated).generateDiff() 83 | 84 | assertEquals( 85 | message = "Applying the diff to the input did not yield the updated value.", 86 | expected = updated, 87 | actual = applyDiff(original, diff) 88 | ) 89 | 90 | assertEquals( 91 | message = "The number of operations in the diff did not match the expected value.", 92 | expected = 40, 93 | actual = diff.count { it !is Skip } 94 | ) 95 | } 96 | 97 | @Test 98 | fun generateDiff_withLoremIpsumExample() { 99 | val original = ( 100 | "Lorem ipsum dolor sit amet, consectetur adipiscing elit, sed do eiusmod " + 101 | "tempor incididunt ut labore et dolore magna aliqua. Quis auctor elit sed " + 102 | "vulputate mi sit amet mauris commodo. Nec dui nunc mattis enim ut tellus " + 103 | "elementum. Ultricies integer quis auctor elit sed vulputate mi sit amet. " + 104 | "Ullamcorper velit sed ullamcorper morbi tincidunt." 105 | ).lowercase().split(" ") 106 | val updated = ( 107 | "Malesuada fames ac turpis egestas. Varius sit amet mattis vulputate enim. Nisl " + 108 | "nisi scelerisque eu ultrices vitae auctor eu augue. Sit amet volutpat consequat " + 109 | "mauris nunc congue nisi vitae. Egestas purus viverra accumsan in nisl nisi " + 110 | "scelerisque eu. Lobortis elementum nibh tellus molestie. Nulla at volutpat diam " + 111 | "ut venenatis tellus in metus. Ac turpis egestas sed tempus urna et pharetra " + 112 | "pharetra massa. Etiam sit amet nisl purus in mollis. Vivamus arcu felis " + 113 | "bibendum ut tristique et egestas quis. Vestibulum lorem sed risus ultricies " + 114 | "tristique nulla aliquet. Nunc scelerisque viverra mauris in aliquam. Facilisis " + 115 | "magna etiam tempor orci eu lobortis elementum nibh. Purus faucibus ornare " + 116 | "suspendisse sed nisi. Dui accumsan sit amet nulla." 117 | ).lowercase().split(" ") 118 | 119 | val diff = MyersDiffAlgorithm(original, updated).generateDiff() 120 | 121 | assertEquals( 122 | message = "Applying the diff to the input did not yield the updated value.", 123 | expected = updated, 124 | actual = applyDiff(original, diff) 125 | ) 126 | 127 | assertEquals( 128 | message = "The number of operations in the diff did not match the expected value.", 129 | expected = 143, 130 | actual = diff.count { it !is Skip } 131 | ) 132 | } 133 | 134 | private fun applyDiff(original: List, diff: List>): List = 135 | original.toMutableList().apply { 136 | var index = 0 137 | diff.forEach { operation -> 138 | when (operation) { 139 | is Skip -> index++ 140 | is Insert -> add(index++, operation.value) 141 | is Delete -> removeAt(index) 142 | } 143 | } 144 | } 145 | } 146 | -------------------------------------------------------------------------------- /difference/src/commonMain/kotlin/dev/andrewbailey/diff/DiffOperation.kt: -------------------------------------------------------------------------------- 1 | package dev.andrewbailey.diff 2 | 3 | /** 4 | * An individual operation contained in a [DiffResult] between two collections. 5 | */ 6 | sealed class DiffOperation { 7 | 8 | /** 9 | * An operation in a diff to indicate the removal of an object between the before and after 10 | * states of the collections. 11 | * 12 | * @param index The index of the removal, expressed as the index to remove from the collection 13 | * if you had applied all previous operations in this diff. 14 | * @param item The item that was removed from the original collection 15 | */ 16 | data class Remove( 17 | val index: Int, 18 | val item: T 19 | ) : DiffOperation() 20 | 21 | /** 22 | * An operation in a diff to indicate the removal of a range of objects between the before and 23 | * after states of the collections. 24 | * 25 | * @param startIndex The start index of the removal (inclusive), expressed as the index to 26 | * remove from the collection if you had applied all previous operations in this diff. 27 | * @param endIndex The end index of the removal (exclusive), expressed as the index to remove 28 | * from the collection if you had applied all previous operations in this diff. 29 | */ 30 | data class RemoveRange( 31 | val startIndex: Int, 32 | val endIndex: Int 33 | ) : DiffOperation() 34 | 35 | /** 36 | * An operation in a diff to indicate the insertion of an object between the before and after 37 | * states of the collections. 38 | * 39 | * @param index The index of the insertion, expressed as the index to add the given object to 40 | * the collection if you had applied all previous operations in this diff. 41 | * @param item The object to insert at the specified location. 42 | */ 43 | data class Add( 44 | val index: Int, 45 | val item: T 46 | ) : DiffOperation() 47 | 48 | /** 49 | * An operation in a diff to indicate the insertion of several objects between the before and 50 | * after states of the collections. 51 | * 52 | * @param index The index of the insertions, expressed as the index to add the given object to 53 | * the collection if you had applied all previous operations in this diff. The first object in 54 | * the given items list should be inserted at this index, with all subsequent operations 55 | * following consecutively. 56 | * @param items The objects to insert at the specified location. Always contains at least two 57 | * values. 58 | */ 59 | data class AddAll( 60 | val index: Int, 61 | val items: List 62 | ) : DiffOperation() 63 | 64 | /** 65 | * An operation in a diff to indicate the movement of one object to a new index between the 66 | * before and after states of the collections. Only included in a diff if movement detection 67 | * was enabled. 68 | * 69 | * The indices expressed in this object assume applying the move operation as an atomic 70 | * operation to a collection that has had all other operations in this diff applied. To 71 | * implement as a remove-then-add call, correct the [toIndex] as shown: 72 | * 73 | * ```kotlin 74 | * add(removeAt(fromIndex), if (toIndex < fromIndex) toIndex else toIndex - 1) 75 | * ``` 76 | * 77 | * @param fromIndex The index of the object as it would appear if you had applied all previous 78 | * operations in this diff. 79 | * @param toIndex The new index that this object should appear at, not accounting for the 80 | * deletion of this object from its current location. 81 | */ 82 | data class Move( 83 | val fromIndex: Int, 84 | val toIndex: Int 85 | ) : DiffOperation() 86 | 87 | /** 88 | * An operation in a diff to indicate the movement of a range of objects to a new location 89 | * between the before and after states of the collections. Only included in a diff if movement 90 | * detection was enabled. 91 | * 92 | * The indices expressed in this object assume applying the move operation as an atomic 93 | * operation to a collection that has had all other operations in this diff applied. To 94 | * implement as a removeRange-then-add call, correct the [toIndex] as shown: 95 | * 96 | * ```kotlin 97 | * addAll( 98 | * values = removeRange(fromIndex, itemCount), 99 | * index = if (toIndex < fromIndex) toIndex else toIndex - 1 100 | * ) 101 | * ``` 102 | * 103 | * Alternatively, to implement as a loop of remove-then-add calls, correct the destination 104 | * indices as shown: 105 | * 106 | * ```kotlin 107 | * when { 108 | * toIndex < fromIndex -> { 109 | * (0 until count).forEach { item -> 110 | * val oldIndex = fromIndex + item 111 | * val newIndex = toIndex + item 112 | * add( 113 | * item = removeAt(oldIndex), 114 | * index = if (newIndex < oldIndex) newIndex else newIndex - 1 115 | * ) 116 | * } 117 | * } 118 | * toIndex > fromIndex -> { 119 | * repeat(count) { 120 | * add( 121 | * item = removeAt(fromIndex), 122 | * index = newIndex 123 | * ) 124 | * } 125 | * } 126 | * } 127 | * ``` 128 | * 129 | * @param fromIndex The index of the object as it would appear if you had applied all previous 130 | * operations in this diff. 131 | * @param toIndex The new index that this object should appear at, not accounting for the 132 | * deletion of this object from its current location. 133 | */ 134 | data class MoveRange( 135 | val fromIndex: Int, 136 | val toIndex: Int, 137 | val itemCount: Int 138 | ) : DiffOperation() 139 | } 140 | -------------------------------------------------------------------------------- /gradlew: -------------------------------------------------------------------------------- 1 | #!/usr/bin/env sh 2 | 3 | # 4 | # Copyright 2015 the original author or authors. 5 | # 6 | # Licensed under the Apache License, Version 2.0 (the "License"); 7 | # you may not use this file except in compliance with the License. 8 | # You may obtain a copy of the License at 9 | # 10 | # https://www.apache.org/licenses/LICENSE-2.0 11 | # 12 | # Unless required by applicable law or agreed to in writing, software 13 | # distributed under the License is distributed on an "AS IS" BASIS, 14 | # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. 15 | # See the License for the specific language governing permissions and 16 | # limitations under the License. 17 | # 18 | 19 | ############################################################################## 20 | ## 21 | ## Gradle start up script for UN*X 22 | ## 23 | ############################################################################## 24 | 25 | # Attempt to set APP_HOME 26 | # Resolve links: $0 may be a link 27 | PRG="$0" 28 | # Need this for relative symlinks. 29 | while [ -h "$PRG" ] ; do 30 | ls=`ls -ld "$PRG"` 31 | link=`expr "$ls" : '.*-> \(.*\)$'` 32 | if expr "$link" : '/.*' > /dev/null; then 33 | PRG="$link" 34 | else 35 | PRG=`dirname "$PRG"`"/$link" 36 | fi 37 | done 38 | SAVED="`pwd`" 39 | cd "`dirname \"$PRG\"`/" >/dev/null 40 | APP_HOME="`pwd -P`" 41 | cd "$SAVED" >/dev/null 42 | 43 | APP_NAME="Gradle" 44 | APP_BASE_NAME=`basename "$0"` 45 | 46 | # Add default JVM options here. You can also use JAVA_OPTS and GRADLE_OPTS to pass JVM options to this script. 47 | DEFAULT_JVM_OPTS='"-Xmx64m" "-Xms64m"' 48 | 49 | # Use the maximum available, or set MAX_FD != -1 to use that value. 50 | MAX_FD="maximum" 51 | 52 | warn () { 53 | echo "$*" 54 | } 55 | 56 | die () { 57 | echo 58 | echo "$*" 59 | echo 60 | exit 1 61 | } 62 | 63 | # OS specific support (must be 'true' or 'false'). 64 | cygwin=false 65 | msys=false 66 | darwin=false 67 | nonstop=false 68 | case "`uname`" in 69 | CYGWIN* ) 70 | cygwin=true 71 | ;; 72 | Darwin* ) 73 | darwin=true 74 | ;; 75 | MINGW* ) 76 | msys=true 77 | ;; 78 | NONSTOP* ) 79 | nonstop=true 80 | ;; 81 | esac 82 | 83 | CLASSPATH=$APP_HOME/gradle/wrapper/gradle-wrapper.jar 84 | 85 | 86 | # Determine the Java command to use to start the JVM. 87 | if [ -n "$JAVA_HOME" ] ; then 88 | if [ -x "$JAVA_HOME/jre/sh/java" ] ; then 89 | # IBM's JDK on AIX uses strange locations for the executables 90 | JAVACMD="$JAVA_HOME/jre/sh/java" 91 | else 92 | JAVACMD="$JAVA_HOME/bin/java" 93 | fi 94 | if [ ! -x "$JAVACMD" ] ; then 95 | die "ERROR: JAVA_HOME is set to an invalid directory: $JAVA_HOME 96 | 97 | Please set the JAVA_HOME variable in your environment to match the 98 | location of your Java installation." 99 | fi 100 | else 101 | JAVACMD="java" 102 | which java >/dev/null 2>&1 || die "ERROR: JAVA_HOME is not set and no 'java' command could be found in your PATH. 103 | 104 | Please set the JAVA_HOME variable in your environment to match the 105 | location of your Java installation." 106 | fi 107 | 108 | # Increase the maximum file descriptors if we can. 109 | if [ "$cygwin" = "false" -a "$darwin" = "false" -a "$nonstop" = "false" ] ; then 110 | MAX_FD_LIMIT=`ulimit -H -n` 111 | if [ $? -eq 0 ] ; then 112 | if [ "$MAX_FD" = "maximum" -o "$MAX_FD" = "max" ] ; then 113 | MAX_FD="$MAX_FD_LIMIT" 114 | fi 115 | ulimit -n $MAX_FD 116 | if [ $? -ne 0 ] ; then 117 | warn "Could not set maximum file descriptor limit: $MAX_FD" 118 | fi 119 | else 120 | warn "Could not query maximum file descriptor limit: $MAX_FD_LIMIT" 121 | fi 122 | fi 123 | 124 | # For Darwin, add options to specify how the application appears in the dock 125 | if $darwin; then 126 | GRADLE_OPTS="$GRADLE_OPTS \"-Xdock:name=$APP_NAME\" \"-Xdock:icon=$APP_HOME/media/gradle.icns\"" 127 | fi 128 | 129 | # For Cygwin or MSYS, switch paths to Windows format before running java 130 | if [ "$cygwin" = "true" -o "$msys" = "true" ] ; then 131 | APP_HOME=`cygpath --path --mixed "$APP_HOME"` 132 | CLASSPATH=`cygpath --path --mixed "$CLASSPATH"` 133 | 134 | JAVACMD=`cygpath --unix "$JAVACMD"` 135 | 136 | # We build the pattern for arguments to be converted via cygpath 137 | ROOTDIRSRAW=`find -L / -maxdepth 1 -mindepth 1 -type d 2>/dev/null` 138 | SEP="" 139 | for dir in $ROOTDIRSRAW ; do 140 | ROOTDIRS="$ROOTDIRS$SEP$dir" 141 | SEP="|" 142 | done 143 | OURCYGPATTERN="(^($ROOTDIRS))" 144 | # Add a user-defined pattern to the cygpath arguments 145 | if [ "$GRADLE_CYGPATTERN" != "" ] ; then 146 | OURCYGPATTERN="$OURCYGPATTERN|($GRADLE_CYGPATTERN)" 147 | fi 148 | # Now convert the arguments - kludge to limit ourselves to /bin/sh 149 | i=0 150 | for arg in "$@" ; do 151 | CHECK=`echo "$arg"|egrep -c "$OURCYGPATTERN" -` 152 | CHECK2=`echo "$arg"|egrep -c "^-"` ### Determine if an option 153 | 154 | if [ $CHECK -ne 0 ] && [ $CHECK2 -eq 0 ] ; then ### Added a condition 155 | eval `echo args$i`=`cygpath --path --ignore --mixed "$arg"` 156 | else 157 | eval `echo args$i`="\"$arg\"" 158 | fi 159 | i=`expr $i + 1` 160 | done 161 | case $i in 162 | 0) set -- ;; 163 | 1) set -- "$args0" ;; 164 | 2) set -- "$args0" "$args1" ;; 165 | 3) set -- "$args0" "$args1" "$args2" ;; 166 | 4) set -- "$args0" "$args1" "$args2" "$args3" ;; 167 | 5) set -- "$args0" "$args1" "$args2" "$args3" "$args4" ;; 168 | 6) set -- "$args0" "$args1" "$args2" "$args3" "$args4" "$args5" ;; 169 | 7) set -- "$args0" "$args1" "$args2" "$args3" "$args4" "$args5" "$args6" ;; 170 | 8) set -- "$args0" "$args1" "$args2" "$args3" "$args4" "$args5" "$args6" "$args7" ;; 171 | 9) set -- "$args0" "$args1" "$args2" "$args3" "$args4" "$args5" "$args6" "$args7" "$args8" ;; 172 | esac 173 | fi 174 | 175 | # Escape application args 176 | save () { 177 | for i do printf %s\\n "$i" | sed "s/'/'\\\\''/g;1s/^/'/;\$s/\$/' \\\\/" ; done 178 | echo " " 179 | } 180 | APP_ARGS=`save "$@"` 181 | 182 | # Collect all arguments for the java command, following the shell quoting and substitution rules 183 | eval set -- $DEFAULT_JVM_OPTS $JAVA_OPTS $GRADLE_OPTS "\"-Dorg.gradle.appname=$APP_BASE_NAME\"" -classpath "\"$CLASSPATH\"" org.gradle.wrapper.GradleWrapperMain "$APP_ARGS" 184 | 185 | exec "$JAVACMD" "$@" 186 | -------------------------------------------------------------------------------- /README.md: -------------------------------------------------------------------------------- 1 | # Difference 2 | Difference is a Kotlin multiplatform differencing library. 3 | Given two lists, Difference will compute the insert and delete operations required to transform the starting list into the final list. 4 | Difference can also optionally detect items that have moved to new indices in the list. 5 | 6 | Behind the scenes, Difference uses Eugene Myer's Differencing Algorithm. 7 | This is the same algorithm used by Android's [DiffUtil](https://developer.android.com/reference/androidx/recyclerview/widget/DiffUtil) class, which you may be familiar with if you're an Android developer. 8 | Difference is very similar to Android's DiffUtil, but is completely platform agnostic and has more receiver-agnostic APIs to consume the diff result. 9 | 10 | ## Setup 11 | Gradle can automatically resolve which variation of Difference is appropriate for the platform and architecture you're compiling for. 12 | To use the universal dependency, add this dependency to your module's `build.gradle`: 13 | 14 | ```groovy 15 | dependencies { 16 | implementation 'dev.andrewbailey.difference:difference:1.1.1' 17 | } 18 | ``` 19 | 20 | If you want to explicitly specify which platform variant of the library you want to depend on, you can use any of the following dependencies as appropriate: 21 | 22 | ``` 23 | dev.andrewbailey.difference:difference-jvm:1.1.1 24 | dev.andrewbailey.difference:difference-js:1.1.1 25 | dev.andrewbailey.difference:difference-linux-x64:1.1.1 26 | dev.andrewbailey.difference:difference-macos-x64:1.1.1 27 | dev.andrewbailey.difference:difference-macos-arm64:1.1.1 28 | dev.andrewbailey.difference:difference-ios-x64:1.1.1 29 | dev.andrewbailey.difference:difference-ios-arm64:1.1.1 30 | dev.andrewbailey.difference:difference-ios-simulator-arm64:1.1.1 31 | dev.andrewbailey.difference:difference-mingw-x64:1.1.1 32 | ``` 33 | 34 | ## Generating a diff 35 | To generate a diff, you can call `differenceOf` with the following arguments: 36 | 37 | ```kotlin 38 | val listOfBffs = listOf("Merengue", "Sherb", "Tammy") 39 | val revisedListOfBffs = listOf("Merengue", "Sprinkle", "Sherb") 40 | 41 | val diff = differenceOf( 42 | original = listOfBffs, 43 | updated = revisedListOfBffs, 44 | detectMoves = false 45 | ) 46 | ``` 47 | 48 | In Java, you can write this code as: 49 | 50 | ```java 51 | List listOfBffs = Arrays.asList("Merengue", "Sherb", "Tammy"); 52 | List revisedListOfBffs = Arrays.asList("Merengue", "Sprinkle", "Sherb"); 53 | 54 | DiffResult diff = Difference.differenceOf(listOfBffs, revisedListOfBffs, false); 55 | ``` 56 | 57 | The diff that will be generated for this input will look like this: 58 | ``` 59 | Insert(index = 1, item = "Sprinkle") 60 | Remove(index = 3) 61 | ``` 62 | 63 | Please keep in mind that calling `differenceOf` is an expensive operation, so it's recommended to offload this call to a background thread. 64 | See the [Performance](#performance) section for more info. 65 | 66 | ## Using a `DiffResult` 67 | 68 | `differenceOf` returns a `DiffResult` object, typed based on the input lists. 69 | To consume a diff, you can call `DiffResult.applyDiff`. 70 | There are several overloads that can increase the performance of how your diff is applied, but the most basic call looks something like this: 71 | 72 | ```kotlin 73 | ... 74 | 75 | val diff = differenceOf( 76 | original = listOfBffs, 77 | updated = revisedListOfBffs, 78 | detectMoves = true 79 | ) 80 | 81 | // When `applyDiff` returns, `output` will be equal to `revisedListOfBffs` 82 | val output = listOfBffs.toMutableList() 83 | diff.applyDiff( 84 | remove = { index: Int -> 85 | output.removeAt(index) 86 | }, 87 | insert = { item: T, index: Int -> 88 | output.add(index, item) 89 | }, 90 | move = { oldIndex: Int, newIndex: Int -> 91 | // You can leave this blank if you set `detectMoves` to false 92 | output.add( 93 | element = removeAt(oldIndex), 94 | index = if (newIndex < oldIndex) { 95 | newIndex 96 | } else { 97 | newIndex - 1 98 | } 99 | ) 100 | } 101 | ) 102 | ``` 103 | 104 | If you're using Difference in Java, using `applyDiff` can be a bit awkward to use because it exposes Kotlin's `FunctionN` interfaces, named parameters, and default arguments to be easy to call. 105 | You can alternatively use `DiffReceiver` to improve the readability of your diff callbacks in a Java project. 106 | 107 | The same receiver logic can be expressed like this in Java: 108 | 109 | ```java 110 | DiffResult diff = differenceOf(...); 111 | 112 | // When `applyDiff` returns, `output` will be equal to `revisedListOfBffs` 113 | List output = ArrayList<>(listOfBffs); 114 | DiffReceiver receiver = new DiffReceiver<>() { 115 | @Override 116 | public void remove(int index) { 117 | output.removeAt(index); 118 | } 119 | 120 | @Override 121 | public void insert(String item, int index) { 122 | output.add(index, item); 123 | } 124 | 125 | @Override 126 | public void move(int oldIndex, int newIndex) { 127 | // You can omit this override if you set `detectMoves` to false 128 | int index = newIndex; 129 | if (newIndex >= oldIndex) { 130 | index--; 131 | } 132 | 133 | output.add(index, output.removeAt(oldIndex)); 134 | } 135 | }; 136 | 137 | receiver.applyDiff(diff); 138 | ``` 139 | 140 | Note that `DiffReceiver` is only available in Java projects. 141 | If your project is a 100% Kotlin project, then you should stick to `applyDiff` and ignore `DiffReceiver`. 142 | 143 | ## Performance 144 | Difference uses a linear-space non-recursive implementation of Eugene Myer's Differencing algorithm. 145 | The algorithm takes O((M+N)×D + D log D) operations, where M and N are the lengths of the input lists, and D is the minimum number of edits it takes to transform the original list into the final list. 146 | If you enable movement detection, this runtime increases by O(D²). 147 | 148 | Diff generation can take a while, so for UI-centric applications, you should avoid calling `differenceOf` on your main thread. 149 | Depending on conditions and the client's hardware, diff generation for arbitrary lists can easily cause your application to block the main thread and cause frame drops if you aren't careful. 150 | 151 | ### Benchmarks 152 | 153 | Difference has benchmark tests that can run on an Android device. 154 | Below is the measured time it takes to compute diffs of various sizes on a Pixel 3 running Android Q. 155 | 156 | These values **should not** be used to estimate how long any call to `differenceOf` will take. 157 | Real-world performance will vary device-to-device, and can be influenced by conditions such as the device's hardware, CPU load, temperature, and battery level, among other factors. 158 | You should take these values with a grain of salt and make note of how the time taken to generate a diff grows exponentially based on the size of the inputs. 159 | 160 | #### Pixel 3 Benchmark (without movement detection) 161 | | Starting list size | Number of operations | Time taken | 162 | |:------------------:|:--------------------:|:-----------| 163 | | 100 | 10 | 0.059 ms | 164 | | 1000 | 100 | 0.983 ms | 165 | | 5000 | 500 | 17.6 ms | 166 | | 10000 | 1000 | 55.6 ms | 167 | 168 | #### Pixel 3 Benchmark (with movement detection) 169 | | Starting list size | Number of operations | Time taken | 170 | |:------------------:|:--------------------:|:-----------| 171 | | 100 | 10 | 0.055 ms | 172 | | 1000 | 100 | 1.158 ms | 173 | | 5000 | 500 | 22.0 ms | 174 | | 10000 | 1000 | 73.5 ms | 175 | -------------------------------------------------------------------------------- /difference/src/commonMain/kotlin/dev/andrewbailey/diff/DiffResult.kt: -------------------------------------------------------------------------------- 1 | package dev.andrewbailey.diff 2 | 3 | /** 4 | * Stores the result of a diff calculated by [differenceOf]. 5 | */ 6 | class DiffResult internal constructor( 7 | /** 8 | * The sequence of operations in the diff. When applied in order, these operations will 9 | * transform the original collection into the target collection. This list always coalesces 10 | * ranges of the same operation together, and prefers to use the minimum number of 11 | * [DiffOperation] objects required to express the diff. 12 | */ 13 | val operations: List> 14 | ) { 15 | 16 | /** 17 | * Executes the operations in this diff-in order. This function is generally intended to 18 | * mirror the state changes expressed in this difference to a parallel data structure derived 19 | * by the diff-ed collection. 20 | * 21 | * The lambdas passed into this method are invoked to respond to each operation. When an index 22 | * is specified, it expresses the index of the in-flight data structure. That is, an index 23 | * which is only valid when all previously dispatched operations have been applied to the 24 | * original collection. 25 | * 26 | * This overload applies operations on an element-by-element basis. Use the overload with 27 | * the additional "Range" lambdas to support bulk operations, which can improve performance. 28 | * 29 | * @param remove Called to remove the object at the specified `index` from the in-flight 30 | * collection as a step towards the final collection. 31 | * @param insert Called to insert the given `item` at the specified `index` to the in-flight 32 | * collection as a step towards the final collection. 33 | * @param move If this diff was generated with moves detected, this function is called to move 34 | * the item at `oldIndex` to `newIndex`. If this diff was not generated with moves detected, 35 | * this lambda will never be invoked. These indexes are written assuming an atomic operation 36 | * to perform the move. To implement a move operation as a remove and re-insert operation, the 37 | * `newIndex` may need to be corrected with an offset. In practice, this looks like 38 | * `add(removeAt(oldIndex), if (newIndex < oldIndex) else newIndex - 1)`. 39 | */ 40 | inline fun applyDiff( 41 | crossinline remove: (index: Int) -> Unit, 42 | crossinline insert: (item: T, index: Int) -> Unit, 43 | crossinline move: (oldIndex: Int, newIndex: Int) -> Unit 44 | ) { 45 | applyDiff( 46 | remove = remove, 47 | insert = insert, 48 | move = move, 49 | removeRange = { start, end -> 50 | repeat(times = end - start) { 51 | remove(start) 52 | } 53 | }, 54 | insertAll = { items, index -> 55 | items.forEachIndexed { itemIndex, item -> 56 | insert(item, index + itemIndex) 57 | } 58 | }, 59 | moveRange = { oldIndex, newIndex, count -> 60 | when { 61 | newIndex < oldIndex -> { 62 | (0 until count).forEach { item -> 63 | move(oldIndex + item, newIndex + item) 64 | } 65 | } 66 | newIndex > oldIndex -> { 67 | repeat(count) { 68 | move(oldIndex, newIndex) 69 | } 70 | } 71 | } 72 | } 73 | ) 74 | } 75 | 76 | /** 77 | * Executes the operations in this diff-in order, with support for applying operations in bulk 78 | * when a large span of items experience the same transformation. This function is generally 79 | * intended to mirror the state changes expressed in this difference to a parallel data 80 | * structure derived by the diff-ed collection. 81 | * 82 | * The lambdas passed into this method are invoked to respond to each aggregated operation. 83 | * When an index or range is specified, it is indexed to the in-flight data structure. That is, 84 | * an index which is only valid when all previously dispatched operations have been applied 85 | * to the original collection. 86 | * 87 | * @param remove Called to remove the object at the specified `index` from the in-flight 88 | * collection as a step towards the final collection. 89 | * @param removeRange Called to remove all objects between index `start` (inclusive) and `end` 90 | * (exclusive) from the in-flight collection as a step towards the final collection. 91 | * @param insert Called to insert the given `item` at the specified `index` to the in-flight 92 | * collection as a step towards the final collection. 93 | * @param insertAll Called to insert all items in the provided collection to the in-flight 94 | * collection. The given list of items should be added in-order with the inserted sequence 95 | * starting at the provided `index` in the in-flight collection. 96 | * @param move If this diff was generated with moves detected, this function is called to move 97 | * the item at `oldIndex` to `newIndex`. If this diff was not generated with moves detected, 98 | * this lambda will never be invoked. These indexes are written assuming an atomic operation 99 | * to perform the move. To implement a move operation as a remove and re-insert operation, the 100 | * `newIndex` may need to be corrected with an offset. In practice, this looks like 101 | * `add(removeAt(oldIndex), if (newIndex < oldIndex) newIndex else newIndex - 1)`. 102 | * @param moveRange This lambda is used in the same way as [move] is, but operates on a 103 | * contiguous span of two or more items to be moved. The indexing works in the same way as it 104 | * does for the single-item variant, in that the `newIndex` and `oldIndex` arguments provided 105 | * are both specified with respect to the current state of the in-flight array. If implementing 106 | * this expression as an addRange and removeRange operation, or by breaking this operation into 107 | * multiple move operations, you will need to correct the destination index when it is before 108 | * the source index. 109 | */ 110 | inline fun applyDiff( 111 | crossinline remove: (index: Int) -> Unit, 112 | crossinline removeRange: (start: Int, end: Int) -> Unit, 113 | crossinline insert: (item: T, index: Int) -> Unit, 114 | crossinline insertAll: (items: List, index: Int) -> Unit, 115 | crossinline move: (oldIndex: Int, newIndex: Int) -> Unit, 116 | crossinline moveRange: (oldIndex: Int, newIndex: Int, count: Int) -> Unit 117 | ) { 118 | operations.forEach { operation -> 119 | when (operation) { 120 | is DiffOperation.Remove -> { 121 | remove(operation.index) 122 | } 123 | is DiffOperation.RemoveRange -> { 124 | removeRange(operation.startIndex, operation.endIndex) 125 | } 126 | is DiffOperation.Add -> { 127 | insert(operation.item, operation.index) 128 | } 129 | is DiffOperation.AddAll -> { 130 | insertAll(operation.items, operation.index) 131 | } 132 | is DiffOperation.Move -> { 133 | move(operation.fromIndex, operation.toIndex) 134 | } 135 | is DiffOperation.MoveRange -> { 136 | moveRange(operation.fromIndex, operation.toIndex, operation.itemCount) 137 | } 138 | } 139 | } 140 | } 141 | 142 | override fun equals(other: Any?) = other is DiffResult<*> && other.operations == operations 143 | 144 | override fun hashCode() = operations.hashCode() 145 | 146 | override fun toString() = "DiffResult(operations = $operations)" 147 | } 148 | -------------------------------------------------------------------------------- /difference/src/commonMain/kotlin/dev/andrewbailey/diff/DiffGenerator.kt: -------------------------------------------------------------------------------- 1 | package dev.andrewbailey.diff 2 | 3 | import dev.andrewbailey.diff.DiffOperation.Add 4 | import dev.andrewbailey.diff.DiffOperation.AddAll 5 | import dev.andrewbailey.diff.DiffOperation.Move 6 | import dev.andrewbailey.diff.DiffOperation.MoveRange 7 | import dev.andrewbailey.diff.DiffOperation.Remove 8 | import dev.andrewbailey.diff.DiffOperation.RemoveRange 9 | import dev.andrewbailey.diff.impl.MyersDiffAlgorithm 10 | import dev.andrewbailey.diff.impl.MyersDiffOperation.Delete 11 | import dev.andrewbailey.diff.impl.MyersDiffOperation.Insert 12 | import dev.andrewbailey.diff.impl.MyersDiffOperation.Skip 13 | import dev.andrewbailey.diff.impl.fastForEach 14 | 15 | internal object DiffGenerator { 16 | 17 | fun generateDiff( 18 | original: List, 19 | updated: List, 20 | detectMoves: Boolean 21 | ): DiffResult { 22 | val diff = MyersDiffAlgorithm(original, updated).generateDiff() 23 | 24 | var index = 0 25 | var indexInOriginalSequence = 0 26 | val operations = mutableListOf>() 27 | diff.fastForEach { operation -> 28 | when (operation) { 29 | is Insert -> { 30 | operations += Add( 31 | index = index, 32 | item = operation.value 33 | ) 34 | index++ 35 | } 36 | is Delete -> { 37 | operations += Remove( 38 | index = index, 39 | item = original[indexInOriginalSequence] 40 | ) 41 | indexInOriginalSequence++ 42 | } 43 | is Skip -> { 44 | index++ 45 | indexInOriginalSequence++ 46 | } 47 | } 48 | } 49 | 50 | if (detectMoves) reduceDeletesAndAddsToMoves(operations) 51 | reduceSequences(operations) 52 | return DiffResult(operations) 53 | } 54 | 55 | /** 56 | * Given a diff, this function performs a reduction step that converts pairs of adds and removes 57 | * for the same item into move operations. 58 | * 59 | * This function takes O(n^2) time. There's an optimization in place here that avoids rescanning 60 | * the entire array for possible matches, and technically adds a coefficient of 1/2 to this 61 | * runtime, but alas big-O isn't concerned with this detail. 62 | * 63 | * The way this algorithm runs is a bit unintuitive and depends on the inputted list of 64 | * operations being sorted by index from smallest to largest. When this function is called, the 65 | * [operations] only contains add and remove operations. We iterate over the entire array. For 66 | * each operation (whether it's an add or remove) we try and find an operation that undoes the 67 | * operation later on in the array (we don't need to rescan the earlier part for reasons that 68 | * will become clear in a moment). 69 | * 70 | * If we find a pair of operations that can be reduced to a move (i.e. if we find a remove that 71 | * undoes an add or vice versa), we replace the operation that came first with the move 72 | * operation. This keeps the array in a sorted order when we're done. We then remove the 73 | * opposite operation from the diff and check the next item until we've checked all operations. 74 | */ 75 | private fun reduceDeletesAndAddsToMoves(operations: MutableList>) { 76 | var index = 0 77 | while (index < operations.size) { 78 | val operation = operations[index] 79 | 80 | var indexOfOppositeAction = index + 1 81 | var endIndexDifference = 0 82 | 83 | while (indexOfOppositeAction < operations.size && 84 | !canBeReducedToMove(operation, operations[indexOfOppositeAction]) 85 | ) { 86 | val rejectedOperation = operations[indexOfOppositeAction] 87 | if (rejectedOperation is Add) { 88 | endIndexDifference++ 89 | } else { 90 | endIndexDifference-- 91 | } 92 | indexOfOppositeAction++ 93 | } 94 | 95 | val oppositeAction = operations.getOrNull(indexOfOppositeAction) 96 | 97 | if (oppositeAction != null) { 98 | val deleteFromIndex = if (operation is Remove) { 99 | operation.index 100 | } else { 101 | (oppositeAction as Remove).index - endIndexDifference - 1 102 | } 103 | 104 | val addToIndex = if (operation is Add) { 105 | operation.index 106 | } else { 107 | (oppositeAction as Add).index - endIndexDifference + 1 108 | } 109 | 110 | operations[index] = Move( 111 | fromIndex = deleteFromIndex, 112 | toIndex = addToIndex 113 | ) 114 | 115 | operations.removeAt(indexOfOppositeAction) 116 | } 117 | 118 | index++ 119 | } 120 | } 121 | 122 | private fun canBeReducedToMove( 123 | operation1: DiffOperation, 124 | operation2: DiffOperation 125 | ): Boolean = when (operation1) { 126 | is Add -> operation2 is Remove && operation1.item == operation2.item 127 | is Remove -> operation2 is Add && operation1.item == operation2.item 128 | else -> false 129 | } 130 | 131 | private fun reduceSequences(operations: MutableList>) { 132 | var index = 0 133 | 134 | while (index < operations.size) { 135 | val operationToReduce = operations[index] 136 | var sequenceEndIndex = index + 1 137 | var sequenceLength = 1 138 | while (sequenceEndIndex < operations.size && 139 | operationToReduce.canBeCombinedWith(operations[sequenceEndIndex], sequenceLength) 140 | ) { 141 | sequenceEndIndex++ 142 | sequenceLength++ 143 | } 144 | 145 | if (sequenceLength > 1) { 146 | operations[index] = reduceSequence( 147 | operations = operations, 148 | sequenceStartIndex = index, 149 | sequenceLength = sequenceLength 150 | ) 151 | 152 | repeat(sequenceLength - 1) { operations.removeAt(index + 1) } 153 | } 154 | 155 | index++ 156 | } 157 | } 158 | 159 | private fun reduceSequence( 160 | operations: MutableList>, 161 | sequenceStartIndex: Int, 162 | sequenceLength: Int 163 | ): DiffOperation = when (val startOperation = operations[sequenceStartIndex]) { 164 | is Remove -> { 165 | RemoveRange( 166 | startIndex = startOperation.index, 167 | endIndex = startOperation.index + sequenceLength 168 | ) 169 | } 170 | is Add -> { 171 | AddAll( 172 | index = startOperation.index, 173 | items = List(sequenceLength) { i -> 174 | (operations[sequenceStartIndex + i] as Add).item 175 | } 176 | ) 177 | } 178 | is Move -> { 179 | MoveRange( 180 | fromIndex = startOperation.fromIndex, 181 | toIndex = startOperation.toIndex, 182 | itemCount = sequenceLength 183 | ) 184 | } 185 | else -> throw IllegalArgumentException( 186 | "Cannot reduce sequence starting with $startOperation" 187 | ) 188 | } 189 | 190 | private fun DiffOperation.canBeCombinedWith( 191 | otherOperation: DiffOperation, 192 | offset: Int 193 | ): Boolean = when (this) { 194 | is Remove -> otherOperation is Remove && index == otherOperation.index 195 | is Add -> otherOperation is Add && index + offset == otherOperation.index 196 | is Move -> 197 | otherOperation is Move && 198 | when { 199 | toIndex < fromIndex -> { 200 | // Move backwards case 201 | toIndex + offset == otherOperation.toIndex && 202 | fromIndex + offset == otherOperation.fromIndex 203 | } 204 | else -> { 205 | // Move forwards case 206 | toIndex == otherOperation.toIndex && 207 | fromIndex == otherOperation.fromIndex 208 | } 209 | } 210 | else -> false 211 | } 212 | } 213 | -------------------------------------------------------------------------------- /difference/src/commonMain/kotlin/dev/andrewbailey/diff/impl/MyersDiffAlgorithm.kt: -------------------------------------------------------------------------------- 1 | package dev.andrewbailey.diff.impl 2 | 3 | import dev.andrewbailey.diff.impl.MyersDiffOperation.Delete 4 | import dev.andrewbailey.diff.impl.MyersDiffOperation.Insert 5 | import dev.andrewbailey.diff.impl.MyersDiffOperation.Skip 6 | import kotlin.math.ceil 7 | 8 | /** 9 | * This class implements a variation of Eugene Myers' Diffing Algorithm that uses linear space. This 10 | * algorithm has a worst-case runtime of O(M + N + D^2), where N and M are the lengths of [original] 11 | * and [updated], and D is the length of the edit script (i.e. the number of `Insert`s and `Delete`s 12 | * that appear in the result of [generateDiff]). This algorithm has an expected runtime of 13 | * O((M + N) D) and always uses O(D) space. 14 | * 15 | * The basic variation of this algorithm (which uses quadratic space) is a greedy algorithm. In this 16 | * introductory variation, the algorithm places the inputs on a grid. At (0, 0), no inputs from 17 | * either [original] or [updated] have been accepted. Moving to the right (in the positive X 18 | * direction) indicates that the next item in [original] should be removed. Moving downward (in the 19 | * positive Y direction) indicates that the next item in [updated] should be inserted. Moving 20 | * diagonally (in both the positive X and Y direction) indicates that [original] and [updated] share 21 | * a value, so there is no difference. 22 | * 23 | * The greedy algorithm makes multiple passes to find the shortest path from (0, 0) to (N, M). When 24 | * the algorithm runs through the inputs, it can move diagonally for free. Long chains of diagonals 25 | * where both inputs have a matching subsequence are called a [Snake]. In each iteration, the 26 | * possible paths expand either by one unit in a single direction or, if there is a snake, 27 | * diagonally until the end of the snake. 28 | * 29 | * The linear-space implementation of this algorithm is a divide and conquer algorithm that follows 30 | * the same basic principles as the greedy algorithm. The input is traversed forwards and backwards 31 | * simultaneously in a subset of the grid. When the paths in both directions intersect, a shortest 32 | * path has been found and a diff can be outputted. 33 | * 34 | * You can read the technical paper by Eugene Myers here: http://xmailserver.org/diff2.pdf 35 | */ 36 | internal class MyersDiffAlgorithm( 37 | private val original: List, 38 | private val updated: List 39 | ) { 40 | 41 | fun generateDiff(): List> { 42 | val path = findPath() 43 | val regions = mutableListOf>() 44 | 45 | path.fastForEach { (p1, p2) -> 46 | var (x1, y1) = walkDiagonal(p1, p2, regions) 47 | val (x2, y2) = p2 48 | 49 | val dY = y2 - y1 50 | val dX = x2 - x1 51 | when { 52 | dY > dX -> { 53 | regions += interpretRegion(x1, y1, x1, y1 + 1) 54 | y1++ 55 | } 56 | dY < dX -> { 57 | regions += interpretRegion(x1, y1, x1 + 1, y1) 58 | x1++ 59 | } 60 | } 61 | 62 | walkDiagonal(Point(x1, y1), p2, regions) 63 | } 64 | 65 | return regions 66 | } 67 | 68 | private fun walkDiagonal( 69 | start: Point, 70 | end: Point, 71 | regionsOutput: MutableList> 72 | ): Point { 73 | var (x1, y1) = start 74 | val (x2, y2) = end 75 | while (x1 < x2 && y1 < y2 && original[x1] == updated[y1]) { 76 | regionsOutput += interpretRegion(x1, y1, x1 + 1, y1 + 1) 77 | x1++ 78 | y1++ 79 | } 80 | 81 | return Point(x1, y1) 82 | } 83 | 84 | private fun interpretRegion( 85 | x1: Int, 86 | y1: Int, 87 | x2: Int, 88 | y2: Int 89 | ): MyersDiffOperation = when { 90 | x1 == x2 -> Insert(value = updated[y1]) 91 | y1 == y2 -> Delete 92 | else -> Skip 93 | } 94 | 95 | private fun findPath(): List { 96 | val snakes = mutableListOf() 97 | val stack = mutableListOf() 98 | 99 | stack.push( 100 | Region( 101 | left = 0, 102 | top = 0, 103 | right = original.size, 104 | bottom = updated.size 105 | ) 106 | ) 107 | 108 | while (stack.isNotEmpty()) { 109 | val region = stack.pop() 110 | 111 | val snake = midpoint(region) 112 | if (snake != null) { 113 | snakes += snake 114 | val (start, finish) = snake 115 | 116 | stack.push( 117 | region.copy( 118 | right = start.x, 119 | bottom = start.y 120 | ) 121 | ) 122 | 123 | stack.push( 124 | region.copy( 125 | left = finish.x, 126 | top = finish.y 127 | ) 128 | ) 129 | } 130 | } 131 | 132 | snakes.sort() 133 | return snakes 134 | } 135 | 136 | private fun midpoint(region: Region): Snake? { 137 | if (region.size == 0) { 138 | return null 139 | } 140 | 141 | val max = ceil(region.size / 2.0f).toInt() 142 | 143 | val vForwards = CircularIntArray(2 * max + 1) 144 | vForwards[1] = region.left 145 | val vBackwards = CircularIntArray(2 * max + 1) 146 | vBackwards[1] = region.bottom 147 | 148 | for (depth in 0..max) { 149 | forwards(region, vForwards, vBackwards, depth)?.let { return it } 150 | backwards(region, vForwards, vBackwards, depth)?.let { return it } 151 | } 152 | 153 | return null 154 | } 155 | 156 | private fun forwards( 157 | region: Region, 158 | vForwards: CircularIntArray, 159 | vBackwards: CircularIntArray, 160 | depth: Int 161 | ): Snake? { 162 | // This loop is effectively `for (k in (-depth..depth step 2).reversed())`, but avoids 163 | // allocating a Range object. 164 | var k = depth 165 | while (k >= -depth) { 166 | val c = k - region.delta 167 | 168 | var endX: Int 169 | val startX: Int 170 | 171 | if (k == -depth || (k != -depth && vForwards[k - 1] < vForwards[k + 1])) { 172 | startX = vForwards[k + 1] 173 | endX = startX 174 | } else { 175 | startX = vForwards[k - 1] 176 | endX = startX + 1 177 | } 178 | 179 | var endY = region.top + (endX - region.left) - k 180 | val startY = if (depth == 0 || endX != startX) endY else endY - 1 181 | 182 | while (endX < region.right && 183 | endY < region.bottom && 184 | original[endX] == updated[endY] 185 | ) { 186 | endX++ 187 | endY++ 188 | } 189 | 190 | vForwards[k] = endX 191 | 192 | if (region.delta.isOdd() && c in -(depth - 1) until depth && endY >= vBackwards[c]) { 193 | return Snake( 194 | start = Point(startX, startY), 195 | end = Point(endX, endY) 196 | ) 197 | } 198 | 199 | k -= 2 200 | } 201 | 202 | return null 203 | } 204 | 205 | private fun backwards( 206 | region: Region, 207 | vForwards: CircularIntArray, 208 | vBackwards: CircularIntArray, 209 | depth: Int 210 | ): Snake? { 211 | // This loop is effectively `for (c in (-depth..depth step 2).reversed())`, but avoids 212 | // allocating a Range object. 213 | var c = depth 214 | while (c >= -depth) { 215 | val k = c + region.delta 216 | 217 | val endY: Int 218 | var startY: Int 219 | 220 | if (c == -depth || (c != depth && vBackwards[c - 1] > vBackwards[c + 1])) { 221 | endY = vBackwards[c + 1] 222 | startY = endY 223 | } else { 224 | endY = vBackwards[c - 1] 225 | startY = endY - 1 226 | } 227 | 228 | var startX = region.left + (startY - region.top) + k 229 | val endX = if (depth == 0 || startY != endY) startX else startX + 1 230 | 231 | while (startX > region.left && 232 | startY > region.top && 233 | original[startX - 1] == updated[startY - 1] 234 | ) { 235 | startX-- 236 | startY-- 237 | } 238 | 239 | vBackwards[c] = startY 240 | 241 | if (region.delta.isEven() && k in -depth..depth && startX <= vForwards[k]) { 242 | return Snake( 243 | start = Point(startX, startY), 244 | end = Point(endX, endY) 245 | ) 246 | } 247 | 248 | c -= 2 249 | } 250 | 251 | return null 252 | } 253 | } 254 | -------------------------------------------------------------------------------- /difference/src/commonTest/kotlin/dev/andrewbailey/diff/DiffGeneratorTest.kt: -------------------------------------------------------------------------------- 1 | package dev.andrewbailey.diff 2 | 3 | import dev.andrewbailey.diff.DiffOperation.Add 4 | import dev.andrewbailey.diff.DiffOperation.AddAll 5 | import dev.andrewbailey.diff.DiffOperation.Move 6 | import dev.andrewbailey.diff.DiffOperation.MoveRange 7 | import dev.andrewbailey.diff.DiffOperation.Remove 8 | import dev.andrewbailey.diff.DiffOperation.RemoveRange 9 | import kotlin.test.Test 10 | import kotlin.test.assertEquals 11 | 12 | class DiffGeneratorTest { 13 | 14 | @Test 15 | fun generateDiff_withEmptyInput_returnsEmptyResult() { 16 | val original = emptyList() 17 | val updated = emptyList() 18 | 19 | val diff = DiffGenerator.generateDiff(original, updated, false) 20 | 21 | assertEquals( 22 | message = "The returned diff did not match the expected value.", 23 | expected = DiffResult(emptyList()), 24 | actual = diff 25 | ) 26 | 27 | assertEquals( 28 | message = "Applying the diff to the input did not yield the updated value.", 29 | expected = updated, 30 | actual = applyDiff(original, diff) 31 | ) 32 | } 33 | 34 | @Test 35 | fun generateDiff_withEmptyStart_returnsAdditions() { 36 | val original = emptyList() 37 | val updated = listOf("A", "B", "C") 38 | 39 | val diff = DiffGenerator.generateDiff(original, updated, false) 40 | 41 | assertEquals( 42 | message = "The returned diff did not match the expected value.", 43 | expected = DiffResult( 44 | listOf( 45 | AddAll( 46 | index = 0, 47 | items = listOf("A", "B", "C") 48 | ) 49 | ) 50 | ), 51 | actual = diff 52 | ) 53 | 54 | assertEquals( 55 | message = "Applying the diff to the input did not yield the updated value.", 56 | expected = updated, 57 | actual = applyDiff(original, diff) 58 | ) 59 | } 60 | 61 | @Test 62 | fun generateDiff_withEmptyEnd_returnsDeletions() { 63 | val original = listOf("A", "B", "C") 64 | val updated = emptyList() 65 | 66 | val diff = DiffGenerator.generateDiff(original, updated, false) 67 | 68 | assertEquals( 69 | message = "The returned diff did not match the expected value.", 70 | expected = DiffResult( 71 | listOf( 72 | RemoveRange( 73 | startIndex = 0, 74 | endIndex = 3 75 | ) 76 | ) 77 | ), 78 | actual = diff 79 | ) 80 | 81 | assertEquals( 82 | message = "Applying the diff to the input did not yield the updated value.", 83 | expected = updated, 84 | actual = applyDiff(original, diff) 85 | ) 86 | } 87 | 88 | @Test 89 | fun generateDiff_withSameStartAndEnd_returnsEmptyDiff() { 90 | val original = listOf("A", "B", "C") 91 | val updated = listOf("A", "B", "C") 92 | 93 | val diff = DiffGenerator.generateDiff(original, updated, false) 94 | 95 | assertEquals( 96 | message = "The returned diff did not match the expected value.", 97 | expected = DiffResult(emptyList()), 98 | actual = diff 99 | ) 100 | 101 | assertEquals( 102 | message = "Applying the diff to the input did not yield the updated value.", 103 | expected = updated, 104 | actual = applyDiff(original, diff) 105 | ) 106 | } 107 | 108 | @Test 109 | fun generateDiff_withoutMoves_calculatesComplexDiff() { 110 | val original = "ABCDEFGHJKLPQR".toList() 111 | val updated = "BCAGHIJLMNOPQR".toList() 112 | 113 | val diff = DiffGenerator.generateDiff( 114 | original = original, 115 | updated = updated, 116 | detectMoves = false 117 | ) 118 | 119 | assertEquals( 120 | message = "The returned diff did not match the expected value.", 121 | expected = DiffResult( 122 | listOf( 123 | Remove(index = 0, item = 'A'), 124 | RemoveRange(startIndex = 2, endIndex = 5), 125 | Add(index = 2, item = 'A'), 126 | Add(index = 5, item = 'I'), 127 | Remove(index = 7, item = 'K'), 128 | AddAll(index = 8, items = "MNO".toList()) 129 | ) 130 | ), 131 | actual = diff 132 | ) 133 | 134 | assertEquals( 135 | message = "Applying the diff to the input did not yield the updated value.", 136 | expected = updated, 137 | actual = applyDiff(original, diff) 138 | ) 139 | } 140 | 141 | @Test 142 | fun generateDiff_detectsForwardsAndBackwardsMovements() { 143 | val original = "CADEFB".toList() 144 | val updated = "ABCDEF".toList() 145 | 146 | val diff = DiffGenerator.generateDiff( 147 | original = original, 148 | updated = updated, 149 | detectMoves = true 150 | ) 151 | 152 | assertEquals( 153 | message = "The returned diff did not match the expected value.", 154 | expected = DiffResult( 155 | listOf( 156 | Move( 157 | fromIndex = 0, 158 | toIndex = 2 159 | ), 160 | Move( 161 | fromIndex = 5, 162 | toIndex = 1 163 | ) 164 | ) 165 | ), 166 | actual = diff 167 | ) 168 | 169 | assertEquals( 170 | message = "Applying the diff to the input did not yield the updated value.", 171 | expected = updated, 172 | actual = applyDiff(original, diff) 173 | ) 174 | } 175 | 176 | @Test 177 | fun generateDiff_detectsMoveForwardsSequences() { 178 | val original = "ABCDEFGHIJKL".toList() 179 | val updated = "ABCGHIJKLDEF".toList() 180 | 181 | val diff = DiffGenerator.generateDiff( 182 | original = original, 183 | updated = updated, 184 | detectMoves = true 185 | ) 186 | 187 | assertEquals( 188 | message = "The returned diff did not match the expected value.", 189 | expected = DiffResult( 190 | listOf( 191 | MoveRange( 192 | fromIndex = 3, 193 | toIndex = 12, 194 | itemCount = 3 195 | ) 196 | ) 197 | ), 198 | actual = diff 199 | ) 200 | 201 | assertEquals( 202 | message = "Applying the diff to the input did not yield the updated value.", 203 | expected = updated, 204 | actual = applyDiff(original, diff) 205 | ) 206 | } 207 | 208 | @Test 209 | fun generateDiff_DetectsMoveBackwardsSequences() { 210 | val original = "ABCDEFGHIJKL".toList() 211 | val updated = "HIJABCDEFGKL".toList() 212 | 213 | val diff = DiffGenerator.generateDiff( 214 | original = original, 215 | updated = updated, 216 | detectMoves = true 217 | ) 218 | 219 | assertEquals( 220 | message = "The returned diff did not match the expected value.", 221 | expected = DiffResult( 222 | listOf( 223 | MoveRange( 224 | fromIndex = 7, 225 | toIndex = 0, 226 | itemCount = 3 227 | ) 228 | ) 229 | ), 230 | actual = diff 231 | ) 232 | 233 | assertEquals( 234 | message = "Applying the diff to the input did not yield the updated value.", 235 | expected = updated, 236 | actual = applyDiff(original, diff) 237 | ) 238 | } 239 | 240 | @Test 241 | fun generateDiff_DetectsAdjacentMovesToDifferentDestinations() { 242 | val original = "ABCDEFGHIJKL".toList() 243 | val updated = "DABCGHEIJKLF".toList() 244 | 245 | val diff = DiffGenerator.generateDiff( 246 | original = original, 247 | updated = updated, 248 | detectMoves = true 249 | ) 250 | 251 | assertEquals( 252 | message = "The returned diff did not match the expected value.", 253 | expected = DiffResult( 254 | listOf( 255 | Move( 256 | fromIndex = 3, 257 | toIndex = 0 258 | ), 259 | Move( 260 | fromIndex = 4, 261 | toIndex = 8 262 | ), 263 | Move( 264 | fromIndex = 4, 265 | toIndex = 12 266 | ) 267 | ) 268 | ), 269 | actual = diff 270 | ) 271 | 272 | assertEquals( 273 | message = "Applying the diff to the input did not yield the updated value.", 274 | expected = updated, 275 | actual = applyDiff(original, diff) 276 | ) 277 | } 278 | 279 | @Test 280 | fun generateDiff_withMoves_excludesOppositeOperationsFromMerging() { 281 | val original = listOf(3, 2, 3, 0, 0, 3, 1, 0, 1, 2) 282 | val updated = listOf(1, 3, 2, 0, 12, 0, 15, 0, 1, 2, 3) 283 | 284 | val diff = DiffGenerator.generateDiff( 285 | original = original, 286 | updated = updated, 287 | detectMoves = true 288 | ) 289 | 290 | assertEquals( 291 | message = "The returned diff did not match the expected value.", 292 | expected = DiffResult( 293 | listOf( 294 | Move( 295 | fromIndex = 6, 296 | toIndex = 0 297 | ), 298 | Move( 299 | fromIndex = 3, 300 | toIndex = 10 301 | ), 302 | Add( 303 | index = 4, 304 | item = 12 305 | ), 306 | Remove( 307 | index = 6, 308 | item = 3 309 | ), 310 | Add( 311 | index = 6, 312 | item = 15 313 | ) 314 | ) 315 | ), 316 | actual = diff 317 | ) 318 | 319 | assertEquals( 320 | message = "Applying the diff to the input did not yield the updated value.", 321 | expected = updated, 322 | actual = applyDiff(original, diff) 323 | ) 324 | } 325 | 326 | private fun applyDiff(original: List, diff: DiffResult): List = 327 | original.toMutableList().apply { 328 | diff.applyDiff( 329 | remove = { index -> removeAt(index) }, 330 | insert = { item, index -> add(index, item) }, 331 | move = { oldIndex, newIndex -> 332 | add( 333 | element = removeAt(oldIndex), 334 | index = if (newIndex < oldIndex) { 335 | newIndex 336 | } else { 337 | newIndex - 1 338 | } 339 | ) 340 | } 341 | ) 342 | } 343 | } 344 | --------------------------------------------------------------------------------