├── .github
└── workflows
│ └── ci.yaml
├── .gitignore
├── .readthedocs.yaml
├── LICENSE
├── MANIFEST.in
├── README.md
├── docs
├── advanced.rst
├── basic.rst
├── citation.rst
├── conf.py
├── images
│ ├── com_0.png
│ ├── com_0_155.png
│ ├── com_index.png
│ ├── example_1.png
│ ├── plasmid_cointegrates.png
│ ├── russian_dolls_fusion.png
│ └── russian_dolls_network.png
├── index.rst
├── installation.rst
├── output.rst
├── requirements.txt
├── tips.rst
└── tutorial.rst
├── env.yaml
├── pling
├── __init__.py
├── align_snakemake
│ ├── Snakefile
│ ├── integerise_plasmids.py
│ ├── matches.py
│ └── unimog.py
├── batching
│ ├── Snakefile
│ └── get_batches.py
├── common_rules
│ └── common_rules.smk
├── dcj_snakemake
│ ├── Snakefile
│ ├── __init__.py
│ ├── commons.py
│ ├── dcj.py
│ ├── glpk_and_ding.py
│ ├── glpk_sol_to_gurobi_sol.py
│ └── gurobi_and_ding.py
├── jac_network_snakemake
│ ├── Snakefile
│ └── seq_containment.py
├── resources.tsv
├── run_pling.py
└── utils.py
├── pyproject.toml
├── setup.py
└── tests
├── __init__.py
├── dcj_snakemake
├── __init__.py
├── test_cases
│ └── glpk_sol_to_gurobi_sol
│ │ ├── test_case_1
│ │ ├── glpk.sol.txt
│ │ ├── glpk_to_gurobi.sol.txt
│ │ └── gurobi.sol
│ │ └── test_case_2
│ │ ├── glpk.sol.txt
│ │ ├── glpk_to_gurobi.sol.txt
│ │ └── gurobi.sol
└── test_glpk_sol_to_gurobi_sol.py
├── integration_test
├── __init__.py
├── data
│ ├── .gitignore
│ ├── CP057418.1.fna
│ ├── NZ_CP027199.1.fna
│ ├── NZ_LR882977.1.fna
│ ├── NZ_MF510423.1.fna
│ ├── all_plasmids_distances.align.truth.tsv
│ ├── all_plasmids_distances.anno.truth.tsv
│ ├── bakta_db
│ │ ├── amrfinderplus-db
│ │ │ ├── 2021-09-30.1
│ │ │ │ ├── AMR.LIB.h3f
│ │ │ │ ├── AMR.LIB.h3i
│ │ │ │ ├── AMR.LIB.h3m
│ │ │ │ ├── AMR.LIB.h3p
│ │ │ │ ├── AMRProt-mutation.tab
│ │ │ │ ├── AMRProt-suppress
│ │ │ │ ├── AMRProt-susceptible.tab
│ │ │ │ ├── AMRProt.pdb
│ │ │ │ ├── AMRProt.phr
│ │ │ │ ├── AMRProt.pin
│ │ │ │ ├── AMRProt.psq
│ │ │ │ ├── AMRProt.ptf
│ │ │ │ ├── AMRProt.pto
│ │ │ │ ├── AMR_CDS.ndb
│ │ │ │ ├── AMR_CDS.nhr
│ │ │ │ ├── AMR_CDS.nin
│ │ │ │ ├── AMR_CDS.not
│ │ │ │ ├── AMR_CDS.nsq
│ │ │ │ ├── AMR_CDS.ntf
│ │ │ │ ├── AMR_CDS.nto
│ │ │ │ ├── database_format_version.txt
│ │ │ │ ├── fam.tab
│ │ │ │ ├── taxgroup.tab
│ │ │ │ └── version.txt
│ │ │ └── latest
│ │ ├── antifam.h3f
│ │ ├── antifam.h3i
│ │ ├── antifam.h3m
│ │ ├── antifam.h3p
│ │ ├── bakta.db
│ │ ├── expert-protein-sequences.dmnd
│ │ ├── ncRNA-genes.i1f
│ │ ├── ncRNA-genes.i1i
│ │ ├── ncRNA-genes.i1m
│ │ ├── ncRNA-genes.i1p
│ │ ├── ncRNA-regions.i1f
│ │ ├── ncRNA-regions.i1i
│ │ ├── ncRNA-regions.i1m
│ │ ├── ncRNA-regions.i1p
│ │ ├── oric.fna
│ │ ├── orit.fna
│ │ ├── pfam.h3f
│ │ ├── pfam.h3i
│ │ ├── pfam.h3m
│ │ ├── pfam.h3p
│ │ ├── psc.dmnd
│ │ ├── rRNA.i1f
│ │ ├── rRNA.i1i
│ │ ├── rRNA.i1m
│ │ ├── rRNA.i1p
│ │ ├── rfam-go.tsv
│ │ ├── sorf.dmnd
│ │ └── version.json
│ └── incy_list_4.txt
└── test_integration_test.py
├── unimog_tests
├── __init__.py
├── test_cases
│ ├── git_issues
│ │ ├── containment_1
│ │ │ └── truth
│ │ │ │ └── align
│ │ │ │ ├── all_plasmids_distances.tsv
│ │ │ │ ├── batches
│ │ │ │ ├── .snakemake_timestamp
│ │ │ │ ├── batch_0.txt
│ │ │ │ ├── batch_1.txt
│ │ │ │ ├── batch_10.txt
│ │ │ │ ├── batch_2.txt
│ │ │ │ ├── batch_3.txt
│ │ │ │ ├── batch_4.txt
│ │ │ │ ├── batch_5.txt
│ │ │ │ ├── batch_6.txt
│ │ │ │ ├── batch_7.txt
│ │ │ │ ├── batch_8.txt
│ │ │ │ ├── batch_9.txt
│ │ │ │ └── batching_info.txt
│ │ │ │ ├── containment
│ │ │ │ ├── all_pairs_containment_distance.tsv
│ │ │ │ ├── containment_communities
│ │ │ │ │ ├── .snakemake_timestamp
│ │ │ │ │ ├── objects
│ │ │ │ │ │ ├── communities.pkl
│ │ │ │ │ │ ├── communities.tsv
│ │ │ │ │ │ ├── communities.txt
│ │ │ │ │ │ └── plasmid_graph.pkl
│ │ │ │ │ └── visualisations
│ │ │ │ │ │ ├── communities
│ │ │ │ │ │ ├── graphs
│ │ │ │ │ │ │ └── community_0.html
│ │ │ │ │ │ ├── index.html
│ │ │ │ │ │ └── libs
│ │ │ │ │ │ │ ├── bluebird.js
│ │ │ │ │ │ │ ├── cytoscape-bubblesets.js
│ │ │ │ │ │ │ ├── cytoscape-euler.js
│ │ │ │ │ │ │ ├── cytoscape-layers.js
│ │ │ │ │ │ │ ├── cytoscape-ngraph.forcelayout.js
│ │ │ │ │ │ │ ├── cytoscape.min.js
│ │ │ │ │ │ │ ├── fetch.min.js
│ │ │ │ │ │ │ ├── jquery-3.6.0.min.js
│ │ │ │ │ │ │ ├── jquery-ui.min.css
│ │ │ │ │ │ │ ├── jquery-ui.min.js
│ │ │ │ │ │ │ ├── jquery-ui.structure.min.css
│ │ │ │ │ │ │ ├── jquery-ui.theme.min.css
│ │ │ │ │ │ │ ├── jquery.blockUI.js
│ │ │ │ │ │ │ ├── jquery.layout-1.4.0.js
│ │ │ │ │ │ │ ├── resources
│ │ │ │ │ │ │ └── images
│ │ │ │ │ │ │ │ ├── busy.gif
│ │ │ │ │ │ │ │ ├── ui-icons_444444_256x240.png
│ │ │ │ │ │ │ │ ├── ui-icons_555555_256x240.png
│ │ │ │ │ │ │ │ ├── ui-icons_777620_256x240.png
│ │ │ │ │ │ │ │ ├── ui-icons_777777_256x240.png
│ │ │ │ │ │ │ │ ├── ui-icons_cc0000_256x240.png
│ │ │ │ │ │ │ │ └── ui-icons_ffffff_256x240.png
│ │ │ │ │ │ │ └── style.css
│ │ │ │ │ │ └── single_graph
│ │ │ │ │ │ ├── libs
│ │ │ │ │ │ ├── bluebird.js
│ │ │ │ │ │ ├── cytoscape-bubblesets.js
│ │ │ │ │ │ ├── cytoscape-euler.js
│ │ │ │ │ │ ├── cytoscape-layers.js
│ │ │ │ │ │ ├── cytoscape-ngraph.forcelayout.js
│ │ │ │ │ │ ├── cytoscape.min.js
│ │ │ │ │ │ ├── fetch.min.js
│ │ │ │ │ │ ├── jquery-3.6.0.min.js
│ │ │ │ │ │ ├── jquery-ui.min.css
│ │ │ │ │ │ ├── jquery-ui.min.js
│ │ │ │ │ │ ├── jquery-ui.structure.min.css
│ │ │ │ │ │ ├── jquery-ui.theme.min.css
│ │ │ │ │ │ ├── jquery.blockUI.js
│ │ │ │ │ │ ├── jquery.layout-1.4.0.js
│ │ │ │ │ │ ├── resources
│ │ │ │ │ │ │ └── images
│ │ │ │ │ │ │ │ ├── busy.gif
│ │ │ │ │ │ │ │ ├── ui-icons_444444_256x240.png
│ │ │ │ │ │ │ │ ├── ui-icons_555555_256x240.png
│ │ │ │ │ │ │ │ ├── ui-icons_777620_256x240.png
│ │ │ │ │ │ │ │ ├── ui-icons_777777_256x240.png
│ │ │ │ │ │ │ │ ├── ui-icons_cc0000_256x240.png
│ │ │ │ │ │ │ │ └── ui-icons_ffffff_256x240.png
│ │ │ │ │ │ └── style.css
│ │ │ │ │ │ └── single_graph.html
│ │ │ │ └── not_pairs_containment_distance.tsv
│ │ │ │ ├── dcj_thresh_4_graph
│ │ │ │ ├── .snakemake_timestamp
│ │ │ │ ├── objects
│ │ │ │ │ ├── communities.pkl
│ │ │ │ │ ├── hub_plasmids.csv
│ │ │ │ │ ├── subcommunities.pkl
│ │ │ │ │ └── typing.tsv
│ │ │ │ └── visualisations
│ │ │ │ │ ├── communities
│ │ │ │ │ ├── graphs
│ │ │ │ │ │ └── community_0.html
│ │ │ │ │ ├── index.html
│ │ │ │ │ └── libs
│ │ │ │ │ │ ├── bluebird.js
│ │ │ │ │ │ ├── cytoscape-bubblesets.js
│ │ │ │ │ │ ├── cytoscape-euler.js
│ │ │ │ │ │ ├── cytoscape-layers.js
│ │ │ │ │ │ ├── cytoscape-ngraph.forcelayout.js
│ │ │ │ │ │ ├── cytoscape.min.js
│ │ │ │ │ │ ├── fetch.min.js
│ │ │ │ │ │ ├── jquery-3.6.0.min.js
│ │ │ │ │ │ ├── jquery-ui.min.css
│ │ │ │ │ │ ├── jquery-ui.min.js
│ │ │ │ │ │ ├── jquery-ui.structure.min.css
│ │ │ │ │ │ ├── jquery-ui.theme.min.css
│ │ │ │ │ │ ├── jquery.blockUI.js
│ │ │ │ │ │ ├── jquery.layout-1.4.0.js
│ │ │ │ │ │ ├── resources
│ │ │ │ │ │ └── images
│ │ │ │ │ │ │ ├── busy.gif
│ │ │ │ │ │ │ ├── ui-icons_444444_256x240.png
│ │ │ │ │ │ │ ├── ui-icons_555555_256x240.png
│ │ │ │ │ │ │ ├── ui-icons_777620_256x240.png
│ │ │ │ │ │ │ ├── ui-icons_777777_256x240.png
│ │ │ │ │ │ │ ├── ui-icons_cc0000_256x240.png
│ │ │ │ │ │ │ └── ui-icons_ffffff_256x240.png
│ │ │ │ │ │ └── style.css
│ │ │ │ │ └── subcommunities
│ │ │ │ │ ├── graphs
│ │ │ │ │ └── community_0_subcommunity_0.html
│ │ │ │ │ ├── index.html
│ │ │ │ │ └── libs
│ │ │ │ │ ├── bluebird.js
│ │ │ │ │ ├── cytoscape-bubblesets.js
│ │ │ │ │ ├── cytoscape-euler.js
│ │ │ │ │ ├── cytoscape-layers.js
│ │ │ │ │ ├── cytoscape-ngraph.forcelayout.js
│ │ │ │ │ ├── cytoscape.min.js
│ │ │ │ │ ├── fetch.min.js
│ │ │ │ │ ├── jquery-3.6.0.min.js
│ │ │ │ │ ├── jquery-ui.min.css
│ │ │ │ │ ├── jquery-ui.min.js
│ │ │ │ │ ├── jquery-ui.structure.min.css
│ │ │ │ │ ├── jquery-ui.theme.min.css
│ │ │ │ │ ├── jquery.blockUI.js
│ │ │ │ │ ├── jquery.layout-1.4.0.js
│ │ │ │ │ ├── resources
│ │ │ │ │ └── images
│ │ │ │ │ │ ├── busy.gif
│ │ │ │ │ │ ├── ui-icons_444444_256x240.png
│ │ │ │ │ │ ├── ui-icons_555555_256x240.png
│ │ │ │ │ │ ├── ui-icons_777620_256x240.png
│ │ │ │ │ │ ├── ui-icons_777777_256x240.png
│ │ │ │ │ │ ├── ui-icons_cc0000_256x240.png
│ │ │ │ │ │ └── ui-icons_ffffff_256x240.png
│ │ │ │ │ └── style.css
│ │ │ │ └── unimogs
│ │ │ │ ├── batch_0_align.unimog
│ │ │ │ ├── batch_0_map.txt
│ │ │ │ ├── batch_10_align.unimog
│ │ │ │ ├── batch_10_map.txt
│ │ │ │ ├── batch_1_align.unimog
│ │ │ │ ├── batch_1_map.txt
│ │ │ │ ├── batch_2_align.unimog
│ │ │ │ ├── batch_2_map.txt
│ │ │ │ ├── batch_3_align.unimog
│ │ │ │ ├── batch_3_map.txt
│ │ │ │ ├── batch_4_align.unimog
│ │ │ │ ├── batch_4_map.txt
│ │ │ │ ├── batch_5_align.unimog
│ │ │ │ ├── batch_5_map.txt
│ │ │ │ ├── batch_6_align.unimog
│ │ │ │ ├── batch_6_map.txt
│ │ │ │ ├── batch_7_align.unimog
│ │ │ │ ├── batch_7_map.txt
│ │ │ │ ├── batch_8_align.unimog
│ │ │ │ ├── batch_8_map.txt
│ │ │ │ ├── batch_9_align.unimog
│ │ │ │ └── batch_9_map.txt
│ │ ├── input
│ │ │ ├── fastas
│ │ │ │ ├── genome_1.fna
│ │ │ │ ├── genome_4.fna
│ │ │ │ └── genome_8.fna
│ │ │ └── palindrome.txt
│ │ └── palindrome
│ │ │ └── truth
│ │ │ └── align
│ │ │ ├── all_plasmids_distances.tsv
│ │ │ ├── batches
│ │ │ ├── .snakemake_timestamp
│ │ │ ├── batch_0.txt
│ │ │ └── batching_info.txt
│ │ │ ├── containment
│ │ │ ├── all_pairs_containment_distance.tsv
│ │ │ └── containment_communities
│ │ │ │ ├── .snakemake_timestamp
│ │ │ │ ├── objects
│ │ │ │ ├── communities.pkl
│ │ │ │ ├── communities.tsv
│ │ │ │ ├── communities.txt
│ │ │ │ └── plasmid_graph.pkl
│ │ │ │ └── visualisations
│ │ │ │ ├── communities
│ │ │ │ ├── graphs
│ │ │ │ │ └── community_0.html
│ │ │ │ ├── index.html
│ │ │ │ └── libs
│ │ │ │ │ ├── bluebird.js
│ │ │ │ │ ├── cytoscape-bubblesets.js
│ │ │ │ │ ├── cytoscape-euler.js
│ │ │ │ │ ├── cytoscape-layers.js
│ │ │ │ │ ├── cytoscape-ngraph.forcelayout.js
│ │ │ │ │ ├── cytoscape.min.js
│ │ │ │ │ ├── fetch.min.js
│ │ │ │ │ ├── jquery-3.6.0.min.js
│ │ │ │ │ ├── jquery-ui.min.css
│ │ │ │ │ ├── jquery-ui.min.js
│ │ │ │ │ ├── jquery-ui.structure.min.css
│ │ │ │ │ ├── jquery-ui.theme.min.css
│ │ │ │ │ ├── jquery.blockUI.js
│ │ │ │ │ ├── jquery.layout-1.4.0.js
│ │ │ │ │ ├── resources
│ │ │ │ │ └── images
│ │ │ │ │ │ ├── busy.gif
│ │ │ │ │ │ ├── ui-icons_444444_256x240.png
│ │ │ │ │ │ ├── ui-icons_555555_256x240.png
│ │ │ │ │ │ ├── ui-icons_777620_256x240.png
│ │ │ │ │ │ ├── ui-icons_777777_256x240.png
│ │ │ │ │ │ ├── ui-icons_cc0000_256x240.png
│ │ │ │ │ │ └── ui-icons_ffffff_256x240.png
│ │ │ │ │ └── style.css
│ │ │ │ └── single_graph
│ │ │ │ ├── libs
│ │ │ │ ├── bluebird.js
│ │ │ │ ├── cytoscape-bubblesets.js
│ │ │ │ ├── cytoscape-euler.js
│ │ │ │ ├── cytoscape-layers.js
│ │ │ │ ├── cytoscape-ngraph.forcelayout.js
│ │ │ │ ├── cytoscape.min.js
│ │ │ │ ├── fetch.min.js
│ │ │ │ ├── jquery-3.6.0.min.js
│ │ │ │ ├── jquery-ui.min.css
│ │ │ │ ├── jquery-ui.min.js
│ │ │ │ ├── jquery-ui.structure.min.css
│ │ │ │ ├── jquery-ui.theme.min.css
│ │ │ │ ├── jquery.blockUI.js
│ │ │ │ ├── jquery.layout-1.4.0.js
│ │ │ │ ├── resources
│ │ │ │ │ └── images
│ │ │ │ │ │ ├── busy.gif
│ │ │ │ │ │ ├── ui-icons_444444_256x240.png
│ │ │ │ │ │ ├── ui-icons_555555_256x240.png
│ │ │ │ │ │ ├── ui-icons_777620_256x240.png
│ │ │ │ │ │ ├── ui-icons_777777_256x240.png
│ │ │ │ │ │ ├── ui-icons_cc0000_256x240.png
│ │ │ │ │ │ └── ui-icons_ffffff_256x240.png
│ │ │ │ └── style.css
│ │ │ │ └── single_graph.html
│ │ │ ├── dcj_thresh_4_graph
│ │ │ ├── .snakemake_timestamp
│ │ │ ├── objects
│ │ │ │ ├── communities.pkl
│ │ │ │ ├── hub_plasmids.csv
│ │ │ │ ├── subcommunities.pkl
│ │ │ │ └── typing.tsv
│ │ │ └── visualisations
│ │ │ │ ├── communities
│ │ │ │ ├── graphs
│ │ │ │ │ └── community_0.html
│ │ │ │ ├── index.html
│ │ │ │ └── libs
│ │ │ │ │ ├── bluebird.js
│ │ │ │ │ ├── cytoscape-bubblesets.js
│ │ │ │ │ ├── cytoscape-euler.js
│ │ │ │ │ ├── cytoscape-layers.js
│ │ │ │ │ ├── cytoscape-ngraph.forcelayout.js
│ │ │ │ │ ├── cytoscape.min.js
│ │ │ │ │ ├── fetch.min.js
│ │ │ │ │ ├── jquery-3.6.0.min.js
│ │ │ │ │ ├── jquery-ui.min.css
│ │ │ │ │ ├── jquery-ui.min.js
│ │ │ │ │ ├── jquery-ui.structure.min.css
│ │ │ │ │ ├── jquery-ui.theme.min.css
│ │ │ │ │ ├── jquery.blockUI.js
│ │ │ │ │ ├── jquery.layout-1.4.0.js
│ │ │ │ │ ├── resources
│ │ │ │ │ └── images
│ │ │ │ │ │ ├── busy.gif
│ │ │ │ │ │ ├── ui-icons_444444_256x240.png
│ │ │ │ │ │ ├── ui-icons_555555_256x240.png
│ │ │ │ │ │ ├── ui-icons_777620_256x240.png
│ │ │ │ │ │ ├── ui-icons_777777_256x240.png
│ │ │ │ │ │ ├── ui-icons_cc0000_256x240.png
│ │ │ │ │ │ └── ui-icons_ffffff_256x240.png
│ │ │ │ │ └── style.css
│ │ │ │ └── subcommunities
│ │ │ │ ├── graphs
│ │ │ │ └── community_0_subcommunity_0.html
│ │ │ │ ├── index.html
│ │ │ │ └── libs
│ │ │ │ ├── bluebird.js
│ │ │ │ ├── cytoscape-bubblesets.js
│ │ │ │ ├── cytoscape-euler.js
│ │ │ │ ├── cytoscape-layers.js
│ │ │ │ ├── cytoscape-ngraph.forcelayout.js
│ │ │ │ ├── cytoscape.min.js
│ │ │ │ ├── fetch.min.js
│ │ │ │ ├── jquery-3.6.0.min.js
│ │ │ │ ├── jquery-ui.min.css
│ │ │ │ ├── jquery-ui.min.js
│ │ │ │ ├── jquery-ui.structure.min.css
│ │ │ │ ├── jquery-ui.theme.min.css
│ │ │ │ ├── jquery.blockUI.js
│ │ │ │ ├── jquery.layout-1.4.0.js
│ │ │ │ ├── resources
│ │ │ │ └── images
│ │ │ │ │ ├── busy.gif
│ │ │ │ │ ├── ui-icons_444444_256x240.png
│ │ │ │ │ ├── ui-icons_555555_256x240.png
│ │ │ │ │ ├── ui-icons_777620_256x240.png
│ │ │ │ │ ├── ui-icons_777777_256x240.png
│ │ │ │ │ ├── ui-icons_cc0000_256x240.png
│ │ │ │ │ └── ui-icons_ffffff_256x240.png
│ │ │ │ └── style.css
│ │ │ └── unimogs
│ │ │ ├── batch_0_align.unimog
│ │ │ └── batch_0_map.txt
│ ├── indel_tests
│ │ ├── input
│ │ │ ├── fastas
│ │ │ │ ├── CP055413.1.fna
│ │ │ │ ├── CP056587.1.fna
│ │ │ │ ├── LR890289.1.fna
│ │ │ │ ├── LR890465.1.fna
│ │ │ │ ├── NC_006816.1.fna
│ │ │ │ ├── NZ_CP006799.1.fna
│ │ │ │ ├── NZ_CP013657.1.fna
│ │ │ │ ├── NZ_CP019161.1.fna
│ │ │ │ ├── NZ_CP037912.1.fna
│ │ │ │ ├── NZ_CP042975.1.fna
│ │ │ │ ├── NZ_CP047745.1.fna
│ │ │ │ ├── NZ_CP051708.1.fna
│ │ │ │ ├── NZ_CP054769.1.fna
│ │ │ │ ├── NZ_CP069936.1.fna
│ │ │ │ ├── NZ_CP070577.1.fna
│ │ │ │ ├── NZ_CP072977.1.fna
│ │ │ │ ├── NZ_CP075435.1.fna
│ │ │ │ ├── NZ_CP102837.1.fna
│ │ │ │ ├── NZ_CP129874.1.fna
│ │ │ │ ├── NZ_MH477636.1.fna
│ │ │ │ ├── NZ_MK312248.1.fna
│ │ │ │ ├── NZ_MT035874.1.fna
│ │ │ │ └── NZ_MW245019.1.fna
│ │ │ ├── test_1.txt
│ │ │ ├── test_10.txt
│ │ │ ├── test_11.txt
│ │ │ ├── test_2.txt
│ │ │ ├── test_3.txt
│ │ │ ├── test_4.txt
│ │ │ ├── test_5.txt
│ │ │ ├── test_6.txt
│ │ │ ├── test_7.txt
│ │ │ ├── test_8.txt
│ │ │ └── test_9.txt
│ │ ├── test_1
│ │ │ └── truth
│ │ │ │ └── align
│ │ │ │ ├── containment
│ │ │ │ ├── all_pairs_containment_distance.tsv
│ │ │ │ └── containment_communities
│ │ │ │ │ └── objects
│ │ │ │ │ ├── communities.tsv
│ │ │ │ │ └── communities.txt
│ │ │ │ └── unimogs
│ │ │ │ ├── batch_0_align.unimog
│ │ │ │ └── batch_0_map.txt
│ │ ├── test_10
│ │ │ └── truth
│ │ │ │ └── align
│ │ │ │ ├── containment
│ │ │ │ ├── all_pairs_containment_distance.tsv
│ │ │ │ └── containment_communities
│ │ │ │ │ └── objects
│ │ │ │ │ ├── communities.tsv
│ │ │ │ │ └── communities.txt
│ │ │ │ └── unimogs
│ │ │ │ ├── batch_0_align.unimog
│ │ │ │ └── batch_0_map.txt
│ │ ├── test_11
│ │ │ └── truth
│ │ │ │ └── align
│ │ │ │ ├── containment
│ │ │ │ ├── all_pairs_containment_distance.tsv
│ │ │ │ └── containment_communities
│ │ │ │ │ └── objects
│ │ │ │ │ ├── communities.tsv
│ │ │ │ │ └── communities.txt
│ │ │ │ └── unimogs
│ │ │ │ ├── batch_0_align.unimog
│ │ │ │ └── batch_0_map.txt
│ │ ├── test_2
│ │ │ └── truth
│ │ │ │ └── align
│ │ │ │ ├── containment
│ │ │ │ ├── all_pairs_containment_distance.tsv
│ │ │ │ └── containment_communities
│ │ │ │ │ └── objects
│ │ │ │ │ ├── communities.tsv
│ │ │ │ │ └── communities.txt
│ │ │ │ └── unimogs
│ │ │ │ ├── batch_0_align.unimog
│ │ │ │ └── batch_0_map.txt
│ │ ├── test_3
│ │ │ └── truth
│ │ │ │ └── align
│ │ │ │ ├── containment
│ │ │ │ ├── all_pairs_containment_distance.tsv
│ │ │ │ └── containment_communities
│ │ │ │ │ └── objects
│ │ │ │ │ ├── communities.tsv
│ │ │ │ │ └── communities.txt
│ │ │ │ └── unimogs
│ │ │ │ ├── batch_0_align.unimog
│ │ │ │ └── batch_0_map.txt
│ │ ├── test_4
│ │ │ └── truth
│ │ │ │ └── align
│ │ │ │ ├── containment
│ │ │ │ ├── all_pairs_containment_distance.tsv
│ │ │ │ └── containment_communities
│ │ │ │ │ └── objects
│ │ │ │ │ ├── communities.tsv
│ │ │ │ │ └── communities.txt
│ │ │ │ └── unimogs
│ │ │ │ ├── batch_0_align.unimog
│ │ │ │ └── batch_0_map.txt
│ │ ├── test_5
│ │ │ └── truth
│ │ │ │ └── align
│ │ │ │ ├── containment
│ │ │ │ ├── all_pairs_containment_distance.tsv
│ │ │ │ └── containment_communities
│ │ │ │ │ └── objects
│ │ │ │ │ ├── communities.tsv
│ │ │ │ │ └── communities.txt
│ │ │ │ └── unimogs
│ │ │ │ ├── batch_0_align.unimog
│ │ │ │ └── batch_0_map.txt
│ │ ├── test_6
│ │ │ └── truth
│ │ │ │ └── align
│ │ │ │ ├── containment
│ │ │ │ ├── all_pairs_containment_distance.tsv
│ │ │ │ └── containment_communities
│ │ │ │ │ └── objects
│ │ │ │ │ ├── communities.tsv
│ │ │ │ │ └── communities.txt
│ │ │ │ └── unimogs
│ │ │ │ ├── batch_0_align.unimog
│ │ │ │ └── batch_0_map.txt
│ │ ├── test_7
│ │ │ └── truth
│ │ │ │ └── align
│ │ │ │ ├── containment
│ │ │ │ ├── all_pairs_containment_distance.tsv
│ │ │ │ └── containment_communities
│ │ │ │ │ └── objects
│ │ │ │ │ ├── communities.tsv
│ │ │ │ │ └── communities.txt
│ │ │ │ └── unimogs
│ │ │ │ ├── batch_0_align.unimog
│ │ │ │ └── batch_0_map.txt
│ │ ├── test_8
│ │ │ └── truth
│ │ │ │ └── align
│ │ │ │ ├── containment
│ │ │ │ ├── all_pairs_containment_distance.tsv
│ │ │ │ └── containment_communities
│ │ │ │ │ └── objects
│ │ │ │ │ ├── communities.tsv
│ │ │ │ │ └── communities.txt
│ │ │ │ └── unimogs
│ │ │ │ ├── batch_0_align.unimog
│ │ │ │ └── batch_0_map.txt
│ │ └── test_9
│ │ │ └── truth
│ │ │ └── align
│ │ │ ├── containment
│ │ │ ├── all_pairs_containment_distance.tsv
│ │ │ └── containment_communities
│ │ │ │ └── objects
│ │ │ │ ├── communities.tsv
│ │ │ │ └── communities.txt
│ │ │ └── unimogs
│ │ │ ├── batch_0_align.unimog
│ │ │ └── batch_0_map.txt
│ └── toy_tests
│ │ ├── input
│ │ ├── fastas
│ │ │ ├── 2_dup_3_dup.fna
│ │ │ ├── 3_dup.fna
│ │ │ ├── 3_dup_w_inverse.fna
│ │ │ ├── del_rearrange.fna
│ │ │ ├── dup_and_inverse.fna
│ │ │ ├── inverse_block.fna
│ │ │ ├── inversion.fna
│ │ │ ├── outlier.fna
│ │ │ ├── reference.fna
│ │ │ ├── reference_2.fna
│ │ │ └── reverse.fna
│ │ ├── skip.unimog
│ │ ├── test_1.txt
│ │ └── test_2.txt
│ │ ├── test_1
│ │ └── truth
│ │ │ ├── align
│ │ │ ├── all_plasmids_distances.tsv
│ │ │ ├── batches
│ │ │ │ ├── batch_0.txt
│ │ │ │ ├── batch_1.txt
│ │ │ │ ├── batch_2.txt
│ │ │ │ └── batching_info.txt
│ │ │ ├── containment
│ │ │ │ ├── all_pairs_containment_distance.tsv
│ │ │ │ └── containment_communities
│ │ │ │ │ └── objects
│ │ │ │ │ ├── communities.tsv
│ │ │ │ │ └── communities.txt
│ │ │ ├── dcj_thresh_4_graph
│ │ │ │ └── objects
│ │ │ │ │ ├── hub_plasmids.csv
│ │ │ │ │ └── typing.tsv
│ │ │ └── unimogs
│ │ │ │ ├── batch_0_align.unimog
│ │ │ │ ├── batch_0_map.txt
│ │ │ │ ├── batch_1_align.unimog
│ │ │ │ ├── batch_1_map.txt
│ │ │ │ ├── batch_2_align.unimog
│ │ │ │ └── batch_2_map.txt
│ │ │ └── skip
│ │ │ ├── all_plasmids_distances.tsv
│ │ │ ├── batches
│ │ │ ├── .snakemake_timestamp
│ │ │ ├── batch_0.txt
│ │ │ ├── batch_1.txt
│ │ │ ├── batch_2.txt
│ │ │ └── batching_info.txt
│ │ │ ├── containment
│ │ │ ├── all_pairs_containment_distance.tsv
│ │ │ └── containment_communities
│ │ │ │ ├── .snakemake_timestamp
│ │ │ │ ├── objects
│ │ │ │ ├── communities.pkl
│ │ │ │ ├── communities.tsv
│ │ │ │ ├── communities.txt
│ │ │ │ └── plasmid_graph.pkl
│ │ │ │ └── visualisations
│ │ │ │ ├── communities
│ │ │ │ ├── graphs
│ │ │ │ │ ├── community_0.html
│ │ │ │ │ └── community_1.html
│ │ │ │ ├── index.html
│ │ │ │ └── libs
│ │ │ │ │ ├── bluebird.js
│ │ │ │ │ ├── cytoscape-bubblesets.js
│ │ │ │ │ ├── cytoscape-euler.js
│ │ │ │ │ ├── cytoscape-layers.js
│ │ │ │ │ ├── cytoscape-ngraph.forcelayout.js
│ │ │ │ │ ├── cytoscape.min.js
│ │ │ │ │ ├── fetch.min.js
│ │ │ │ │ ├── jquery-3.6.0.min.js
│ │ │ │ │ ├── jquery-ui.min.css
│ │ │ │ │ ├── jquery-ui.min.js
│ │ │ │ │ ├── jquery-ui.structure.min.css
│ │ │ │ │ ├── jquery-ui.theme.min.css
│ │ │ │ │ ├── jquery.blockUI.js
│ │ │ │ │ ├── jquery.layout-1.4.0.js
│ │ │ │ │ ├── resources
│ │ │ │ │ └── images
│ │ │ │ │ │ ├── busy.gif
│ │ │ │ │ │ ├── ui-icons_444444_256x240.png
│ │ │ │ │ │ ├── ui-icons_555555_256x240.png
│ │ │ │ │ │ ├── ui-icons_777620_256x240.png
│ │ │ │ │ │ ├── ui-icons_777777_256x240.png
│ │ │ │ │ │ ├── ui-icons_cc0000_256x240.png
│ │ │ │ │ │ └── ui-icons_ffffff_256x240.png
│ │ │ │ │ └── style.css
│ │ │ │ └── single_graph
│ │ │ │ ├── libs
│ │ │ │ ├── bluebird.js
│ │ │ │ ├── cytoscape-bubblesets.js
│ │ │ │ ├── cytoscape-euler.js
│ │ │ │ ├── cytoscape-layers.js
│ │ │ │ ├── cytoscape-ngraph.forcelayout.js
│ │ │ │ ├── cytoscape.min.js
│ │ │ │ ├── fetch.min.js
│ │ │ │ ├── jquery-3.6.0.min.js
│ │ │ │ ├── jquery-ui.min.css
│ │ │ │ ├── jquery-ui.min.js
│ │ │ │ ├── jquery-ui.structure.min.css
│ │ │ │ ├── jquery-ui.theme.min.css
│ │ │ │ ├── jquery.blockUI.js
│ │ │ │ ├── jquery.layout-1.4.0.js
│ │ │ │ ├── resources
│ │ │ │ │ └── images
│ │ │ │ │ │ ├── busy.gif
│ │ │ │ │ │ ├── ui-icons_444444_256x240.png
│ │ │ │ │ │ ├── ui-icons_555555_256x240.png
│ │ │ │ │ │ ├── ui-icons_777620_256x240.png
│ │ │ │ │ │ ├── ui-icons_777777_256x240.png
│ │ │ │ │ │ ├── ui-icons_cc0000_256x240.png
│ │ │ │ │ │ └── ui-icons_ffffff_256x240.png
│ │ │ │ └── style.css
│ │ │ │ └── single_graph.html
│ │ │ └── dcj_thresh_4_graph
│ │ │ ├── .snakemake_timestamp
│ │ │ ├── objects
│ │ │ ├── communities.pkl
│ │ │ ├── hub_plasmids.csv
│ │ │ ├── subcommunities.pkl
│ │ │ └── typing.tsv
│ │ │ └── visualisations
│ │ │ ├── communities
│ │ │ ├── graphs
│ │ │ │ ├── community_0.html
│ │ │ │ └── community_1.html
│ │ │ ├── index.html
│ │ │ └── libs
│ │ │ │ ├── bluebird.js
│ │ │ │ ├── cytoscape-bubblesets.js
│ │ │ │ ├── cytoscape-euler.js
│ │ │ │ ├── cytoscape-layers.js
│ │ │ │ ├── cytoscape-ngraph.forcelayout.js
│ │ │ │ ├── cytoscape.min.js
│ │ │ │ ├── fetch.min.js
│ │ │ │ ├── jquery-3.6.0.min.js
│ │ │ │ ├── jquery-ui.min.css
│ │ │ │ ├── jquery-ui.min.js
│ │ │ │ ├── jquery-ui.structure.min.css
│ │ │ │ ├── jquery-ui.theme.min.css
│ │ │ │ ├── jquery.blockUI.js
│ │ │ │ ├── jquery.layout-1.4.0.js
│ │ │ │ ├── resources
│ │ │ │ └── images
│ │ │ │ │ ├── busy.gif
│ │ │ │ │ ├── ui-icons_444444_256x240.png
│ │ │ │ │ ├── ui-icons_555555_256x240.png
│ │ │ │ │ ├── ui-icons_777620_256x240.png
│ │ │ │ │ ├── ui-icons_777777_256x240.png
│ │ │ │ │ ├── ui-icons_cc0000_256x240.png
│ │ │ │ │ └── ui-icons_ffffff_256x240.png
│ │ │ │ └── style.css
│ │ │ └── subcommunities
│ │ │ ├── graphs
│ │ │ ├── community_0_subcommunity_0.html
│ │ │ └── community_1_subcommunity_0.html
│ │ │ ├── index.html
│ │ │ └── libs
│ │ │ ├── bluebird.js
│ │ │ ├── cytoscape-bubblesets.js
│ │ │ ├── cytoscape-euler.js
│ │ │ ├── cytoscape-layers.js
│ │ │ ├── cytoscape-ngraph.forcelayout.js
│ │ │ ├── cytoscape.min.js
│ │ │ ├── fetch.min.js
│ │ │ ├── jquery-3.6.0.min.js
│ │ │ ├── jquery-ui.min.css
│ │ │ ├── jquery-ui.min.js
│ │ │ ├── jquery-ui.structure.min.css
│ │ │ ├── jquery-ui.theme.min.css
│ │ │ ├── jquery.blockUI.js
│ │ │ ├── jquery.layout-1.4.0.js
│ │ │ ├── resources
│ │ │ └── images
│ │ │ │ ├── busy.gif
│ │ │ │ ├── ui-icons_444444_256x240.png
│ │ │ │ ├── ui-icons_555555_256x240.png
│ │ │ │ ├── ui-icons_777620_256x240.png
│ │ │ │ ├── ui-icons_777777_256x240.png
│ │ │ │ ├── ui-icons_cc0000_256x240.png
│ │ │ │ └── ui-icons_ffffff_256x240.png
│ │ │ └── style.css
│ │ └── test_2
│ │ └── truth
│ │ └── align
│ │ ├── all_plasmids_distances.tsv
│ │ ├── batches
│ │ ├── .snakemake_timestamp
│ │ ├── batch_0.txt
│ │ ├── batch_1.txt
│ │ ├── batch_10.txt
│ │ ├── batch_2.txt
│ │ ├── batch_3.txt
│ │ ├── batch_4.txt
│ │ ├── batch_5.txt
│ │ ├── batch_6.txt
│ │ ├── batch_7.txt
│ │ ├── batch_8.txt
│ │ ├── batch_9.txt
│ │ └── batching_info.txt
│ │ ├── containment
│ │ ├── all_pairs_containment_distance.tsv
│ │ └── containment_communities
│ │ │ └── objects
│ │ │ ├── communities.tsv
│ │ │ └── communities.txt
│ │ ├── dcj_thresh_4_graph
│ │ └── objects
│ │ │ ├── hub_plasmids.csv
│ │ │ └── typing.tsv
│ │ └── unimogs
│ │ ├── batch_0_align.unimog
│ │ ├── batch_0_map.txt
│ │ ├── batch_10_align.unimog
│ │ ├── batch_10_map.txt
│ │ ├── batch_1_align.unimog
│ │ ├── batch_1_map.txt
│ │ ├── batch_2_align.unimog
│ │ ├── batch_2_map.txt
│ │ ├── batch_3_align.unimog
│ │ ├── batch_3_map.txt
│ │ ├── batch_4_align.unimog
│ │ ├── batch_4_map.txt
│ │ ├── batch_5_align.unimog
│ │ ├── batch_5_map.txt
│ │ ├── batch_6_align.unimog
│ │ ├── batch_6_map.txt
│ │ ├── batch_7_align.unimog
│ │ ├── batch_7_map.txt
│ │ ├── batch_8_align.unimog
│ │ ├── batch_8_map.txt
│ │ ├── batch_9_align.unimog
│ │ └── batch_9_map.txt
└── test_unimog_tests.py
└── utils.py
/.github/workflows/ci.yaml:
--------------------------------------------------------------------------------
1 | name: Test pling
2 |
3 | on:
4 | push:
5 | branches:
6 | - main
7 | - dev
8 | pull_request:
9 | branches:
10 | - main
11 | - dev
12 |
13 | jobs:
14 | Testing:
15 | runs-on: ${{ matrix.os }}
16 | strategy:
17 | matrix:
18 | os: [ ubuntu-latest ]
19 | python-version: [ 3.9, "3.10", 3.11 ]
20 | steps:
21 | - uses: actions/checkout@v3
22 | - uses: mamba-org/setup-micromamba@v1
23 | with:
24 | micromamba-version: '1.5.8-0'
25 | environment-name: test-env
26 | condarc: |
27 | channels:
28 | - conda-forge
29 | - bioconda
30 | - defaults
31 | create-args: >-
32 | python=${{ matrix.python-version }}
33 | sourmash
34 | pandas
35 | numpy
36 | intervaltree
37 | mummer=3.23
38 | glpk=5.0
39 | snakemake=7.32.4
40 | plasnet=0.6.0
41 | dingII
42 | init-shell: bash
43 | cache-environment: true
44 | post-cleanup: 'all'
45 |
46 | - uses: eWaterCycle/setup-singularity@v7
47 | with:
48 | singularity-version: 3.7.1
49 |
50 | - name: Test
51 | shell: bash -el {0}
52 | run: |
53 | micromamba activate test-env
54 | python -m pip install .
55 | PYTHONPATH="." python -m unittest discover -s tests -t .
56 |
--------------------------------------------------------------------------------
/.gitignore:
--------------------------------------------------------------------------------
1 | .idea
2 | .snakemake
3 | __pycache__
4 | logs
5 | /.venv/
6 |
--------------------------------------------------------------------------------
/.readthedocs.yaml:
--------------------------------------------------------------------------------
1 | # .readthedocs.yaml
2 | # Read the Docs configuration file
3 | # See https://docs.readthedocs.io/en/stable/config-file/v2.html for details
4 |
5 | # Required
6 | version: 2
7 |
8 | # Set the OS, Python version and other tools you might need
9 | build:
10 | os: ubuntu-22.04
11 | tools:
12 | python: "3.12"
13 | # You can also specify other tool versions:
14 | # nodejs: "19"
15 | # rust: "1.64"
16 | # golang: "1.19"
17 |
18 | # Build documentation in the "docs/" directory with Sphinx
19 | sphinx:
20 | configuration: docs/conf.py
21 |
22 | # Optionally build your docs in additional formats such as PDF and ePub
23 | # formats:
24 | # - pdf
25 | # - epub
26 |
27 | # Optional but recommended, declare the Python requirements required
28 | # to build your documentation
29 | # See https://docs.readthedocs.io/en/stable/guides/reproducible-builds.html
30 | python:
31 | install:
32 | - requirements: docs/requirements.txt
33 |
--------------------------------------------------------------------------------
/LICENSE:
--------------------------------------------------------------------------------
1 | MIT License
2 |
3 | Copyright (c) 2023 iqbal-lab-org
4 |
5 | Permission is hereby granted, free of charge, to any person obtaining a copy
6 | of this software and associated documentation files (the "Software"), to deal
7 | in the Software without restriction, including without limitation the rights
8 | to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
9 | copies of the Software, and to permit persons to whom the Software is
10 | furnished to do so, subject to the following conditions:
11 |
12 | The above copyright notice and this permission notice shall be included in all
13 | copies or substantial portions of the Software.
14 |
15 | THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
16 | IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
17 | FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
18 | AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
19 | LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
20 | OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
21 | SOFTWARE.
22 |
--------------------------------------------------------------------------------
/MANIFEST.in:
--------------------------------------------------------------------------------
1 | include pling/resources.tsv
2 | include pling/align_snakemake/Snakefile
3 | include pling/batching/Snakefile
4 | include pling/dcj_snakemake/Snakefile
5 | include pling/common_rules/common_rules.smk
6 | include pling/jac_network_snakemake/Snakefile
7 |
--------------------------------------------------------------------------------
/README.md:
--------------------------------------------------------------------------------
1 | # Pling!
2 |
3 | Pling is a software workflow for plasmid analysis using rearrangement distances, specifically the Double Cut and Join Indel (DCJ-Indel) distance. By intelligently combining containment distance (shared content as fraction of the smaller) and DCJ-indel distance ("how far apart evolutionarily" in a structural sense), and by preventing shared mobile elements from clouding the issue, it infers clusters of related plasmids.
4 |
5 | For installation instructions and documentation, please go [here](https://pling.readthedocs.io).
6 |
--------------------------------------------------------------------------------
/docs/basic.rst:
--------------------------------------------------------------------------------
1 | Basic Usage
2 | ===========
3 |
4 | Required input is a text file of a list of paths to fasta files ``genomes_list`` and a path to an output directory ``output_dir``. All the genomes must be circular and complete. If you have all your genomes in one directory, you can navigate to that directory and generate ``genomes_list`` by running
5 |
6 | .. code-block:: console
7 |
8 | ls -d -1 $PWD/*.fasta > input.txt
9 |
10 | Then usage is
11 |
12 | .. code-block:: console
13 |
14 | pling input.txt output_dir align
15 |
16 |
17 |
--------------------------------------------------------------------------------
/docs/citation.rst:
--------------------------------------------------------------------------------
1 | Citation
2 | ========
3 |
4 | Preprint: https://doi.org/10.1101/2024.06.12.598623
5 |
--------------------------------------------------------------------------------
/docs/conf.py:
--------------------------------------------------------------------------------
1 | # Configuration file for the Sphinx documentation builder.
2 | #
3 | # This file only contains a selection of the most common options. For a full
4 | # list see the documentation:
5 | # https://www.sphinx-doc.org/en/master/usage/configuration.html
6 |
7 | # -- Path setup --------------------------------------------------------------
8 |
9 | # If extensions (or modules to document with autodoc) are in another directory,
10 | # add these directories to sys.path here. If the directory is relative to the
11 | # documentation root, use os.path.abspath to make it absolute, like shown here.
12 | #
13 | # import os
14 | # import sys
15 | # sys.path.insert(0, os.path.abspath('.'))
16 |
17 |
18 | # -- Project information -----------------------------------------------------
19 |
20 | project = "pling"
21 | copyright = "2024, Daria Frolova"
22 | author = "Daria Frolova"
23 |
24 | release = '2.0'
25 | version = '2.0.0'
26 |
27 | # -- General configuration ---------------------------------------------------
28 | # -- General configuration
29 |
30 | extensions = [
31 | "sphinx.ext.duration",
32 | "sphinx.ext.doctest",
33 | "sphinx.ext.autodoc",
34 | "sphinx.ext.autosummary",
35 | "sphinx.ext.intersphinx",
36 | ]
37 |
38 | intersphinx_mapping = {
39 | "rtd": ("https://docs.readthedocs.io/en/stable/", None),
40 | "python": ("https://docs.python.org/3/", None),
41 | "sphinx": ("https://www.sphinx-doc.org/en/master/", None),
42 | }
43 | intersphinx_disabled_domains = ["std"]
44 |
45 | templates_path = ["_templates"]
46 |
47 | # -- Options for EPUB output
48 | epub_show_urls = "footnote"
49 |
50 | # List of patterns, relative to source directory, that match files and
51 | # directories to ignore when looking for source files.
52 | # This pattern also affects html_static_path and html_extra_path.
53 | exclude_patterns = ["_build", "Thumbs.db", ".DS_Store"]
54 |
55 | # -- Options for HTML output -------------------------------------------------
56 |
57 | # The theme to use for HTML and HTML Help pages. See the documentation for
58 | # a list of builtin themes.
59 | #
60 | html_theme = "sphinx_book_theme"
61 | # Add any paths that contain custom static files (such as style sheets) here,
62 | # relative to this directory. They are copied after the builtin static files,
63 | # so a file named "default.css" will overwrite the builtin "default.css".
64 | html_static_path = ["_static"]
65 |
--------------------------------------------------------------------------------
/docs/images/com_0.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/docs/images/com_0.png
--------------------------------------------------------------------------------
/docs/images/com_0_155.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/docs/images/com_0_155.png
--------------------------------------------------------------------------------
/docs/images/com_index.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/docs/images/com_index.png
--------------------------------------------------------------------------------
/docs/images/example_1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/docs/images/example_1.png
--------------------------------------------------------------------------------
/docs/images/plasmid_cointegrates.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/docs/images/plasmid_cointegrates.png
--------------------------------------------------------------------------------
/docs/images/russian_dolls_fusion.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/docs/images/russian_dolls_fusion.png
--------------------------------------------------------------------------------
/docs/images/russian_dolls_network.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/docs/images/russian_dolls_network.png
--------------------------------------------------------------------------------
/docs/index.rst:
--------------------------------------------------------------------------------
1 | Pling!
2 | ======
3 |
4 | Pling is a software workflow for plasmid analysis using rearrangement distances, specifically the Double Cut and Join Indel (DCJ-Indel) distance. By intelligently combining containment distance (shared content as fraction of the smaller) and DCJ-indel distance ("how far apart evolutionarily" in a structural sense), and by preventing shared mobile elements from clouding the issue, it infers clusters of related plasmids.
5 |
6 | .. toctree::
7 |
8 | installation.rst
9 | basic.rst
10 | tutorial.rst
11 | output.rst
12 | advanced.rst
13 | tips.rst
14 | citation.rst
15 |
--------------------------------------------------------------------------------
/docs/installation.rst:
--------------------------------------------------------------------------------
1 | Installation
2 | ============
3 |
4 | Conda
5 | -----
6 |
7 | To install with conda, just run::
8 |
9 | conda config --add channels bioconda
10 | conda config --add channels conda-forge
11 | conda install pling
12 |
13 |
14 | From source
15 | -----------
16 |
17 | Start with::
18 |
19 | git clone https://github.com/iqbal-lab-org/pling.git && cd pling
20 |
21 | From here you can install dependancies using conda with the ``env.yaml`` file, or whichever method you prefer. To install dependancies with conda, do::
22 |
23 | conda env create -f env.yaml
24 | conda activate pling
25 |
26 | and then finally install pling with::
27 |
28 | python -m pip install .
29 |
30 |
31 | Installing optional dependancies
32 | --------------------------------
33 |
34 | By default, the DCJ-Indel distances are calculated with the open source solver GLPK. Optionally, pling can use Gurobi for its calculations, but this dependancy is not included in the usual pling installation. This is because Gurobi is a commercial software which requires a license, which is free for academic purposes. Information on obtaining this license can be found here: https://www.gurobi.com/academia/academic-program-and-licenses/. Gurobi can then be installed via conda as follows::
35 |
36 | conda config --add channels https://conda.anaconda.org/gurobi
37 | conda install gurobi=10.0.1
38 |
--------------------------------------------------------------------------------
/docs/requirements.txt:
--------------------------------------------------------------------------------
1 | sphinx==7.1.2
2 | sphinx-book-theme
3 |
--------------------------------------------------------------------------------
/env.yaml:
--------------------------------------------------------------------------------
1 | name: pling
2 | channels:
3 | - conda-forge
4 | - bioconda
5 | dependencies:
6 | - python =3.10
7 | - snakemake =7.32.4
8 | - sourmash =4.4.0
9 | - pandas =1.5.3
10 | - numpy =1.26.0
11 | - intervaltree =3.0.2
12 | - mummer =3.23
13 | - glpk =5.0
14 | - plasnet==0.6.0
15 | - dingII
16 |
--------------------------------------------------------------------------------
/pling/__init__.py:
--------------------------------------------------------------------------------
1 | import sys
2 |
3 | """
4 | Version has unique source in pyproject.toml.
5 | importlib fetches version from distribution metadata files
6 | (in dist-info or egg-info dirs).
7 | From Python 3.8, importlib_metadata is in standard library as importlib.metadata.
8 | """
9 | if sys.version_info >= (3, 8):
10 | from importlib import metadata
11 | else:
12 | import importlib_metadata as metadata
13 |
14 | __version__: str = metadata.version("pling")
15 |
16 | from .run_pling import main
17 |
18 | __all__ = ["main"]
19 |
--------------------------------------------------------------------------------
/pling/align_snakemake/Snakefile:
--------------------------------------------------------------------------------
1 | import os
2 | import pandas as pd
3 | import math
4 | from pling.utils import get_pling_root_dir, get_fasta_file_info
5 |
6 | configfile: "../config.yaml"
7 |
8 | OUTPUTPATH = config["output_dir"]
9 | PREFIX = config["prefix"]
10 | batch_size = config["batch_size"]
11 | FASTAFILES = [el[0] for el in pd.read_csv(config["genomes_list"], header=None).values]
12 | FASTAEXT = {os.path.splitext(os.path.basename(el))[0]:os.path.splitext(os.path.basename(el))[1] for el in FASTAFILES}
13 | GENOMES = list(FASTAEXT.keys())
14 |
15 | def get_regions():
16 | if config.get("regions", False):
17 | return "--regions"
18 | else:
19 | return ""
20 |
21 | def get_topology(topology):
22 | if config["topology"]=="None":
23 | return ""
24 | else:
25 | return f"--topology {topology}"
26 |
27 | include: "../common_rules/common_rules.smk"
28 |
29 | rule all:
30 | input:
31 | seq_containment = f"{OUTPUTPATH}/containment/all_pairs_containment_distance.tsv",
32 | communities = f"{OUTPUTPATH}/containment/containment_communities"
33 |
34 | rule make_unimogs:
35 | input:
36 | batch_list=lambda wildcards: f"{OUTPUTPATH}/batches/batch_{wildcards.batch}.txt"
37 | output:
38 | containment=f"{OUTPUTPATH}/tmp_files/containment_batchwise/batch_{{batch}}_containment.tsv",
39 | unimog = f"{OUTPUTPATH}/unimogs/batch_{{batch}}_align.unimog",
40 | map = f"{OUTPUTPATH}/unimogs/batch_{{batch}}_map.txt"
41 | threads: config["make_unimogs_threads"]
42 | resources:
43 | mem_mb=lambda wildcards, attempt: config["make_unimogs_mem"]*attempt
44 | params:
45 | genomes_list = config["genomes_list"],
46 | outputpath = OUTPUTPATH,
47 | identity_threshold = config["identity_threshold"],
48 | containment_distance = config["seq_containment_distance"],
49 | pling_root_dir = get_pling_root_dir(),
50 | regions = get_regions(),
51 | topology = get_topology(config["topology"])
52 | shadow: "shallow"
53 | shell:
54 | """
55 | PYTHONPATH={params.pling_root_dir} python {params.pling_root_dir}/pling/align_snakemake/unimog.py \
56 | --genomes_list {params.genomes_list} \
57 | --batch {input.batch_list} \
58 | --identity_threshold {params.identity_threshold} \
59 | --containment_distance {params.containment_distance} \
60 | --outputpath {params.outputpath} \
61 | --containment_output {output.containment} \
62 | --unimog_output {output.unimog} \
63 | --map_output {output.map} \
64 | {params.regions} \
65 | {params.topology}
66 | """
67 |
--------------------------------------------------------------------------------
/pling/batching/Snakefile:
--------------------------------------------------------------------------------
1 | from pling.utils import get_pling_root_dir
2 |
3 | OUTPUTPATH = config["output_dir"]
4 |
5 | def smash():
6 | if config.get("sourmash", False):
7 | return "--sourmash"
8 | else:
9 | return ""
10 |
11 | def get_batching_resources(type):
12 | if config.get("sourmash", False):
13 | threads = config["sourmash_threads"]
14 | mem = config["sourmash_mem"]
15 | else:
16 | threads = 1
17 | mem = 4000
18 | if type == "threads":
19 | return threads
20 | elif type == "mem":
21 | return mem
22 |
23 | rule all:
24 | input:
25 | f"{OUTPUTPATH}/batches"
26 |
27 | rule get_batches:
28 | output:
29 | directory(f"{OUTPUTPATH}/batches")
30 | params:
31 | outputpath = OUTPUTPATH,
32 | genomes_list = config["genomes_list"],
33 | batch_size = config["batch_size"],
34 | sourmash = smash(),
35 | smash_threshold = config.get("sourmash_threshold", 1),
36 | containmentpath = f"{OUTPUTPATH}/containment/not_pairs_containment_distance.tsv",
37 | pling_root_dir = get_pling_root_dir()
38 | threads: get_batching_resources("threads")
39 | resources:
40 | mem_mb=lambda wildcards, attempt: get_batching_resources("mem")*attempt
41 | shell:
42 | """
43 | PYTHONPATH={params.pling_root_dir} python {params.pling_root_dir}/pling/batching/get_batches.py \
44 | --genomes_list {params.genomes_list} \
45 | --batch_size {params.batch_size} \
46 | --outputpath {params.outputpath} \
47 | {params.sourmash} \
48 | --smash_threshold {params.smash_threshold} \
49 | --containmentpath {params.containmentpath}
50 | """
51 |
--------------------------------------------------------------------------------
/pling/common_rules/common_rules.smk:
--------------------------------------------------------------------------------
1 | # common rules and functions shared by align_snakemake and jac_network_snakemake workflows
2 | # TODO: refactor as this is a bit brittle because it requires the predefinition of the following global variables
3 | # TODO: prior to including this:
4 | # OUTPUTPATH
5 | # GENOMES
6 | from pling.utils import get_number_of_batches
7 |
8 | rule create_genomes_tsv:
9 | output:
10 | genomes_tsv = f"{OUTPUTPATH}/tmp_files/genomes.tsv"
11 | params:
12 | genomes = GENOMES
13 | run:
14 | with open(output.genomes_tsv, "w") as f:
15 | f.write("plasmid\n")
16 | for genome in params.genomes:
17 | f.write(f"{genome}\n")
18 | localrules: create_genomes_tsv
19 |
20 | rule cat_containment:
21 | input:
22 | containments = expand(f"{OUTPUTPATH}/tmp_files/containment_batchwise/batch_{{batch}}_containment.tsv", batch=[str(i) for i in range(get_number_of_batches(OUTPUTPATH))])
23 | output:
24 | all_containment_distances = f"{OUTPUTPATH}/containment/all_pairs_containment_distance.tsv"
25 | threads: 1
26 | resources:
27 | mem_mb=lambda wildcards, attempt: 4000*attempt
28 | run:
29 | with open(output.all_containment_distances, "w") as contain_out:
30 | contain_out.write("plasmid_1\tplasmid_2\tdistance\n")
31 | for file in input.containments:
32 | with open(file, "r") as f:
33 | to_cat = f.read()
34 | contain_out.write(to_cat)
35 |
36 | localrules: cat_containment
37 |
38 | def get_metadata(metadata):
39 | if metadata == "None":
40 | return ""
41 | else:
42 | return f"--plasmids-metadata {metadata}"
43 |
44 | rule get_communities:
45 | input:
46 | containment = f"{OUTPUTPATH}/containment/all_pairs_containment_distance.tsv",
47 | genomes = rules.create_genomes_tsv.output.genomes_tsv
48 | output:
49 | communities = directory(f"{OUTPUTPATH}/containment/containment_communities"),
50 | threads: 1
51 | resources:
52 | mem_mb=lambda wildcards, attempt: config["get_communities_mem"]*attempt
53 | params:
54 | containment_distance=config["seq_containment_distance"],
55 | bh_connectivity=config["bh_connectivity"],
56 | bh_neighbours_edge_density=config["bh_neighbours_edge_density"],
57 | metadata = get_metadata(config["metadata"]),
58 | output_type = config["output_type"]
59 | shell: """
60 | plasnet split \
61 | --distance-threshold {params.containment_distance} \
62 | --bh-connectivity {params.bh_connectivity} \
63 | --bh-neighbours-edge-density {params.bh_neighbours_edge_density} \
64 | --output-plasmid-graph \
65 | --output-type {params.output_type} \
66 | {params.metadata} \
67 | {input.genomes} \
68 | {input.containment} \
69 | {output.communities}
70 | """
71 |
--------------------------------------------------------------------------------
/pling/dcj_snakemake/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/pling/dcj_snakemake/__init__.py
--------------------------------------------------------------------------------
/pling/dcj_snakemake/glpk_and_ding.py:
--------------------------------------------------------------------------------
1 | import subprocess
2 |
3 | def unimog_to_ilp(unimog, lp, genome1, genome2):
4 | try:
5 | print("Converting unimog to ILP...\n")
6 | subprocess.run(f"dingII generate {unimog} -mm --writeilp {lp} -p {genome1} {genome2}", shell=True, check=True, capture_output=True)
7 | print("Completed.\n")
8 | except subprocess.CalledProcessError as e:
9 | print(e.stderr.decode())
10 | print(e)
11 | raise e
12 |
13 | def ilp_GLPK(lp, solution, snakefile_dir, timelimit):
14 | try:
15 | print("Solving ILP with GLPK...\n")
16 | subprocess.run(f"glpsol --lp {lp} -o {solution}.tmp {timelimit}", shell=True, check=True, capture_output=True)
17 | print("Completed.\n Converting GLPK output to Gurobi output...\n")
18 | subprocess.run(f"python {snakefile_dir}/glpk_sol_to_gurobi_sol.py <{solution}.tmp >{solution}", shell=True, check=True, capture_output=True)
19 | print("Completed.\n")
20 | subprocess.run(f"rm {solution}.tmp", shell=True, check=True, capture_output=True)
21 | except subprocess.CalledProcessError as e:
22 | print(e.stderr.decode())
23 | print(e)
24 | raise e
25 |
26 | def dcj_dist(unimog, solution, genome1, genome2):
27 | try:
28 | print("Parsing Gurobi output to get DCJ distances...\n")
29 | dcj_out = subprocess.run(f"dingII parsesol {unimog} --solgur {solution} -p {genome1} {genome2}", shell=True, check=True, capture_output=True, text=True).stdout
30 | dist = int(dcj_out.strip().split(" ")[2])
31 | print("Completed.\n")
32 | except subprocess.CalledProcessError as e:
33 | print(e.stderr.decode())
34 | print(e)
35 | raise e
36 | return dist
37 |
--------------------------------------------------------------------------------
/pling/dcj_snakemake/glpk_sol_to_gurobi_sol.py:
--------------------------------------------------------------------------------
1 | def glpk_sol_to_gurobi_sol(input_fh, output_fh):
2 | print("# Solution for model obj", file=output_fh)
3 |
4 | gather_solution = False
5 | solution = []
6 | for line in input_fh:
7 | line = line.strip()
8 |
9 | is_objective_line = line.startswith("Objective:")
10 | if is_objective_line:
11 | obj_value = int(line.split()[3])
12 | print(f"# Objective value = {obj_value}", file=output_fh)
13 |
14 | solution_started = line == "No. Column name Activity Lower bound Upper bound"
15 | if solution_started:
16 | gather_solution = True
17 |
18 | solution_ended = line.startswith("Integer feasibility conditions:")
19 | if solution_ended:
20 | gather_solution = False
21 |
22 | if gather_solution:
23 | solution.extend(line.split())
24 |
25 | headerless_solution = solution[13:]
26 | for number, column_name, star, activity, lower_bound, upper_bound in zip(*(iter(headerless_solution[i::6]) for i in range(0, 6))):
27 | print(column_name, activity, file=output_fh)
28 |
29 |
30 | if __name__ == "__main__":
31 | import sys
32 | sys.exit(glpk_sol_to_gurobi_sol(sys.stdin, sys.stdout))
33 |
--------------------------------------------------------------------------------
/pling/jac_network_snakemake/Snakefile:
--------------------------------------------------------------------------------
1 | import os
2 | import pandas as pd
3 | from pling.utils import get_pling_root_dir
4 | import math
5 |
6 | configfile: "../config.yaml"
7 |
8 | FASTAFILES = [el[0] for el in pd.read_csv(config["genomes_list"], header=None).values]
9 | FASTAEXT = {os.path.splitext(os.path.basename(el))[0]:os.path.splitext(os.path.basename(el))[1] for el in FASTAFILES}
10 | GENOMES = list(FASTAEXT.keys())
11 | FASTAPATH = os.path.dirname(FASTAFILES[0])
12 | OUTPUTPATH = config["output_dir"]
13 | PREFIX = config["prefix"]
14 | batch_size = config["batch_size"]
15 | number_of_batches = math.ceil((len(GENOMES)*(len(GENOMES)-1)/2)/batch_size)
16 |
17 | include: "../common_rules/common_rules.smk"
18 |
19 | rule all:
20 | input:
21 | communities = f"{OUTPUTPATH}/containment/containment_communities"
22 |
23 | rule pairwise_seq_containment:
24 | input:
25 | batch_list=lambda wildcards: f"{OUTPUTPATH}/batches/batch_{wildcards.batch}.txt"
26 | output:
27 | containment=f"{OUTPUTPATH}/tmp_files/containment_batchwise/batch_{{batch}}_containment.tsv"
28 | threads: config["pairwise_seq_containment_threads"]
29 | resources:
30 | mem_mb=lambda wildcards, attempt: config["pairwise_seq_containment_mem"]*attempt
31 | params:
32 | genomes_list = config["genomes_list"],
33 | batch = lambda wildcards: wildcards.batch,
34 | outputpath = OUTPUTPATH,
35 | identity_threshold = config["identity_threshold"],
36 | pling_root_dir = get_pling_root_dir()
37 | shadow: "shallow"
38 | shell: """
39 | PYTHONPATH={params.pling_root_dir} python {params.pling_root_dir}/pling/jac_network_snakemake/seq_containment.py \
40 | --genomes_list {params.genomes_list} \
41 | --batch {params.batch} \
42 | --identity_threshold {params.identity_threshold} \
43 | --outputpath {params.outputpath} \
44 | --containment_output {output.containment} \
45 | """
46 |
--------------------------------------------------------------------------------
/pling/resources.tsv:
--------------------------------------------------------------------------------
1 | Rule Threads Mem
2 | make_unimogs 1 10000
3 | get_communities NA 4000
4 | bakta 1 15000
5 | panaroo 1 15000
6 | minimap 1 4000
7 | consolidation NA 4000
8 | deduplication 1 10000
9 | blocks NA 4000
10 | unimog_to_ilp NA 4000
11 | ilp 1 10000
12 | dcj_dist NA 4000
13 | dcj_matrix NA 4000
14 | build_DCJ_graph NA 8000
15 | pairwise_seq_containment 1 10000
16 | sourmash 1 10000
17 |
--------------------------------------------------------------------------------
/pling/utils.py:
--------------------------------------------------------------------------------
1 | from pathlib import Path
2 | import os
3 | import pandas as pd
4 |
5 | def get_pling_root_dir() -> Path:
6 | return Path(__file__).parent.parent
7 |
8 | def get_number_of_batches(outputpath):
9 | with open(f"{outputpath}/batches/batching_info.txt") as f:
10 | batch_size, number_of_batches = f.readlines()
11 | return int(number_of_batches)
12 |
13 | def read_in_batch_pairs(filepath):
14 | pairs=[]
15 | with open(filepath,"r") as f:
16 | for line in f:
17 | genome1, genome2 = (line.strip("[]\n").split(","))
18 | pairs.append([genome1[1:-1], genome2[2:-1]])
19 | return pairs
20 |
21 | def get_fasta_file_info(genomes_list):
22 | FASTAFILES_LIST = [el[0] for el in pd.read_csv(genomes_list, header=None).values]
23 | FASTAFILES = {os.path.splitext(os.path.basename(el))[0]:el for el in FASTAFILES_LIST}
24 | FASTAEXT = {os.path.splitext(os.path.basename(el))[0]:os.path.splitext(os.path.basename(el))[1] for el in FASTAFILES_LIST}
25 | FASTAPATH = os.path.dirname(FASTAFILES_LIST[0])
26 | return FASTAFILES, FASTAEXT, FASTAPATH
27 |
--------------------------------------------------------------------------------
/pyproject.toml:
--------------------------------------------------------------------------------
1 | [build-system]
2 | requires = ["setuptools", "wheel"]
3 | build-backend = "setuptools.build_meta"
4 |
5 | [project]
6 | name = "pling"
7 | version = "2.0.0"
8 | description = "Pling computes the rearrangement distance between plasmids"
9 | authors = [{name = "Daria Frolova", email = "daria@ebi.ac.uk"}, {name = "Leandro Lima", email = "leandro@ebi.ac.uk"}]
10 | license = {text = "MIT"}
11 | readme = "README.md"
12 | keywords = ["Plasmids", "Comparative genomics", "Genome rearrangement", "DCJ-indel distance"]
13 | requires-python = ">=3.9,<3.12"
14 |
15 | [project.urls]
16 | Homepage = "https://github.com/iqbal-lab-org/pling"
17 |
18 | [project.scripts]
19 | pling = 'pling.run_pling:main'
20 |
--------------------------------------------------------------------------------
/setup.py:
--------------------------------------------------------------------------------
1 | from setuptools import setup
2 | if __name__ == "__main__":
3 | setup()
4 |
--------------------------------------------------------------------------------
/tests/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/__init__.py
--------------------------------------------------------------------------------
/tests/dcj_snakemake/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/dcj_snakemake/__init__.py
--------------------------------------------------------------------------------
/tests/dcj_snakemake/test_glpk_sol_to_gurobi_sol.py:
--------------------------------------------------------------------------------
1 | from unittest import TestCase
2 | from pling.dcj_snakemake.glpk_sol_to_gurobi_sol import glpk_sol_to_gurobi_sol
3 | from tests.utils import *
4 |
5 |
6 | class Test_glpk_sol_to_gurobi_sol(TestCase):
7 | def test_glpk_sol_to_gurobi_sol_test_case_short(self):
8 | with open("tests/dcj_snakemake/test_cases/glpk_sol_to_gurobi_sol/test_case_1/glpk.sol.txt") as input_fh, \
9 | open("tests/dcj_snakemake/test_cases/glpk_sol_to_gurobi_sol/test_case_1/glpk_to_gurobi.sol.txt", "w") as output_fh:
10 | glpk_sol_to_gurobi_sol(input_fh, output_fh)
11 | assert_files_are_identical(
12 | "tests/dcj_snakemake/test_cases/glpk_sol_to_gurobi_sol/test_case_1/glpk_to_gurobi.sol.txt",
13 | "tests/dcj_snakemake/test_cases/glpk_sol_to_gurobi_sol/test_case_1/gurobi.sol")
14 |
15 | def test_glpk_sol_to_gurobi_sol_test_case_long(self):
16 | with open("tests/dcj_snakemake/test_cases/glpk_sol_to_gurobi_sol/test_case_2/glpk.sol.txt") as input_fh, \
17 | open("tests/dcj_snakemake/test_cases/glpk_sol_to_gurobi_sol/test_case_2/glpk_to_gurobi.sol.txt", "w") as output_fh:
18 | glpk_sol_to_gurobi_sol(input_fh, output_fh)
19 | assert_files_are_identical(
20 | "tests/dcj_snakemake/test_cases/glpk_sol_to_gurobi_sol/test_case_2/glpk_to_gurobi.sol.txt",
21 | "tests/dcj_snakemake/test_cases/glpk_sol_to_gurobi_sol/test_case_2/gurobi.sol")
--------------------------------------------------------------------------------
/tests/integration_test/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/__init__.py
--------------------------------------------------------------------------------
/tests/integration_test/data/.gitignore:
--------------------------------------------------------------------------------
1 | out_*
--------------------------------------------------------------------------------
/tests/integration_test/data/all_plasmids_distances.align.truth.tsv:
--------------------------------------------------------------------------------
1 | plasmid_1 plasmid_2 distance
2 | CP057418.1 NZ_CP027199.1 21
3 | CP057418.1 NZ_LR882977.1 15
4 | NZ_CP027199.1 NZ_LR882977.1 18
5 |
--------------------------------------------------------------------------------
/tests/integration_test/data/all_plasmids_distances.anno.truth.tsv:
--------------------------------------------------------------------------------
1 | plasmid_1 plasmid_2 distance
2 | NZ_CP027199.1 CP057418.1 18
3 | NZ_LR882977.1 CP057418.1 14
4 | NZ_LR882977.1 NZ_CP027199.1 16
5 |
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMR.LIB.h3f:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMR.LIB.h3f
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMR.LIB.h3i:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMR.LIB.h3i
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMR.LIB.h3m:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMR.LIB.h3m
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMR.LIB.h3p:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMR.LIB.h3p
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMRProt-mutation.tab:
--------------------------------------------------------------------------------
1 | #taxgroup accession_version mutation_position mutation_symbol class subclass mutated_protein_name
2 | Escherichia WP_000019358.1 12 soxS_A12S MULTIDRUG AMPICILLIN/CHLORAMPHENICOL/QUINOLONE/RIFAMPIN/TETRACYCLINE Escherichia_ampicillin/chloramphenicol/quinolone/rifampin/tetracycline_resistant_SoxS
3 |
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMRProt-suppress:
--------------------------------------------------------------------------------
1 | #taxgroup protein_accession protein_gi
2 | Escherichia AAA21095.1 151858
3 |
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMRProt-susceptible.tab:
--------------------------------------------------------------------------------
1 | #taxgroup gene_symbol accession_version resistance_cutoff class subclass resistance_protein_name
2 | Streptococcus_pneumoniae pbp1a WP_001040013.1 99.000000 BETA-LACTAM BETA-LACTAM Streptococcus_pneumoniae_beta-lactam_resistant_PBP1A
3 |
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMRProt.pdb:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMRProt.pdb
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMRProt.phr:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMRProt.phr
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMRProt.pin:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMRProt.pin
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMRProt.psq:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
5 |
6 |
7 |
8 |
9 |
10 |
11 |
12 |
13 |
14 |
15 |
16 |
17 |
18 |
19 |
20 |
21 |
22 |
23 |
24 |
25 |
26 |
27 |
28 |
29 |
30 |
31 |
32 |
33 |
34 |
35 |
36 |
37 |
38 |
39 |
40 |
41 |
42 |
43 |
44 |
45 |
46 |
47 |
48 |
49 |
50 |
51 |
52 |
53 |
54 |
55 |
56 |
57 |
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMRProt.ptf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMRProt.ptf
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMRProt.pto:
--------------------------------------------------------------------------------
1 |
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMR_CDS.ndb:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMR_CDS.ndb
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMR_CDS.nhr:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMR_CDS.nhr
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMR_CDS.nin:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMR_CDS.nin
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMR_CDS.not:
--------------------------------------------------------------------------------
1 |
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMR_CDS.nsq:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMR_CDS.nsq
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMR_CDS.ntf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMR_CDS.ntf
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/AMR_CDS.nto:
--------------------------------------------------------------------------------
1 |
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/database_format_version.txt:
--------------------------------------------------------------------------------
1 | 3.10.16
2 |
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/taxgroup.tab:
--------------------------------------------------------------------------------
1 | #taxgroup gpipe_taxgroup number_of_nucl_ref_genes
2 | Acinetobacter_baumannii Acinetobacter 0
3 |
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/amrfinderplus-db/2021-09-30.1/version.txt:
--------------------------------------------------------------------------------
1 | 2021-09-30.1
2 |
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/amrfinderplus-db/latest:
--------------------------------------------------------------------------------
1 | 2021-09-30.1
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/antifam.h3f:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/antifam.h3f
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/antifam.h3i:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/antifam.h3i
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/antifam.h3m:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/antifam.h3m
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/antifam.h3p:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/antifam.h3p
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/bakta.db:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/bakta.db
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/expert-protein-sequences.dmnd:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/expert-protein-sequences.dmnd
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/ncRNA-genes.i1f:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/ncRNA-genes.i1f
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/ncRNA-genes.i1i:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/ncRNA-genes.i1i
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/ncRNA-genes.i1m:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/ncRNA-genes.i1m
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/ncRNA-genes.i1p:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/ncRNA-genes.i1p
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/ncRNA-regions.i1f:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/ncRNA-regions.i1f
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/ncRNA-regions.i1i:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/ncRNA-regions.i1i
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/ncRNA-regions.i1m:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/ncRNA-regions.i1m
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/ncRNA-regions.i1p:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/ncRNA-regions.i1p
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/oric.fna:
--------------------------------------------------------------------------------
1 | >ORI10010001
2 | TATTCTTCTATAACATTGTCAAGAATGATAGTTAAAATTCTCGAAATTGGGATATTAACTGCTTTGGAGTAATTTCTAACTTTTTGTCATACTCTTTGACTTGTATAGAAGTGTACACCTGTATCTAGTTTTTCTTGGCGTTCAACAGGAACTATTCCTGGTATTTTTGTTTTAGGTTGGGGAGGAATAGGCTGTGGTTGTGTGAATTGTTGTTGAAAATTTTGATTTTTTTGCTGTAAGAAACCATTATTATGATATTGAAAATTTTGTTCCTCTTGAAAATATCTCTCTTTTTTTGGTTTTCCAGAAAAATTTGATGAAAAAGATTTTTCTTCATTTCAATTTTCAAGATTATTTTCATTTTGTTGATTTATTTGCTCAGGCTGTTGAAATGAATTATTTTTTGATCAAAAAGATTTTGGAAAGGTTTTTTCAAAAGCAGATAAAGGTCCAAAATCAAATGAAGATGAATCTTTGTCAAAAGATGTTTCTTCTCTTTTTGACAAATTTTGTTTTTGATTAAACTTATTTTTATTTTGGGGTGTTACTTTTTCTTTTATGGAAAACAAATCTTCTTCTAAAAGACTTTGTTCTGGGTCATCATCTTGTGCTAAATCAAAGAAAAAACGTTTCTTTTTGTTA
3 | >ORI10010003
4 | GGCGTAGACACTGAATTCGATGGGGATAAGTGGTGGATAAAAGAATATAAATTAGTCATTACACTTTACTCACGAATATCCCCCTTTTTTTAGAGAAAAAATATACTTTCTTCACAAGCTTGTGTGCGGTTTTTGTTTGGTAATTCTCGAGACATAAGCACTTATCCAGATATTCACAGTTACTATTATGTGATACGACTACATTCTTTATACTTATAAGATTAATAAGGAGGAAACTAACT
5 |
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/orit.fna:
--------------------------------------------------------------------------------
1 | >CP019995|MOBP
2 | GTAGAATCGTTTAGTATGAGAATAGAAAACCAACGGTTTTCATGAACTTACTAAACGATTCTAC
3 | >CP012386|MOBP
4 | AGAACAATCAACAACTAATTAGGCAAATTAAGGGGTGCTAAACAACTGCTAGTAGGTGCTAGAGATGTGCTATAAAGGGTGCTAGTTTGGTGCTAGTTACTGCTAAATACGTGCTAGTTTAGGTGCTAGAAACGTGCTATATGGTGCTAAAAAGGTGCTAGTTTGCATGAAGTTACCTGCTAGCCAAGTGCTAGTGGCGTTCGTTTTTGGGTCCCACGGGAAAGCCTTGCACTGCAAGGCGGGTCAGCTTGTCTGACCCCCATTTCCCCTTATGCTCTTCCGAAACACAAAGCGCAATTAAGCGAATACTAGAGAATAAATA
5 |
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/pfam.h3f:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/pfam.h3f
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/pfam.h3i:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/pfam.h3i
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/pfam.h3m:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/pfam.h3m
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/pfam.h3p:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/pfam.h3p
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/psc.dmnd:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/psc.dmnd
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/rRNA.i1f:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/rRNA.i1f
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/rRNA.i1i:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/rRNA.i1i
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/rRNA.i1m:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/rRNA.i1m
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/rRNA.i1p:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/rRNA.i1p
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/rfam-go.tsv:
--------------------------------------------------------------------------------
1 | Rfam:RF00001 GO:0003735
2 |
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/sorf.dmnd:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/integration_test/data/bakta_db/sorf.dmnd
--------------------------------------------------------------------------------
/tests/integration_test/data/bakta_db/version.json:
--------------------------------------------------------------------------------
1 | {
2 | "date": "2023-02-20",
3 | "major": 5,
4 | "minor": 0,
5 | "type": "full",
6 | "dependencies": [
7 | {
8 | "name": "AMRFinderPlus",
9 | "release": "2020-09-22.2"
10 | },
11 | {
12 | "name": "COG",
13 | "release": "2014"
14 | },
15 | {
16 | "name": "DoriC",
17 | "release": "10"
18 | },
19 | {
20 | "name": "ISFinder",
21 | "release": "2019-09-25"
22 | },
23 | {
24 | "name": "Mob-suite",
25 | "release": "2.0"
26 | },
27 | {
28 | "name": "Pfam",
29 | "release": "33.1"
30 | },
31 | {
32 | "name": "RefSeq",
33 | "release": "r202"
34 | },
35 | {
36 | "name": "Rfam",
37 | "release": "14.2"
38 | },
39 | {
40 | "name": "UniProtKB/Swiss-Prot",
41 | "release": "2020_04"
42 | }
43 | ],
44 | "experts": [
45 | {
46 | "name": "AMRFinderPlus",
47 | "release": "3.10.1"
48 | },
49 | {
50 | "name": "NCBI BlastRules",
51 | "release": "4.0"
52 | }
53 | ]
54 | }
55 |
--------------------------------------------------------------------------------
/tests/integration_test/data/incy_list_4.txt:
--------------------------------------------------------------------------------
1 | tests/integration_test/data/CP057418.1.fna
2 | tests/integration_test/data/NZ_CP027199.1.fna
3 | tests/integration_test/data/NZ_LR882977.1.fna
4 | tests/integration_test/data/NZ_MF510423.1.fna
5 |
--------------------------------------------------------------------------------
/tests/integration_test/test_integration_test.py:
--------------------------------------------------------------------------------
1 | from argparse import Namespace
2 | from unittest import TestCase
3 | from pling import run_pling
4 | from tests.utils import *
5 |
6 |
7 | class Test_Pling_end_to_end(TestCase):
8 | def read_file(self, path):
9 | """Helper method to read a file."""
10 | with open(path, "rb") as f:
11 | return f.read()
12 |
13 | def assert_files_are_identical(self, path_to_first_file, path_to_second_file):
14 | first_file_content = self.read_file(path_to_first_file)
15 | second_file_content = self.read_file(path_to_second_file)
16 | self.assertEqual(first_file_content, second_file_content)
17 |
18 | def test_pling_align_end_to_end(self):
19 | args = Namespace(
20 | genomes_list='tests/integration_test/data/incy_list_4.txt',
21 | output_dir='tests/integration_test/data/out_align',
22 | integerisation='align',
23 | unimog=None,
24 | containment_distance=0.6,
25 | dcj=4,
26 | identity=80,
27 | min_indel_size=200,
28 | bh_connectivity=10,
29 | bh_neighbours_edge_density=0.2,
30 | small_subcommunity_size_threshold=4,
31 | plasmid_metadata=None,
32 | cores=2,
33 | storetmp=False,
34 | forceall=True,
35 | ilp_solver="GLPK",
36 | timelimit=None,
37 | resources=None,
38 | profile=None,
39 | batch_size=50,
40 | sourmash=False,
41 | sourmash_threshold=0.85,
42 | topology=None,
43 | regions=False,
44 | output_type="html"
45 | )
46 | run_pling.pling(args)
47 |
48 | assert_files_are_identical(
49 | "tests/integration_test/data/out_align/all_plasmids_distances.tsv",
50 | "tests/integration_test/data/all_plasmids_distances.align.truth.tsv",
51 | )
52 |
53 | if __name__ == '__main__':
54 | unittest.main()
55 |
--------------------------------------------------------------------------------
/tests/unimog_tests/__init__.py:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/__init__.py
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/all_plasmids_distances.tsv:
--------------------------------------------------------------------------------
1 | plasmid_1 plasmid_2 distance
2 | reference reverse 0
3 | reference 3_dup 1
4 | reference outlier 2
5 | reference 2_dup_3_dup 2
6 | reference 3_dup_w_inverse 2
7 | reference reference_2 2
8 | reference del_rearrange 2
9 | reference inversion 2
10 | reference dup_and_inverse 2
11 | reference inverse_block 2
12 | reverse 3_dup 1
13 | reverse outlier 2
14 | reverse 2_dup_3_dup 2
15 | reverse 3_dup_w_inverse 2
16 | reverse reference_2 2
17 | reverse del_rearrange 2
18 | reverse inversion 2
19 | reverse dup_and_inverse 2
20 | reverse inverse_block 2
21 | 3_dup outlier 2
22 | 3_dup 2_dup_3_dup 1
23 | 3_dup 3_dup_w_inverse 1
24 | 3_dup reference_2 3
25 | 3_dup del_rearrange 2
26 | 3_dup inversion 3
27 | 3_dup dup_and_inverse 3
28 | 3_dup inverse_block 3
29 | outlier 2_dup_3_dup 2
30 | outlier 3_dup_w_inverse 2
31 | outlier reference_2 2
32 | outlier del_rearrange 2
33 | outlier inversion 2
34 | outlier dup_and_inverse 2
35 | outlier inverse_block 2
36 | 2_dup_3_dup 3_dup_w_inverse 2
37 | 2_dup_3_dup reference_2 3
38 | 2_dup_3_dup del_rearrange 2
39 | 2_dup_3_dup inversion 3
40 | 2_dup_3_dup dup_and_inverse 3
41 | 2_dup_3_dup inverse_block 3
42 | 3_dup_w_inverse reference_2 3
43 | 3_dup_w_inverse del_rearrange 2
44 | 3_dup_w_inverse inversion 3
45 | 3_dup_w_inverse dup_and_inverse 3
46 | 3_dup_w_inverse inverse_block 3
47 | reference_2 del_rearrange 3
48 | reference_2 inversion 1
49 | reference_2 dup_and_inverse 2
50 | reference_2 inverse_block 1
51 | del_rearrange inversion 3
52 | del_rearrange dup_and_inverse 3
53 | del_rearrange inverse_block 3
54 | inversion dup_and_inverse 1
55 | inversion inverse_block 0
56 | dup_and_inverse inverse_block 1
57 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/batches/.snakemake_timestamp:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/batches/.snakemake_timestamp
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/batches/batch_0.txt:
--------------------------------------------------------------------------------
1 | ['reference', 'reverse']
2 | ['reference', '3_dup']
3 | ['reference', 'outlier']
4 | ['reference', '2_dup_3_dup']
5 | ['reference', '3_dup_w_inverse']
6 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/batches/batch_1.txt:
--------------------------------------------------------------------------------
1 | ['reference', 'reference_2']
2 | ['reference', 'del_rearrange']
3 | ['reference', 'inversion']
4 | ['reference', 'dup_and_inverse']
5 | ['reference', 'inverse_block']
6 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/batches/batch_10.txt:
--------------------------------------------------------------------------------
1 | ['del_rearrange', 'dup_and_inverse']
2 | ['del_rearrange', 'inverse_block']
3 | ['inversion', 'dup_and_inverse']
4 | ['inversion', 'inverse_block']
5 | ['dup_and_inverse', 'inverse_block']
6 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/batches/batch_2.txt:
--------------------------------------------------------------------------------
1 | ['reverse', '3_dup']
2 | ['reverse', 'outlier']
3 | ['reverse', '2_dup_3_dup']
4 | ['reverse', '3_dup_w_inverse']
5 | ['reverse', 'reference_2']
6 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/batches/batch_3.txt:
--------------------------------------------------------------------------------
1 | ['reverse', 'del_rearrange']
2 | ['reverse', 'inversion']
3 | ['reverse', 'dup_and_inverse']
4 | ['reverse', 'inverse_block']
5 | ['3_dup', 'outlier']
6 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/batches/batch_4.txt:
--------------------------------------------------------------------------------
1 | ['3_dup', '2_dup_3_dup']
2 | ['3_dup', '3_dup_w_inverse']
3 | ['3_dup', 'reference_2']
4 | ['3_dup', 'del_rearrange']
5 | ['3_dup', 'inversion']
6 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/batches/batch_5.txt:
--------------------------------------------------------------------------------
1 | ['3_dup', 'dup_and_inverse']
2 | ['3_dup', 'inverse_block']
3 | ['outlier', '2_dup_3_dup']
4 | ['outlier', '3_dup_w_inverse']
5 | ['outlier', 'reference_2']
6 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/batches/batch_6.txt:
--------------------------------------------------------------------------------
1 | ['outlier', 'del_rearrange']
2 | ['outlier', 'inversion']
3 | ['outlier', 'dup_and_inverse']
4 | ['outlier', 'inverse_block']
5 | ['2_dup_3_dup', '3_dup_w_inverse']
6 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/batches/batch_7.txt:
--------------------------------------------------------------------------------
1 | ['2_dup_3_dup', 'reference_2']
2 | ['2_dup_3_dup', 'del_rearrange']
3 | ['2_dup_3_dup', 'inversion']
4 | ['2_dup_3_dup', 'dup_and_inverse']
5 | ['2_dup_3_dup', 'inverse_block']
6 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/batches/batch_8.txt:
--------------------------------------------------------------------------------
1 | ['3_dup_w_inverse', 'reference_2']
2 | ['3_dup_w_inverse', 'del_rearrange']
3 | ['3_dup_w_inverse', 'inversion']
4 | ['3_dup_w_inverse', 'dup_and_inverse']
5 | ['3_dup_w_inverse', 'inverse_block']
6 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/batches/batch_9.txt:
--------------------------------------------------------------------------------
1 | ['reference_2', 'del_rearrange']
2 | ['reference_2', 'inversion']
3 | ['reference_2', 'dup_and_inverse']
4 | ['reference_2', 'inverse_block']
5 | ['del_rearrange', 'inversion']
6 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/batches/batching_info.txt:
--------------------------------------------------------------------------------
1 | 5
2 | 11
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/all_pairs_containment_distance.tsv:
--------------------------------------------------------------------------------
1 | plasmid_1 plasmid_2 distance
2 | reference reverse 0.0
3 | reference 3_dup 0.0
4 | reference outlier 1.0
5 | reference 2_dup_3_dup 0.0
6 | reference 3_dup_w_inverse 0.004930966469428033
7 | reference reference_2 0.21055226824457596
8 | reference del_rearrange 0.717948717948718
9 | reference inversion 0.21055226824457596
10 | reference dup_and_inverse 0.21055226824457596
11 | reference inverse_block 0.21055226824457596
12 | reverse 3_dup 0.0
13 | reverse outlier 1.0
14 | reverse 2_dup_3_dup 0.0
15 | reverse 3_dup_w_inverse 0.004930966469428033
16 | reverse reference_2 0.21055226824457596
17 | reverse del_rearrange 0.717948717948718
18 | reverse inversion 0.21055226824457596
19 | reverse dup_and_inverse 0.21055226824457596
20 | reverse inverse_block 0.21055226824457596
21 | 3_dup outlier 1.0
22 | 3_dup 2_dup_3_dup 0.0
23 | 3_dup 3_dup_w_inverse 0.0
24 | 3_dup reference_2 0.45221843003412965
25 | 3_dup del_rearrange 0.8047781569965871
26 | 3_dup inversion 0.45358361774744027
27 | 3_dup dup_and_inverse 0.45358361774744027
28 | 3_dup inverse_block 0.45358361774744027
29 | outlier 2_dup_3_dup 1.0
30 | outlier 3_dup_w_inverse 1.0
31 | outlier reference_2 1.0
32 | outlier del_rearrange 1.0
33 | outlier inversion 1.0
34 | outlier dup_and_inverse 1.0
35 | outlier inverse_block 1.0
36 | 2_dup_3_dup 3_dup_w_inverse 0.0
37 | 2_dup_3_dup reference_2 0.5258493353028064
38 | 2_dup_3_dup del_rearrange 0.819330385344283
39 | 2_dup_3_dup inversion 0.5270310192023634
40 | 2_dup_3_dup dup_and_inverse 0.5270310192023634
41 | 2_dup_3_dup inverse_block 0.5270310192023634
42 | 3_dup_w_inverse reference_2 0.4621160409556314
43 | 3_dup_w_inverse del_rearrange 0.8081911262798634
44 | 3_dup_w_inverse inversion 0.4621160409556314
45 | 3_dup_w_inverse dup_and_inverse 0.4621160409556314
46 | 3_dup_w_inverse inverse_block 0.4621160409556314
47 | reference_2 del_rearrange 0.0
48 | reference_2 inversion 0.004799616030717546
49 | reference_2 dup_and_inverse 0.004799616030717546
50 | reference_2 inverse_block 0.004799616030717546
51 | del_rearrange inversion 0.006317119393556503
52 | del_rearrange dup_and_inverse 0.006317119393556503
53 | del_rearrange inverse_block 0.006317119393556503
54 | inversion dup_and_inverse 0.0
55 | inversion inverse_block 0.002399808015358773
56 | dup_and_inverse inverse_block 0.0
57 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/.snakemake_timestamp:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/.snakemake_timestamp
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/objects/communities.pkl:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/objects/communities.pkl
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/objects/communities.tsv:
--------------------------------------------------------------------------------
1 | plasmid community
2 | reference community_0
3 | reverse community_0
4 | 3_dup community_0
5 | outlier community_0
6 | 2_dup_3_dup community_0
7 | 3_dup_w_inverse community_0
8 | reference_2 community_0
9 | del_rearrange community_0
10 | inversion community_0
11 | dup_and_inverse community_0
12 | inverse_block community_0
13 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/objects/communities.txt:
--------------------------------------------------------------------------------
1 | reference reverse 3_dup outlier 2_dup_3_dup 3_dup_w_inverse reference_2 del_rearrange inversion dup_and_inverse inverse_block
2 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/objects/plasmid_graph.pkl:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/objects/plasmid_graph.pkl
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/visualisations/communities/index.html:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
5 | Communities visualisation
6 |
7 |
8 |
9 |
10 | Communities visualisation
11 |
12 | View community_0 (11 nodes, 55 edges)
13 |
14 |
15 |
16 |
17 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/visualisations/communities/libs/resources/images/busy.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/visualisations/communities/libs/resources/images/busy.gif
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_444444_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_444444_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_555555_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_555555_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_777620_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_777620_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_777777_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_777777_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_cc0000_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_cc0000_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_ffffff_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_ffffff_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/visualisations/single_graph/libs/resources/images/busy.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/visualisations/single_graph/libs/resources/images/busy.gif
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_444444_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_444444_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_555555_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_555555_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_777620_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_777620_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_777777_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_777777_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_cc0000_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_cc0000_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_ffffff_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_ffffff_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/containment/not_pairs_containment_distance.tsv:
--------------------------------------------------------------------------------
1 | 3_dup_w_inverse outlier 1.0
2 | 3_dup_w_inverse del_rearrange 1.0
3 | reference_2 outlier 1.0
4 | reverse outlier 1.0
5 | reverse del_rearrange 1.0
6 | outlier reference 1.0
7 | outlier dup_and_inverse 1.0
8 | outlier inversion 1.0
9 | outlier 3_dup 1.0
10 | outlier del_rearrange 1.0
11 | outlier 2_dup_3_dup 1.0
12 | outlier inverse_block 1.0
13 | reference del_rearrange 1.0
14 | 3_dup del_rearrange 1.0
15 | del_rearrange 2_dup_3_dup 1.0
16 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/.snakemake_timestamp:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/.snakemake_timestamp
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/objects/communities.pkl:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/objects/communities.pkl
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/objects/hub_plasmids.csv:
--------------------------------------------------------------------------------
1 | hub_plasmids
2 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/objects/subcommunities.pkl:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/objects/subcommunities.pkl
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/objects/typing.tsv:
--------------------------------------------------------------------------------
1 | plasmid type
2 | reference community_0_subcommunity_0
3 | reverse community_0_subcommunity_0
4 | 3_dup community_0_subcommunity_0
5 | outlier community_0_subcommunity_0
6 | 2_dup_3_dup community_0_subcommunity_0
7 | 3_dup_w_inverse community_0_subcommunity_0
8 | reference_2 community_0_subcommunity_0
9 | del_rearrange community_0_subcommunity_0
10 | inversion community_0_subcommunity_0
11 | dup_and_inverse community_0_subcommunity_0
12 | inverse_block community_0_subcommunity_0
13 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/visualisations/communities/index.html:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
5 | Communities visualisation
6 |
7 |
8 |
9 |
10 | Communities visualisation
11 |
12 | View community_0 (11 nodes, 55 edges)
13 |
14 |
15 |
16 |
17 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/busy.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/busy.gif
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_444444_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_444444_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_555555_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_555555_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_777620_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_777620_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_777777_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_777777_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_cc0000_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_cc0000_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_ffffff_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_ffffff_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/visualisations/subcommunities/index.html:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
5 | subcommunity visualisation
6 |
7 |
8 |
9 |
10 | subcommunity visualisation
11 |
12 | View community_0_subcommunity_0 (11 nodes, 55 edges)
13 |
14 |
15 |
16 |
17 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/busy.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/busy.gif
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_444444_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_444444_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_555555_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_555555_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_777620_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_777620_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_777777_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_777777_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_cc0000_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_cc0000_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_ffffff_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_ffffff_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/unimogs/batch_0_align.unimog:
--------------------------------------------------------------------------------
1 | >reference~reverse:reference
2 | 1 )
3 | >reference~reverse:reverse
4 | -1 )
5 | >reference~3_dup:reference
6 | 1 )
7 | >reference~3_dup:3_dup
8 | 1 2 )
9 | >reference~outlier:reference
10 | 1 )
11 | >reference~outlier:outlier
12 | 2 )
13 | >reference~2_dup_3_dup:reference
14 | 1 2 3 )
15 | >reference~2_dup_3_dup:2_dup_3_dup
16 | 1 2 2 3 4 )
17 | >reference~3_dup_w_inverse:reference
18 | 1 2 )
19 | >reference~3_dup_w_inverse:3_dup_w_inverse
20 | 1 -2 3 )
21 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/unimogs/batch_0_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 | reference~reverse reference 1 1 2029
3 | reverse -1 1 2029
4 | reference~3_dup reference 1 1 2029
5 | 3_dup 1 1 2029
6 | 3_dup 2 2029 2931
7 | reference~outlierreference~2_dup_3_dup reference 1 1 550
8 | reference 2 578 1005
9 | reference 3 1033 2029
10 | 2_dup_3_dup 1 1 550
11 | 2_dup_3_dup 2 578 1005
12 | 2_dup_3_dup 2 1033 1460
13 | 2_dup_3_dup 3 1488 2484
14 | 2_dup_3_dup 4 2484 3386
15 | reference~3_dup_w_inverse reference 1 1 563
16 | reference 2 563 2019
17 | 3_dup_w_inverse 1 1 563
18 | 3_dup_w_inverse -2 563 2019
19 | 3_dup_w_inverse 3 2019 2931
20 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/unimogs/batch_10_align.unimog:
--------------------------------------------------------------------------------
1 | >del_rearrange~dup_and_inverse:del_rearrange
2 | 1 2 3 )
3 | >del_rearrange~dup_and_inverse:dup_and_inverse
4 | 4 -2 1 5 3 )
5 | >del_rearrange~inverse_block:del_rearrange
6 | 1 2 3 )
7 | >del_rearrange~inverse_block:inverse_block
8 | 2 4 -3 -1 )
9 | >inversion~dup_and_inverse:inversion
10 | 1 2 3 )
11 | >inversion~dup_and_inverse:dup_and_inverse
12 | 1 2 2 3 )
13 | >inversion~inverse_block:inversion
14 | 1 2 )
15 | >inversion~inverse_block:inverse_block
16 | -1 -2 )
17 | >dup_and_inverse~inverse_block:dup_and_inverse
18 | 1 3 2 )
19 | >dup_and_inverse~inverse_block:inverse_block
20 | -1 -2 )
21 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/unimogs/batch_10_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 | del_rearrange~dup_and_inverse del_rearrange 1 1 2355
3 | del_rearrange 2 2368 2914
4 | del_rearrange 3 2937 3147
5 | dup_and_inverse 4 1 1025
6 | dup_and_inverse -2 1025 1571
7 | dup_and_inverse 1 1594 3948
8 | dup_and_inverse 5 3948 6322
9 | dup_and_inverse 3 6322 6532
10 | del_rearrange~inverse_block del_rearrange 1 1 2342
11 | del_rearrange 2 2365 2914
12 | del_rearrange 3 2937 3147
13 | inverse_block 2 1 550
14 | inverse_block 4 550 1574
15 | inverse_block -3 1574 1784
16 | inverse_block -1 1807 4148
17 | inversion~dup_and_inverse inversion 1 1 1584
18 | inversion 2 1594 3948
19 | inversion 3 3958 4168
20 | dup_and_inverse 1 1 1584
21 | dup_and_inverse 2 1594 3948
22 | dup_and_inverse 2 3958 6312
23 | dup_and_inverse 3 6322 6532
24 | inversion~inverse_block inversion 1 1 1574
25 | inversion 2 1584 4168
26 | inverse_block -1 1 1574
27 | inverse_block -2 1574 4158
28 | dup_and_inverse~inverse_block dup_and_inverse 1 1 1574
29 | dup_and_inverse 3 1574 3938
30 | dup_and_inverse 2 3938 6532
31 | inverse_block -1 1 1574
32 | inverse_block -2 1574 4168
33 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/unimogs/batch_1_align.unimog:
--------------------------------------------------------------------------------
1 | >reference~reference_2:reference
2 | 1 3 2 )
3 | >reference~reference_2:reference_2
4 | 1 2 4 )
5 | >reference~del_rearrange:reference
6 | 1 2 )
7 | >reference~del_rearrange:del_rearrange
8 | 3 1 4 )
9 | >reference~inversion:reference
10 | 1 3 2 )
11 | >reference~inversion:inversion
12 | -2 -1 4 )
13 | >reference~dup_and_inverse:reference
14 | 1 3 2 )
15 | >reference~dup_and_inverse:dup_and_inverse
16 | -2 -1 4 )
17 | >reference~inverse_block:reference
18 | 1 3 2 )
19 | >reference~inverse_block:inverse_block
20 | 1 2 4 )
21 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/unimogs/batch_1_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 | reference~reference_2 reference 1 1 550
3 | reference 3 550 1033
4 | reference 2 1033 2029
5 | reference_2 1 1 550
6 | reference_2 2 578 1574
7 | reference_2 4 1574 4168
8 | reference~del_rearrange reference 1 1 573
9 | reference 2 573 2029
10 | del_rearrange 3 1 2365
11 | del_rearrange 1 2365 2937
12 | del_rearrange 4 2937 3167
13 | reference~inversion reference 1 1 550
14 | reference 3 550 1033
15 | reference 2 1033 2029
16 | inversion -2 1 997
17 | inversion -1 1025 1574
18 | inversion 4 1574 4168
19 | reference~dup_and_inverse reference 1 1 550
20 | reference 3 550 1033
21 | reference 2 1033 2029
22 | dup_and_inverse -2 1 997
23 | dup_and_inverse -1 1025 1574
24 | dup_and_inverse 4 1574 6532
25 | reference~inverse_block reference 1 1 550
26 | reference 3 550 1033
27 | reference 2 1033 2029
28 | inverse_block 1 1 550
29 | inverse_block 2 578 1574
30 | inverse_block 4 1574 4168
31 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/unimogs/batch_2_align.unimog:
--------------------------------------------------------------------------------
1 | >reverse~3_dup:reverse
2 | 1 )
3 | >reverse~3_dup:3_dup
4 | -1 2 )
5 | >reverse~outlier:reverse
6 | 1 )
7 | >reverse~outlier:outlier
8 | 2 )
9 | >reverse~2_dup_3_dup:reverse
10 | 1 2 3 )
11 | >reverse~2_dup_3_dup:2_dup_3_dup
12 | -3 -2 -2 -1 4 )
13 | >reverse~3_dup_w_inverse:reverse
14 | 1 2 )
15 | >reverse~3_dup_w_inverse:3_dup_w_inverse
16 | -2 1 3 )
17 | >reverse~reference_2:reverse
18 | 1 3 2 )
19 | >reverse~reference_2:reference_2
20 | -2 -1 4 )
21 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/unimogs/batch_2_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 | reverse~3_dup reverse 1 1 2029
3 | 3_dup -1 1 2029
4 | 3_dup 2 2029 2931
5 | reverse~outlierreverse~2_dup_3_dup reverse 1 1 997
6 | reverse 2 1025 1452
7 | reverse 3 1480 2029
8 | 2_dup_3_dup -3 1 550
9 | 2_dup_3_dup -2 578 1005
10 | 2_dup_3_dup -2 1033 1460
11 | 2_dup_3_dup -1 1488 2484
12 | 2_dup_3_dup 4 2484 3386
13 | reverse~3_dup_w_inverse reverse 1 11 1467
14 | reverse 2 1467 2029
15 | 3_dup_w_inverse -2 1 563
16 | 3_dup_w_inverse 1 563 2019
17 | 3_dup_w_inverse 3 2019 2931
18 | reverse~reference_2 reverse 1 1 997
19 | reverse 3 997 1480
20 | reverse 2 1480 2029
21 | reference_2 -2 1 550
22 | reference_2 -1 578 1574
23 | reference_2 4 1574 4168
24 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/unimogs/batch_3_align.unimog:
--------------------------------------------------------------------------------
1 | >reverse~del_rearrange:reverse
2 | 2 1 )
3 | >reverse~del_rearrange:del_rearrange
4 | 3 -1 4 )
5 | >reverse~inversion:reverse
6 | 1 3 2 )
7 | >reverse~inversion:inversion
8 | 1 2 4 )
9 | >reverse~dup_and_inverse:reverse
10 | 1 3 2 )
11 | >reverse~dup_and_inverse:dup_and_inverse
12 | 1 2 4 )
13 | >reverse~inverse_block:reverse
14 | 1 3 2 )
15 | >reverse~inverse_block:inverse_block
16 | -2 -1 4 )
17 | >3_dup~outlier:3_dup
18 | 1 )
19 | >3_dup~outlier:outlier
20 | 2 )
21 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/unimogs/batch_3_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 | reverse~del_rearrange reverse 2 1 1457
3 | reverse 1 1457 2029
4 | del_rearrange 3 1 2365
5 | del_rearrange -1 2365 2937
6 | del_rearrange 4 2937 3167
7 | reverse~inversion reverse 1 1 997
8 | reverse 3 997 1480
9 | reverse 2 1480 2029
10 | inversion 1 1 997
11 | inversion 2 1025 1574
12 | inversion 4 1574 4168
13 | reverse~dup_and_inverse reverse 1 1 997
14 | reverse 3 997 1480
15 | reverse 2 1480 2029
16 | dup_and_inverse 1 1 997
17 | dup_and_inverse 2 1025 1574
18 | dup_and_inverse 4 1574 6532
19 | reverse~inverse_block reverse 1 1 997
20 | reverse 3 997 1480
21 | reverse 2 1480 2029
22 | inverse_block -2 1 550
23 | inverse_block -1 578 1574
24 | inverse_block 4 1574 4168
25 | 3_dup~outlier
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/unimogs/batch_4_align.unimog:
--------------------------------------------------------------------------------
1 | >3_dup~2_dup_3_dup:3_dup
2 | 1 2 3 )
3 | >3_dup~2_dup_3_dup:2_dup_3_dup
4 | 1 2 2 3 )
5 | >3_dup~3_dup_w_inverse:3_dup
6 | 1 2 3 )
7 | >3_dup~3_dup_w_inverse:3_dup_w_inverse
8 | 1 -2 3 )
9 | >3_dup~reference_2:3_dup
10 | 1 3 2 4 )
11 | >3_dup~reference_2:reference_2
12 | 1 2 5 )
13 | >3_dup~del_rearrange:3_dup
14 | 1 2 )
15 | >3_dup~del_rearrange:del_rearrange
16 | 3 1 4 )
17 | >3_dup~inversion:3_dup
18 | 1 3 2 4 )
19 | >3_dup~inversion:inversion
20 | -2 -1 5 )
21 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/unimogs/batch_4_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 | 3_dup~2_dup_3_dup 3_dup 1 1 550
3 | 3_dup 2 578 1005
4 | 3_dup 3 1033 2931
5 | 2_dup_3_dup 1 1 550
6 | 2_dup_3_dup 2 578 1005
7 | 2_dup_3_dup 2 1033 1460
8 | 2_dup_3_dup 3 1488 3386
9 | 3_dup~3_dup_w_inverse 3_dup 1 1 563
10 | 3_dup 2 563 2019
11 | 3_dup 3 2019 2931
12 | 3_dup_w_inverse 1 1 563
13 | 3_dup_w_inverse -2 563 2019
14 | 3_dup_w_inverse 3 2019 2931
15 | 3_dup~reference_2 3_dup 1 1 550
16 | 3_dup 3 550 1033
17 | 3_dup 2 1033 2033
18 | 3_dup 4 2033 2931
19 | reference_2 1 1 550
20 | reference_2 2 578 1578
21 | reference_2 5 1578 4168
22 | 3_dup~del_rearrange 3_dup 1 1 573
23 | 3_dup 2 573 2931
24 | del_rearrange 3 1 2365
25 | del_rearrange 1 2365 2937
26 | del_rearrange 4 2937 3167
27 | 3_dup~inversion 3_dup 1 1 550
28 | 3_dup 3 550 1033
29 | 3_dup 2 1033 2029
30 | 3_dup 4 2029 2931
31 | inversion -2 1 997
32 | inversion -1 1025 1574
33 | inversion 5 1574 4168
34 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/unimogs/batch_5_align.unimog:
--------------------------------------------------------------------------------
1 | >3_dup~dup_and_inverse:3_dup
2 | 1 3 2 4 )
3 | >3_dup~dup_and_inverse:dup_and_inverse
4 | -2 -1 5 )
5 | >3_dup~inverse_block:3_dup
6 | 1 3 2 4 )
7 | >3_dup~inverse_block:inverse_block
8 | 1 2 5 )
9 | >outlier~2_dup_3_dup:outlier
10 | 1 )
11 | >outlier~2_dup_3_dup:2_dup_3_dup
12 | 2 )
13 | >outlier~3_dup_w_inverse:outlier
14 | 1 )
15 | >outlier~3_dup_w_inverse:3_dup_w_inverse
16 | 2 )
17 | >outlier~reference_2:outlier
18 | 1 )
19 | >outlier~reference_2:reference_2
20 | 2 )
21 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/unimogs/batch_5_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 | 3_dup~dup_and_inverse 3_dup 1 1 550
3 | 3_dup 3 550 1033
4 | 3_dup 2 1033 2029
5 | 3_dup 4 2029 2931
6 | dup_and_inverse -2 1 997
7 | dup_and_inverse -1 1025 1574
8 | dup_and_inverse 5 1574 6532
9 | 3_dup~inverse_block 3_dup 1 1 550
10 | 3_dup 3 550 1033
11 | 3_dup 2 1033 2029
12 | 3_dup 4 2029 2931
13 | inverse_block 1 1 550
14 | inverse_block 2 578 1574
15 | inverse_block 5 1574 4168
16 | outlier~2_dup_3_dupoutlier~3_dup_w_inverseoutlier~reference_2
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/unimogs/batch_6_align.unimog:
--------------------------------------------------------------------------------
1 | >outlier~del_rearrange:outlier
2 | 1 )
3 | >outlier~del_rearrange:del_rearrange
4 | 2 )
5 | >outlier~inversion:outlier
6 | 1 )
7 | >outlier~inversion:inversion
8 | 2 )
9 | >outlier~dup_and_inverse:outlier
10 | 1 )
11 | >outlier~dup_and_inverse:dup_and_inverse
12 | 2 )
13 | >outlier~inverse_block:outlier
14 | 1 )
15 | >outlier~inverse_block:inverse_block
16 | 2 )
17 | >2_dup_3_dup~3_dup_w_inverse:2_dup_3_dup
18 | 1 4 2 3 )
19 | >2_dup_3_dup~3_dup_w_inverse:3_dup_w_inverse
20 | 1 -2 3 )
21 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/unimogs/batch_6_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 | outlier~del_rearrangeoutlier~inversionoutlier~dup_and_inverseoutlier~inverse_block2_dup_3_dup~3_dup_w_inverse 2_dup_3_dup 1 1 563
3 | 2_dup_3_dup 4 563 1018
4 | 2_dup_3_dup 2 1018 2474
5 | 2_dup_3_dup 3 2474 3386
6 | 3_dup_w_inverse 1 1 563
7 | 3_dup_w_inverse -2 563 2019
8 | 3_dup_w_inverse 3 2019 2931
9 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/unimogs/batch_7_align.unimog:
--------------------------------------------------------------------------------
1 | >2_dup_3_dup~reference_2:2_dup_3_dup
2 | 1 3 2 4 )
3 | >2_dup_3_dup~reference_2:reference_2
4 | 1 2 5 )
5 | >2_dup_3_dup~del_rearrange:2_dup_3_dup
6 | 1 2 )
7 | >2_dup_3_dup~del_rearrange:del_rearrange
8 | 3 1 4 )
9 | >2_dup_3_dup~inversion:2_dup_3_dup
10 | 1 3 2 4 )
11 | >2_dup_3_dup~inversion:inversion
12 | -2 -1 5 )
13 | >2_dup_3_dup~dup_and_inverse:2_dup_3_dup
14 | 1 3 2 4 )
15 | >2_dup_3_dup~dup_and_inverse:dup_and_inverse
16 | -2 -1 5 )
17 | >2_dup_3_dup~inverse_block:2_dup_3_dup
18 | 1 3 2 4 )
19 | >2_dup_3_dup~inverse_block:inverse_block
20 | 1 2 5 )
21 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/unimogs/batch_7_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 | 2_dup_3_dup~reference_2 2_dup_3_dup 1 1 550
3 | 2_dup_3_dup 3 550 1488
4 | 2_dup_3_dup 2 1488 2488
5 | 2_dup_3_dup 4 2488 3386
6 | reference_2 1 1 550
7 | reference_2 2 578 1578
8 | reference_2 5 1578 4168
9 | 2_dup_3_dup~del_rearrange 2_dup_3_dup 1 1 573
10 | 2_dup_3_dup 2 573 3386
11 | del_rearrange 3 1 2365
12 | del_rearrange 1 2365 2937
13 | del_rearrange 4 2937 3167
14 | 2_dup_3_dup~inversion 2_dup_3_dup 1 1 550
15 | 2_dup_3_dup 3 550 1488
16 | 2_dup_3_dup 2 1488 2484
17 | 2_dup_3_dup 4 2484 3386
18 | inversion -2 1 997
19 | inversion -1 1025 1574
20 | inversion 5 1574 4168
21 | 2_dup_3_dup~dup_and_inverse 2_dup_3_dup 1 1 550
22 | 2_dup_3_dup 3 550 1488
23 | 2_dup_3_dup 2 1488 2484
24 | 2_dup_3_dup 4 2484 3386
25 | dup_and_inverse -2 1 997
26 | dup_and_inverse -1 1025 1574
27 | dup_and_inverse 5 1574 6532
28 | 2_dup_3_dup~inverse_block 2_dup_3_dup 1 1 550
29 | 2_dup_3_dup 3 550 1488
30 | 2_dup_3_dup 2 1488 2484
31 | 2_dup_3_dup 4 2484 3386
32 | inverse_block 1 1 550
33 | inverse_block 2 578 1574
34 | inverse_block 5 1574 4168
35 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/unimogs/batch_8_align.unimog:
--------------------------------------------------------------------------------
1 | >3_dup_w_inverse~reference_2:3_dup_w_inverse
2 | 1 2 3 )
3 | >3_dup_w_inverse~reference_2:reference_2
4 | 1 -2 4 )
5 | >3_dup_w_inverse~del_rearrange:3_dup_w_inverse
6 | 1 2 )
7 | >3_dup_w_inverse~del_rearrange:del_rearrange
8 | 3 1 4 )
9 | >3_dup_w_inverse~inversion:3_dup_w_inverse
10 | 1 2 3 )
11 | >3_dup_w_inverse~inversion:inversion
12 | 2 -1 4 )
13 | >3_dup_w_inverse~dup_and_inverse:3_dup_w_inverse
14 | 1 2 3 )
15 | >3_dup_w_inverse~dup_and_inverse:dup_and_inverse
16 | 2 -1 4 )
17 | >3_dup_w_inverse~inverse_block:3_dup_w_inverse
18 | 1 2 3 )
19 | >3_dup_w_inverse~inverse_block:inverse_block
20 | 1 -2 4 )
21 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/unimogs/batch_8_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 | 3_dup_w_inverse~reference_2 3_dup_w_inverse 1 1 550
3 | 3_dup_w_inverse 2 563 1564
4 | 3_dup_w_inverse 3 1564 2931
5 | reference_2 1 1 550
6 | reference_2 -2 563 1564
7 | reference_2 4 1564 4168
8 | 3_dup_w_inverse~del_rearrange 3_dup_w_inverse 1 1 563
9 | 3_dup_w_inverse 2 563 2931
10 | del_rearrange 3 1 2365
11 | del_rearrange 1 2365 2927
12 | del_rearrange 4 2927 3167
13 | 3_dup_w_inverse~inversion 3_dup_w_inverse 1 1 550
14 | 3_dup_w_inverse 2 563 1564
15 | 3_dup_w_inverse 3 1564 2931
16 | inversion 2 11 1012
17 | inversion -1 1025 1574
18 | inversion 4 1574 4168
19 | 3_dup_w_inverse~dup_and_inverse 3_dup_w_inverse 1 1 550
20 | 3_dup_w_inverse 2 563 1564
21 | 3_dup_w_inverse 3 1564 2931
22 | dup_and_inverse 2 11 1012
23 | dup_and_inverse -1 1025 1574
24 | dup_and_inverse 4 1574 6532
25 | 3_dup_w_inverse~inverse_block 3_dup_w_inverse 1 1 550
26 | 3_dup_w_inverse 2 563 1564
27 | 3_dup_w_inverse 3 1564 2931
28 | inverse_block 1 1 550
29 | inverse_block -2 563 1564
30 | inverse_block 4 1564 4168
31 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/unimogs/batch_9_align.unimog:
--------------------------------------------------------------------------------
1 | >reference_2~del_rearrange:reference_2
2 | 1 4 2 3 )
3 | >reference_2~del_rearrange:del_rearrange
4 | 2 1 3 )
5 | >reference_2~inversion:reference_2
6 | 1 2 )
7 | >reference_2~inversion:inversion
8 | -1 2 )
9 | >reference_2~dup_and_inverse:reference_2
10 | 1 2 )
11 | >reference_2~dup_and_inverse:dup_and_inverse
12 | -1 3 2 )
13 | >reference_2~inverse_block:reference_2
14 | 1 2 )
15 | >reference_2~inverse_block:inverse_block
16 | 1 -2 )
17 | >del_rearrange~inversion:del_rearrange
18 | 1 2 3 )
19 | >del_rearrange~inversion:inversion
20 | 4 -2 1 3 )
21 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/containment_1/truth/align/unimogs/batch_9_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 | reference_2~del_rearrange reference_2 1 1 550
3 | reference_2 4 550 1574
4 | reference_2 2 1574 3915
5 | reference_2 3 3938 4168
6 | del_rearrange 2 1 2342
7 | del_rearrange 1 2365 2914
8 | del_rearrange 3 2937 3167
9 | reference_2~inversion reference_2 1 1 1564
10 | reference_2 2 1574 4148
11 | inversion -1 11 1574
12 | inversion 2 1594 4168
13 | reference_2~dup_and_inverse reference_2 1 1 1551
14 | reference_2 2 1574 4148
15 | dup_and_inverse -1 24 1574
16 | dup_and_inverse 3 1574 3958
17 | dup_and_inverse 2 3958 6532
18 | reference_2~inverse_block reference_2 1 1 1554
19 | reference_2 2 1574 4148
20 | inverse_block 1 1 1554
21 | inverse_block -2 1574 4148
22 | del_rearrange~inversion del_rearrange 1 1 2342
23 | del_rearrange 2 2365 2914
24 | del_rearrange 3 2937 3147
25 | inversion 4 1 1025
26 | inversion -2 1025 1574
27 | inversion 1 1594 3935
28 | inversion 3 3958 4168
29 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/input/palindrome.txt:
--------------------------------------------------------------------------------
1 | tests/unimog_tests/test_cases/git_issues/input/fastas/genome_1.fna
2 | tests/unimog_tests/test_cases/git_issues/input/fastas/genome_4.fna
3 | tests/unimog_tests/test_cases/git_issues/input/fastas/genome_8.fna
4 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/all_plasmids_distances.tsv:
--------------------------------------------------------------------------------
1 | plasmid_1 plasmid_2 distance
2 | genome_1 genome_4 0
3 | genome_1 genome_8 0
4 | genome_4 genome_8 0
5 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/batches/.snakemake_timestamp:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/batches/.snakemake_timestamp
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/batches/batch_0.txt:
--------------------------------------------------------------------------------
1 | ['genome_1', 'genome_4']
2 | ['genome_1', 'genome_8']
3 | ['genome_4', 'genome_8']
4 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/batches/batching_info.txt:
--------------------------------------------------------------------------------
1 | 10
2 | 1
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/all_pairs_containment_distance.tsv:
--------------------------------------------------------------------------------
1 | plasmid_1 plasmid_2 distance
2 | genome_1 genome_4 0.0
3 | genome_1 genome_8 0.0
4 | genome_4 genome_8 0.0
5 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/.snakemake_timestamp:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/.snakemake_timestamp
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/objects/communities.pkl:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/objects/communities.pkl
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/objects/communities.tsv:
--------------------------------------------------------------------------------
1 | plasmid community
2 | genome_1 community_0
3 | genome_4 community_0
4 | genome_8 community_0
5 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/objects/communities.txt:
--------------------------------------------------------------------------------
1 | genome_1 genome_4 genome_8
2 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/objects/plasmid_graph.pkl:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/objects/plasmid_graph.pkl
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/visualisations/communities/index.html:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
5 | Communities visualisation
6 |
7 |
8 |
9 |
10 | Communities visualisation
11 |
12 | View community_0 (3 nodes, 3 edges)
13 |
14 |
15 |
16 |
17 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/visualisations/communities/libs/resources/images/busy.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/visualisations/communities/libs/resources/images/busy.gif
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_444444_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_444444_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_555555_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_555555_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_777620_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_777620_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_777777_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_777777_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_cc0000_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_cc0000_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_ffffff_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_ffffff_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/visualisations/single_graph/libs/resources/images/busy.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/visualisations/single_graph/libs/resources/images/busy.gif
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_444444_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_444444_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_555555_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_555555_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_777620_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_777620_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_777777_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_777777_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_cc0000_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_cc0000_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_ffffff_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_ffffff_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/.snakemake_timestamp:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/.snakemake_timestamp
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/objects/communities.pkl:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/objects/communities.pkl
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/objects/hub_plasmids.csv:
--------------------------------------------------------------------------------
1 | hub_plasmids
2 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/objects/subcommunities.pkl:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/objects/subcommunities.pkl
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/objects/typing.tsv:
--------------------------------------------------------------------------------
1 | plasmid type
2 | genome_1 community_0_subcommunity_0
3 | genome_4 community_0_subcommunity_0
4 | genome_8 community_0_subcommunity_0
5 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/visualisations/communities/index.html:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
5 | Communities visualisation
6 |
7 |
8 |
9 |
10 | Communities visualisation
11 |
12 | View community_0 (3 nodes, 3 edges)
13 |
14 |
15 |
16 |
17 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/busy.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/busy.gif
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_444444_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_444444_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_555555_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_555555_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_777620_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_777620_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_777777_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_777777_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_cc0000_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_cc0000_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_ffffff_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_ffffff_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/visualisations/subcommunities/index.html:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
5 | subcommunity visualisation
6 |
7 |
8 |
9 |
10 | subcommunity visualisation
11 |
12 | View community_0_subcommunity_0 (3 nodes, 3 edges)
13 |
14 |
15 |
16 |
17 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/busy.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/busy.gif
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_444444_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_444444_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_555555_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_555555_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_777620_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_777620_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_777777_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_777777_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_cc0000_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_cc0000_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_ffffff_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_ffffff_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/unimogs/batch_0_align.unimog:
--------------------------------------------------------------------------------
1 | >genome_1~genome_4:genome_1
2 | 1 )
3 | >genome_1~genome_4:genome_4
4 | -1 )
5 | >genome_1~genome_8:genome_1
6 | 1 2 )
7 | >genome_1~genome_8:genome_8
8 | 2 1 )
9 | >genome_4~genome_8:genome_4
10 | 1 2 )
11 | >genome_4~genome_8:genome_8
12 | -1 -2 )
13 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/git_issues/palindrome/truth/align/unimogs/batch_0_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 | genome_1~genome_4 genome_1 1 1 4117
3 | genome_4 -1 1 4117
4 | genome_1~genome_8 genome_1 1 1 2701
5 | genome_1 2 2701 4117
6 | genome_8 2 1 1417
7 | genome_8 1 1417 4117
8 | genome_4~genome_8 genome_4 1 1 1417
9 | genome_4 2 1417 4117
10 | genome_8 -1 1 1417
11 | genome_8 -2 1417 4117
12 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/input/test_1.txt:
--------------------------------------------------------------------------------
1 | tests/unimog_tests/test_cases/indel_tests/input/fastas/NZ_MK312248.1.fna
2 | tests/unimog_tests/test_cases/indel_tests/input/fastas/NZ_CP129874.1.fna
3 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/input/test_10.txt:
--------------------------------------------------------------------------------
1 | tests/unimog_tests/test_cases/indel_tests/input/fastas/LR890289.1.fna
2 | tests/unimog_tests/test_cases/indel_tests/input/fastas/NZ_CP013657.1.fna
3 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/input/test_11.txt:
--------------------------------------------------------------------------------
1 | tests/unimog_tests/test_cases/indel_tests/input/fastas/LR890465.1.fna
2 | tests/unimog_tests/test_cases/indel_tests/input/fastas/NZ_CP054769.1.fna
3 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/input/test_2.txt:
--------------------------------------------------------------------------------
1 | tests/unimog_tests/test_cases/indel_tests/input/fastas/CP056587.1.fna
2 | tests/unimog_tests/test_cases/indel_tests/input/fastas/CP055413.1.fna
3 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/input/test_3.txt:
--------------------------------------------------------------------------------
1 | tests/unimog_tests/test_cases/indel_tests/input/fastas/NZ_MH477636.1.fna
2 | tests/unimog_tests/test_cases/indel_tests/input/fastas/NZ_CP047745.1.fna
3 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/input/test_4.txt:
--------------------------------------------------------------------------------
1 | tests/unimog_tests/test_cases/indel_tests/input/fastas/NZ_CP102837.1.fna
2 | tests/unimog_tests/test_cases/indel_tests/input/fastas/NZ_CP019161.1.fna
3 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/input/test_5.txt:
--------------------------------------------------------------------------------
1 | tests/unimog_tests/test_cases/indel_tests/input/fastas/NZ_CP006799.1.fna
2 | tests/unimog_tests/test_cases/indel_tests/input/fastas/NZ_MW245019.1.fna
3 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/input/test_6.txt:
--------------------------------------------------------------------------------
1 | tests/unimog_tests/test_cases/indel_tests/input/fastas/NZ_CP037912.1.fna
2 | tests/unimog_tests/test_cases/indel_tests/input/fastas/NZ_CP069936.1.fna
3 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/input/test_7.txt:
--------------------------------------------------------------------------------
1 | tests/unimog_tests/test_cases/indel_tests/input/fastas/NZ_CP070577.1.fna
2 | tests/unimog_tests/test_cases/indel_tests/input/fastas/NZ_CP075435.1.fna
3 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/input/test_8.txt:
--------------------------------------------------------------------------------
1 | tests/unimog_tests/test_cases/indel_tests/input/fastas/NZ_CP072977.1.fna
2 | tests/unimog_tests/test_cases/indel_tests/input/fastas/NC_006816.1.fna
3 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/input/test_9.txt:
--------------------------------------------------------------------------------
1 | tests/unimog_tests/test_cases/indel_tests/input/fastas/NZ_CP042975.1.fna
2 | tests/unimog_tests/test_cases/indel_tests/input/fastas/NZ_MT035874.1.fna
3 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_1/truth/align/containment/all_pairs_containment_distance.tsv:
--------------------------------------------------------------------------------
1 | plasmid_1 plasmid_2 distance
2 | NZ_MK312248.1 NZ_CP129874.1 0.5265530961949894
3 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_1/truth/align/containment/containment_communities/objects/communities.tsv:
--------------------------------------------------------------------------------
1 | plasmid community
2 | NZ_MK312248.1 community_0
3 | NZ_CP129874.1 community_0
4 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_1/truth/align/containment/containment_communities/objects/communities.txt:
--------------------------------------------------------------------------------
1 | NZ_MK312248.1 NZ_CP129874.1
2 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_1/truth/align/unimogs/batch_0_align.unimog:
--------------------------------------------------------------------------------
1 | >NZ_MK312248.1~NZ_CP129874.1:NZ_MK312248.1
2 | 1 19 2 20 3 21 4 22 5 6 7 23 8 9 24 10 11 12 13 25 14 26 15 27 4 16 17 18 )
3 | >NZ_MK312248.1~NZ_CP129874.1:NZ_CP129874.1
4 | 29 -5 30 -15 31 3 32 14 33 -7 -6 -13 34 -12 -11 -10 35 -9 36 -8 37 4 16 38 2 -1 -18 -17 39 )
5 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_1/truth/align/unimogs/batch_0_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 | NZ_MK312248.1~NZ_CP129874.1 NZ_MK312248.1 1 1 4691
3 | NZ_MK312248.1 19 4691 13228
4 | NZ_MK312248.1 2 13228 13651
5 | NZ_MK312248.1 20 13651 22788
6 | NZ_MK312248.1 3 22788 23737
7 | NZ_MK312248.1 21 23737 41909
8 | NZ_MK312248.1 4 41909 43262
9 | NZ_MK312248.1 22 43262 49172
10 | NZ_MK312248.1 5 49172 56005
11 | NZ_MK312248.1 6 55996 56294
12 | NZ_MK312248.1 7 56490 56913
13 | NZ_MK312248.1 23 56913 63358
14 | NZ_MK312248.1 8 63358 64089
15 | NZ_MK312248.1 9 64081 64847
16 | NZ_MK312248.1 24 64847 70218
17 | NZ_MK312248.1 10 70218 72176
18 | NZ_MK312248.1 11 72371 81754
19 | NZ_MK312248.1 12 81948 90468
20 | NZ_MK312248.1 13 90462 91214
21 | NZ_MK312248.1 25 91214 92780
22 | NZ_MK312248.1 14 92780 93085
23 | NZ_MK312248.1 26 93085 103201
24 | NZ_MK312248.1 15 103201 104397
25 | NZ_MK312248.1 27 104397 110971
26 | NZ_MK312248.1 4 110971 112410
27 | NZ_MK312248.1 16 112410 115261
28 | NZ_MK312248.1 17 115354 115658
29 | NZ_MK312248.1 18 115854 120731
30 | NZ_CP129874.1 29 1 8135
31 | NZ_CP129874.1 -5 8135 14967
32 | NZ_CP129874.1 30 14967 16434
33 | NZ_CP129874.1 -15 16434 17630
34 | NZ_CP129874.1 31 17630 26632
35 | NZ_CP129874.1 3 26632 27571
36 | NZ_CP129874.1 32 27571 31025
37 | NZ_CP129874.1 14 31025 31330
38 | NZ_CP129874.1 33 31330 36677
39 | NZ_CP129874.1 -7 36677 37100
40 | NZ_CP129874.1 -6 37199 37497
41 | NZ_CP129874.1 -13 37497 38249
42 | NZ_CP129874.1 34 38249 39344
43 | NZ_CP129874.1 -12 39344 47910
44 | NZ_CP129874.1 -11 48007 57490
45 | NZ_CP129874.1 -10 57588 59545
46 | NZ_CP129874.1 35 59545 62954
47 | NZ_CP129874.1 -9 62954 63720
48 | NZ_CP129874.1 36 63720 71832
49 | NZ_CP129874.1 -8 71832 72577
50 | NZ_CP129874.1 37 72577 79011
51 | NZ_CP129874.1 4 79011 80364
52 | NZ_CP129874.1 16 80364 83212
53 | NZ_CP129874.1 38 83212 87393
54 | NZ_CP129874.1 2 87393 87816
55 | NZ_CP129874.1 -1 87915 92605
56 | NZ_CP129874.1 -18 92605 97579
57 | NZ_CP129874.1 -17 97678 97981
58 | NZ_CP129874.1 39 97981 100027
59 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_10/truth/align/containment/all_pairs_containment_distance.tsv:
--------------------------------------------------------------------------------
1 | plasmid_1 plasmid_2 distance
2 | LR890289.1 NZ_CP013657.1 0.300219829145449
3 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_10/truth/align/containment/containment_communities/objects/communities.tsv:
--------------------------------------------------------------------------------
1 | plasmid community
2 | LR890289.1 community_0
3 | NZ_CP013657.1 community_0
4 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_10/truth/align/containment/containment_communities/objects/communities.txt:
--------------------------------------------------------------------------------
1 | LR890289.1 NZ_CP013657.1
2 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_10/truth/align/unimogs/batch_0_align.unimog:
--------------------------------------------------------------------------------
1 | >LR890289.1~NZ_CP013657.1:LR890289.1
2 | 34 1 35 2 3 4 5 6 7 36 8 37 9 38 10 11 39 12 13 40 14 15 41 16 42 17 43 18 19 44 20 21 22 45 23 46 24 47 25 48 26 49 27 50 28 51 29 52 30 31 32 53 33 9 54 )
3 | >LR890289.1~NZ_CP013657.1:NZ_CP013657.1
4 | -12 -8 56 -1 57 -9 -33 58 -19 59 -18 60 -32 61 -31 62 -30 -29 63 -28 64 -27 -7 6 65 15 11 14 66 -26 67 -25 -24 -23 68 -22 69 -21 70 -20 -9 71 -17 -16 72 10 11 -4 -3 -2 4 5 -13 )
5 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_11/truth/align/containment/all_pairs_containment_distance.tsv:
--------------------------------------------------------------------------------
1 | plasmid_1 plasmid_2 distance
2 | NZ_CP054769.1 LR890465.1 0.0562722397120502
3 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_11/truth/align/containment/containment_communities/objects/communities.tsv:
--------------------------------------------------------------------------------
1 | plasmid community
2 | NZ_CP054769.1 community_0
3 | LR890465.1 community_0
4 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_11/truth/align/containment/containment_communities/objects/communities.txt:
--------------------------------------------------------------------------------
1 | NZ_CP054769.1 LR890465.1
2 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_11/truth/align/unimogs/batch_0_align.unimog:
--------------------------------------------------------------------------------
1 | >NZ_CP054769.1~LR890465.1:NZ_CP054769.1
2 | 1 2 16 3 17 4 18 5 6 8 7 -6 9 19 10 20 11 12 13 14 15 )
3 | >NZ_CP054769.1~LR890465.1:LR890465.1
4 | 1 22 2 23 3 4 5 6 -7 24 8 25 -6 9 26 10 11 12 12 13 14 14 15 )
5 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_11/truth/align/unimogs/batch_0_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 | NZ_CP054769.1~LR890465.1 NZ_CP054769.1 1 1 12705
3 | NZ_CP054769.1 2 12696 18655
4 | NZ_CP054769.1 16 18655 24717
5 | NZ_CP054769.1 3 24717 32410
6 | NZ_CP054769.1 17 32410 33738
7 | NZ_CP054769.1 4 33738 34319
8 | NZ_CP054769.1 18 34319 35523
9 | NZ_CP054769.1 5 35523 42961
10 | NZ_CP054769.1 6 42961 43734
11 | NZ_CP054769.1 8 43733 76605
12 | NZ_CP054769.1 7 76605 78941
13 | NZ_CP054769.1 -6 78941 79714
14 | NZ_CP054769.1 9 79714 81375
15 | NZ_CP054769.1 19 81375 82570
16 | NZ_CP054769.1 10 82570 87194
17 | NZ_CP054769.1 20 87194 88398
18 | NZ_CP054769.1 11 88398 175809
19 | NZ_CP054769.1 12 175875 176229
20 | NZ_CP054769.1 13 176295 178144
21 | NZ_CP054769.1 14 178146 191864
22 | NZ_CP054769.1 15 191864 195035
23 | LR890465.1 1 1 12699
24 | LR890465.1 22 12699 13755
25 | LR890465.1 2 13755 19714
26 | LR890465.1 23 19714 44203
27 | LR890465.1 3 44203 51896
28 | LR890465.1 4 51897 52478
29 | LR890465.1 5 52482 59920
30 | LR890465.1 6 59920 60693
31 | LR890465.1 -7 60693 63029
32 | LR890465.1 24 63029 68118
33 | LR890465.1 8 68118 100990
34 | LR890465.1 25 100990 104984
35 | LR890465.1 -6 104984 105757
36 | LR890465.1 9 105757 107418
37 | LR890465.1 26 107418 122401
38 | LR890465.1 10 122401 127026
39 | LR890465.1 11 127030 214475
40 | LR890465.1 12 214541 214895
41 | LR890465.1 12 214961 215188
42 | LR890465.1 13 215338 217187
43 | LR890465.1 14 217189 230977
44 | LR890465.1 14 217190 230918
45 | LR890465.1 15 230918 233933
46 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_2/truth/align/containment/all_pairs_containment_distance.tsv:
--------------------------------------------------------------------------------
1 | plasmid_1 plasmid_2 distance
2 | CP056587.1 CP055413.1 0.39788832415213404
3 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_2/truth/align/containment/containment_communities/objects/communities.tsv:
--------------------------------------------------------------------------------
1 | plasmid community
2 | CP056587.1 community_0
3 | CP055413.1 community_0
4 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_2/truth/align/containment/containment_communities/objects/communities.txt:
--------------------------------------------------------------------------------
1 | CP056587.1 CP055413.1
2 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_2/truth/align/unimogs/batch_0_align.unimog:
--------------------------------------------------------------------------------
1 | >CP056587.1~CP055413.1:CP056587.1
2 | 31 1 2 32 3 33 4 5 6 34 7 35 -5 8 36 9 37 10 38 8 39 11 40 12 13 41 14 42 15 16 17 18 19 43 20 44 21 22 23 45 24 46 25 47 26 27 48 28 29 49 -12 50 30 )
3 | >CP056587.1~CP055413.1:CP055413.1
4 | 54 -27 55 -25 56 -14 57 -13 58 -26 59 24 28 60 -30 20 61 -21 -19 62 -18 -11 -17 -16 -15 63 -2 64 -7 -6 -5 8 65 -23 66 -22 9 67 8 68 1 10 3 69 29 70 12 71 -4 72 )
5 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_3/truth/align/containment/all_pairs_containment_distance.tsv:
--------------------------------------------------------------------------------
1 | plasmid_1 plasmid_2 distance
2 | NZ_MH477636.1 NZ_CP047745.1 0.4423384943940203
3 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_3/truth/align/containment/containment_communities/objects/communities.tsv:
--------------------------------------------------------------------------------
1 | plasmid community
2 | NZ_MH477636.1 community_0
3 | NZ_CP047745.1 community_0
4 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_3/truth/align/containment/containment_communities/objects/communities.txt:
--------------------------------------------------------------------------------
1 | NZ_MH477636.1 NZ_CP047745.1
2 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_3/truth/align/unimogs/batch_0_align.unimog:
--------------------------------------------------------------------------------
1 | >NZ_MH477636.1~NZ_CP047745.1:NZ_MH477636.1
2 | 1 12 2 3 13 4 14 5 15 6 7 16 8 17 9 18 10 19 11 )
3 | >NZ_MH477636.1~NZ_CP047745.1:NZ_CP047745.1
4 | 7 20 8 21 -10 22 -3 23 5 24 -2 25 -1 -11 26 4 9 27 6 )
5 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_3/truth/align/unimogs/batch_0_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 | NZ_MH477636.1~NZ_CP047745.1 NZ_MH477636.1 1 1 958
3 | NZ_MH477636.1 12 958 1334
4 | NZ_MH477636.1 2 1334 11910
5 | NZ_MH477636.1 3 11910 13696
6 | NZ_MH477636.1 13 13696 18115
7 | NZ_MH477636.1 4 18115 19233
8 | NZ_MH477636.1 14 19233 21757
9 | NZ_MH477636.1 5 21757 22188
10 | NZ_MH477636.1 15 22188 27318
11 | NZ_MH477636.1 6 27318 27760
12 | NZ_MH477636.1 7 27760 28634
13 | NZ_MH477636.1 16 28634 29196
14 | NZ_MH477636.1 8 29196 30119
15 | NZ_MH477636.1 17 30119 104442
16 | NZ_MH477636.1 9 104442 105263
17 | NZ_MH477636.1 18 105263 140851
18 | NZ_MH477636.1 10 140851 141618
19 | NZ_MH477636.1 19 141618 161771
20 | NZ_MH477636.1 11 161771 163589
21 | NZ_CP047745.1 7 1 875
22 | NZ_CP047745.1 20 875 3238
23 | NZ_CP047745.1 8 3238 4161
24 | NZ_CP047745.1 21 4161 4943
25 | NZ_CP047745.1 -10 4943 5709
26 | NZ_CP047745.1 22 5709 9715
27 | NZ_CP047745.1 -3 9715 11501
28 | NZ_CP047745.1 23 11501 12475
29 | NZ_CP047745.1 5 12475 12906
30 | NZ_CP047745.1 24 12906 13870
31 | NZ_CP047745.1 -2 13870 24590
32 | NZ_CP047745.1 25 24590 24823
33 | NZ_CP047745.1 -1 24823 25780
34 | NZ_CP047745.1 -11 25780 27598
35 | NZ_CP047745.1 26 27598 28819
36 | NZ_CP047745.1 4 28819 29937
37 | NZ_CP047745.1 9 29938 30759
38 | NZ_CP047745.1 27 30759 37019
39 | NZ_CP047745.1 6 37019 37461
40 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_4/truth/align/containment/all_pairs_containment_distance.tsv:
--------------------------------------------------------------------------------
1 | plasmid_1 plasmid_2 distance
2 | NZ_CP102837.1 NZ_CP019161.1 0.45683174515207026
3 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_4/truth/align/containment/containment_communities/objects/communities.tsv:
--------------------------------------------------------------------------------
1 | plasmid community
2 | NZ_CP102837.1 community_0
3 | NZ_CP019161.1 community_0
4 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_4/truth/align/containment/containment_communities/objects/communities.txt:
--------------------------------------------------------------------------------
1 | NZ_CP102837.1 NZ_CP019161.1
2 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_4/truth/align/unimogs/batch_0_align.unimog:
--------------------------------------------------------------------------------
1 | >NZ_CP102837.1~NZ_CP019161.1:NZ_CP102837.1
2 | 26 6 27 -2 13 28 12 29 8 30 11 7 5 31 4 3 2 1 25 32 24 33 23 22 21 34 20 35 19 36 16 37 17 18 15 38 14 39 10 40 9 41 -7 42 )
3 | >NZ_CP102837.1~NZ_CP019161.1:NZ_CP019161.1
4 | -1 -2 45 -3 46 -4 47 -5 48 -6 49 -7 50 8 51 -9 52 -10 53 11 54 -12 55 -13 56 -14 57 -15 58 16 59 17 17 18 60 -19 -20 -21 -22 61 -23 -24 -25 )
5 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_5/truth/align/containment/all_pairs_containment_distance.tsv:
--------------------------------------------------------------------------------
1 | plasmid_1 plasmid_2 distance
2 | NZ_CP006799.1 NZ_MW245019.1 0.31148564955482394
3 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_5/truth/align/containment/containment_communities/objects/communities.tsv:
--------------------------------------------------------------------------------
1 | plasmid community
2 | NZ_CP006799.1 community_0
3 | NZ_MW245019.1 community_0
4 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_5/truth/align/containment/containment_communities/objects/communities.txt:
--------------------------------------------------------------------------------
1 | NZ_CP006799.1 NZ_MW245019.1
2 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_5/truth/align/unimogs/batch_0_align.unimog:
--------------------------------------------------------------------------------
1 | >NZ_CP006799.1~NZ_MW245019.1:NZ_CP006799.1
2 | 21 31 38 33 28 39 17 40 18 19 41 23 42 24 43 25 26 44 35 36 45 27 22 46 32 47 16 48 15 14 13 12 49 34 50 29 51 11 10 8 52 7 53 6 5 4 54 3 55 2 1 37 9 56 30 20 )
3 | >NZ_CP006799.1~NZ_MW245019.1:NZ_MW245019.1
4 | -1 57 -2 58 -3 -4 59 -5 60 -6 61 -7 62 -8 9 -10 63 -11 64 -12 65 -13 -9 -14 -15 66 -16 67 17 68 18 69 19 70 20 21 71 -22 23 24 25 72 26 -27 73 -28 74 -29 30 31 -32 75 33 -34 76 35 77 36 -37 )
5 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_6/truth/align/containment/all_pairs_containment_distance.tsv:
--------------------------------------------------------------------------------
1 | plasmid_1 plasmid_2 distance
2 | NZ_CP037912.1 NZ_CP069936.1 0.4700967686834855
3 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_6/truth/align/containment/containment_communities/objects/communities.tsv:
--------------------------------------------------------------------------------
1 | plasmid community
2 | NZ_CP037912.1 community_0
3 | NZ_CP069936.1 community_0
4 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_6/truth/align/containment/containment_communities/objects/communities.txt:
--------------------------------------------------------------------------------
1 | NZ_CP037912.1 NZ_CP069936.1
2 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_6/truth/align/unimogs/batch_0_align.unimog:
--------------------------------------------------------------------------------
1 | >NZ_CP037912.1~NZ_CP069936.1:NZ_CP037912.1
2 | 21 17 22 20 23 19 18 17 24 16 25 15 14 26 13 27 12 28 11 10 29 9 30 8 31 7 32 6 33 5 34 4 35 3 36 2 37 1 38 )
3 | >NZ_CP037912.1~NZ_CP069936.1:NZ_CP069936.1
4 | 40 -1 -2 41 -3 -4 -5 -6 42 -7 43 -8 -9 -10 44 -11 45 -12 46 -13 47 -14 48 -15 -16 -17 49 -17 -17 -18 50 -19 51 20 52 )
5 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_6/truth/align/unimogs/batch_0_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 | NZ_CP037912.1~NZ_CP069936.1 NZ_CP037912.1 21 1 11471
3 | NZ_CP037912.1 17 11471 12240
4 | NZ_CP037912.1 22 12240 20064
5 | NZ_CP037912.1 20 20064 21397
6 | NZ_CP037912.1 23 21397 22138
7 | NZ_CP037912.1 19 22138 32160
8 | NZ_CP037912.1 18 32157 42440
9 | NZ_CP037912.1 17 42441 43209
10 | NZ_CP037912.1 24 43209 58760
11 | NZ_CP037912.1 16 58760 61577
12 | NZ_CP037912.1 25 61577 65280
13 | NZ_CP037912.1 15 65280 65641
14 | NZ_CP037912.1 14 65638 76539
15 | NZ_CP037912.1 26 76539 76904
16 | NZ_CP037912.1 13 76904 78717
17 | NZ_CP037912.1 27 78717 79024
18 | NZ_CP037912.1 12 79024 79601
19 | NZ_CP037912.1 28 79601 80618
20 | NZ_CP037912.1 11 80618 85670
21 | NZ_CP037912.1 10 85667 85900
22 | NZ_CP037912.1 29 85900 87478
23 | NZ_CP037912.1 9 87478 92124
24 | NZ_CP037912.1 30 92124 92532
25 | NZ_CP037912.1 8 92532 93592
26 | NZ_CP037912.1 31 93592 94145
27 | NZ_CP037912.1 7 94145 95975
28 | NZ_CP037912.1 32 95975 96246
29 | NZ_CP037912.1 6 96246 97480
30 | NZ_CP037912.1 33 97480 97846
31 | NZ_CP037912.1 5 97846 103559
32 | NZ_CP037912.1 34 103559 104356
33 | NZ_CP037912.1 4 104356 112617
34 | NZ_CP037912.1 35 112617 113632
35 | NZ_CP037912.1 3 113632 115140
36 | NZ_CP037912.1 36 115140 116654
37 | NZ_CP037912.1 2 116654 117934
38 | NZ_CP037912.1 37 117934 120651
39 | NZ_CP037912.1 1 120651 121389
40 | NZ_CP037912.1 38 121389 149305
41 | NZ_CP069936.1 40 1 26231
42 | NZ_CP069936.1 -1 26231 26972
43 | NZ_CP069936.1 -2 26982 28263
44 | NZ_CP069936.1 41 28263 28632
45 | NZ_CP069936.1 -3 28632 30147
46 | NZ_CP069936.1 -4 30195 38438
47 | NZ_CP069936.1 -5 38496 44211
48 | NZ_CP069936.1 -6 44232 45466
49 | NZ_CP069936.1 42 45466 45742
50 | NZ_CP069936.1 -7 45742 47572
51 | NZ_CP069936.1 43 47572 48083
52 | NZ_CP069936.1 -8 48083 49143
53 | NZ_CP069936.1 -9 49216 53857
54 | NZ_CP069936.1 -10 53926 54159
55 | NZ_CP069936.1 44 54159 55469
56 | NZ_CP069936.1 -11 55469 60667
57 | NZ_CP069936.1 45 60667 61832
58 | NZ_CP069936.1 -12 61832 62402
59 | NZ_CP069936.1 46 62402 62708
60 | NZ_CP069936.1 -13 62708 64521
61 | NZ_CP069936.1 47 64521 64885
62 | NZ_CP069936.1 -14 64885 75596
63 | NZ_CP069936.1 48 75596 79336
64 | NZ_CP069936.1 -15 79336 79696
65 | NZ_CP069936.1 -16 79826 82691
66 | NZ_CP069936.1 -17 82753 83521
67 | NZ_CP069936.1 49 83521 88847
68 | NZ_CP069936.1 -17 88847 89615
69 | NZ_CP069936.1 -17 88847 89616
70 | NZ_CP069936.1 -18 89761 100044
71 | NZ_CP069936.1 50 100044 101354
72 | NZ_CP069936.1 -19 101354 111376
73 | NZ_CP069936.1 51 111376 129382
74 | NZ_CP069936.1 20 129382 130715
75 | NZ_CP069936.1 52 130715 134652
76 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_7/truth/align/containment/all_pairs_containment_distance.tsv:
--------------------------------------------------------------------------------
1 | plasmid_1 plasmid_2 distance
2 | NZ_CP070577.1 NZ_CP075435.1 0.5973736285610576
3 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_7/truth/align/containment/containment_communities/objects/communities.tsv:
--------------------------------------------------------------------------------
1 | plasmid community
2 | NZ_CP070577.1 community_0
3 | NZ_CP075435.1 community_0
4 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_7/truth/align/containment/containment_communities/objects/communities.txt:
--------------------------------------------------------------------------------
1 | NZ_CP070577.1 NZ_CP075435.1
2 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_7/truth/align/unimogs/batch_0_align.unimog:
--------------------------------------------------------------------------------
1 | >NZ_CP070577.1~NZ_CP075435.1:NZ_CP070577.1
2 | 27 31 4 26 25 32 25 24 33 23 22 34 21 35 20 36 19 18 37 17 38 16 15 39 14 40 2 41 13 42 12 43 11 44 5 45 6 46 7 8 47 3 9 48 10 49 1 30 29 28 )
3 | >NZ_CP070577.1~NZ_CP075435.1:NZ_CP075435.1
4 | -1 51 2 52 -3 53 -4 54 5 55 6 7 56 8 57 9 10 58 -11 59 -12 60 -13 61 -14 62 -15 63 -16 64 -17 65 -18 66 -19 67 -20 -21 68 -22 69 -23 -24 -25 -26 -27 -28 -29 -30 )
5 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_8/truth/align/containment/all_pairs_containment_distance.tsv:
--------------------------------------------------------------------------------
1 | plasmid_1 plasmid_2 distance
2 | NZ_CP072977.1 NC_006816.1 0.6166197316420948
3 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_8/truth/align/containment/containment_communities/objects/communities.tsv:
--------------------------------------------------------------------------------
1 | plasmid community
2 | NZ_CP072977.1 community_0
3 | NC_006816.1 community_1
4 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_8/truth/align/containment/containment_communities/objects/communities.txt:
--------------------------------------------------------------------------------
1 | NZ_CP072977.1
2 | NC_006816.1
3 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_8/truth/align/unimogs/batch_0_align.unimog:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/indel_tests/test_8/truth/align/unimogs/batch_0_align.unimog
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_8/truth/align/unimogs/batch_0_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_9/truth/align/containment/all_pairs_containment_distance.tsv:
--------------------------------------------------------------------------------
1 | plasmid_1 plasmid_2 distance
2 | NZ_CP042975.1 NZ_MT035874.1 0.4403965672910878
3 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_9/truth/align/containment/containment_communities/objects/communities.tsv:
--------------------------------------------------------------------------------
1 | plasmid community
2 | NZ_CP042975.1 community_0
3 | NZ_MT035874.1 community_0
4 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_9/truth/align/containment/containment_communities/objects/communities.txt:
--------------------------------------------------------------------------------
1 | NZ_CP042975.1 NZ_MT035874.1
2 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_9/truth/align/unimogs/batch_0_align.unimog:
--------------------------------------------------------------------------------
1 | >NZ_CP042975.1~NZ_MT035874.1:NZ_CP042975.1
2 | 18 2 4 1 17 16 19 15 14 13 10 9 8 20 7 5 6 21 3 22 12 23 11 24 )
3 | >NZ_CP042975.1~NZ_MT035874.1:NZ_MT035874.1
4 | -1 -2 25 -3 4 26 5 27 6 28 -7 29 -8 30 -9 31 -10 32 11 33 12 34 -13 35 -14 -15 -16 -17 )
5 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/indel_tests/test_9/truth/align/unimogs/batch_0_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 | NZ_CP042975.1~NZ_MT035874.1 NZ_CP042975.1 18 1 5047
3 | NZ_CP042975.1 2 5047 8988
4 | NZ_CP042975.1 4 8997 10054
5 | NZ_CP042975.1 1 10062 24773
6 | NZ_CP042975.1 17 24773 42215
7 | NZ_CP042975.1 16 41645 42384
8 | NZ_CP042975.1 19 42384 42684
9 | NZ_CP042975.1 15 42684 53885
10 | NZ_CP042975.1 14 54062 56851
11 | NZ_CP042975.1 13 56854 83447
12 | NZ_CP042975.1 10 83447 84503
13 | NZ_CP042975.1 9 84503 86903
14 | NZ_CP042975.1 8 86899 91528
15 | NZ_CP042975.1 20 91528 106511
16 | NZ_CP042975.1 7 106511 108980
17 | NZ_CP042975.1 5 108211 112896
18 | NZ_CP042975.1 6 112895 144504
19 | NZ_CP042975.1 21 144504 152958
20 | NZ_CP042975.1 3 152958 153462
21 | NZ_CP042975.1 22 153462 241546
22 | NZ_CP042975.1 12 241546 242850
23 | NZ_CP042975.1 23 242850 269467
24 | NZ_CP042975.1 11 269467 270090
25 | NZ_CP042975.1 24 270090 270777
26 | NZ_MT035874.1 -1 1 14707
27 | NZ_MT035874.1 -2 14716 18658
28 | NZ_MT035874.1 25 18658 63823
29 | NZ_MT035874.1 -3 63823 64327
30 | NZ_MT035874.1 4 64504 65561
31 | NZ_MT035874.1 26 65561 71830
32 | NZ_MT035874.1 5 71830 76516
33 | NZ_MT035874.1 27 76516 77842
34 | NZ_MT035874.1 6 77842 109454
35 | NZ_MT035874.1 28 109454 113295
36 | NZ_MT035874.1 -7 113295 115730
37 | NZ_MT035874.1 29 115730 116925
38 | NZ_MT035874.1 -8 116925 121552
39 | NZ_MT035874.1 30 121552 122748
40 | NZ_MT035874.1 -9 122748 125148
41 | NZ_MT035874.1 31 125148 126828
42 | NZ_MT035874.1 -10 126828 127884
43 | NZ_MT035874.1 32 127884 154264
44 | NZ_MT035874.1 11 154264 154888
45 | NZ_MT035874.1 33 154888 163778
46 | NZ_MT035874.1 12 163778 165083
47 | NZ_MT035874.1 34 165083 168952
48 | NZ_MT035874.1 -13 168952 195521
49 | NZ_MT035874.1 35 195521 196013
50 | NZ_MT035874.1 -14 196013 198795
51 | NZ_MT035874.1 -15 198801 210002
52 | NZ_MT035874.1 -16 210002 210740
53 | NZ_MT035874.1 -17 210381 228159
54 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/input/fastas/outlier.fna:
--------------------------------------------------------------------------------
1 | >outlier
2 | aaaaaaaaaaaaaaaaaaaaa
3 | atggaaacagctgtagcgtactataaagatggtgttccttatgatgataaggggcaggta
4 | atcattactcttttgaatggtaatccagacgggag------tggctctggcggtggtggt
5 | ggaactggaggtagcaaaagtgaaagttctgcagccattcatgccacagctaaatggtct
6 | actgctcaattgaagaaaacgcaggcagaacaggctgcccgagcaaaagctgccgcagaa
7 | gcacaggctaaagcaaaagcaaaccgggatgcgctgactcaacatctgaaggatattgtg
8 | aatgaggcgcttcgccataattccactcatccggaggttattgacctggctcatgccaat
9 | aatgcagcgatgcaggcagaagcagagcggttgcgccttgcaaaagcagaagaaaaagcc
10 | cgtaaagaagcggaagctgcggaaaaggcttttcaggaagcagaacaacgacgtaaagag
11 | atagagaaggagcaggctgaaacagaacgccaattgaaactggctgaggatgaagagaaa
12 | cgcctggcagcattgagtgaagaggcccgagctgtggaggtggcacaaaaaaatcttgct
13 | gctgcacaatctgagctggcgaaagtggatgaagagattaatacgctcaatacccgttta
14 | agctccagtattcatgcccgtgatgcagaaacgaatacgctgtccggaaaacgaaatgag
15 | ttggatcaggcatctgctaaatataaagaactggatgaaagggttaaacttttatctcct
16 | agggcgaatgatccgcttcagagtcgtcctttttttgaggccaccagactacgggcgaga
17 | gctggtgatgagatggaggaaaaacaaaagcaggtaacagcatcagaaacgcgtcttaac
18 | cagattagctctgagataaatggaatccaagaggctatttctcaggctaataataagcga
19 | agtacagcagtttcacgtattcatgatgctgaagataatttgaaaacagcacagactaat
20 | ctcctgaactcgcagattaaggatgctgtggatgcaacagttagcttttatcaaacgcta
21 | tctgaaaaatatggtgaaaaatattcaaaaatggcacaggaacttgctgataaatctaaa
22 | ggtaagaaaatcagcaatgtgaatgaagctctagctgcttttgagaaatacaaggatgta
23 | ttaaataagaaattcagcaaagcagaccgtgatgcaattttcaatgcactggaggcggtt
24 | aagtatgaagactgggctaagcatttagatcagtttgccaagtacttgaagattacggga
25 | catgtttcttttggatatgatgtggtatctgatatcctaaaaattaaggatacaggtgac
26 | tggaagccgctatttcttacattagagaagaaagctgtagatgctggagttagttatgtt
27 | gttgttttactttttagtgtgcttgctggaactacattaggtatctgggggattgctatt
28 | gttacaggcattctatgtgcctttattgataagaataaacttaatactataaatgaggtg
29 | ttgggtatttaa
30 | aaaaaaaaaaaaaaaaaaa
31 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/input/fastas/reference.fna:
--------------------------------------------------------------------------------
1 | >reference
2 | ATGTCAGGTAAAAAAACTATCGTTACTCTGCTCCGGGTATCGCTACTGGCATGCCCGTTA
3 | CTGTTCACGACACCATCGTTTGCAATGATCGACACGCCATCCGTGAAGGTCGGCTTTTCT
4 | CCTGAAGGAAGCGCATCCGCTCTGGTGCTTGACACAATCAACAGTGCGGAAAGCTCCATC
5 | AGGATGATGGCATATTCCTTCACCGACCCGGATGTAATGCATGCGCTGGCAAAAGCGAAA
6 | AAACGCGGAGTGGACGTCCGTATTGTTGTTGATGACAAGGGGAATACGAACCGGGCAAGT
7 | CAGGAAGCGATGAAATATATCAACCTGCTGGACATTCCTCTCCGGACTGTAGATGCCTTC
8 | CCCATCCATCACGACAAAGTCATCATTGTTGACGGAAACACGGTTGAAACTGGCTCCTAT
9 | AACTTCTCTCGTGCTGCTGCACGCAAGAATTCAGAGAATGTCGTTGTGCTCAAGAATATG
10 | CCGGATGTAGCCGCACAATATCTTGAACACTGGCAGGATCGCTGGAATAAGGGTACAGAC
11 | TGGAGACCCTGA
12 | AAAAAAAAAAAAAAAAAAAA
13 | ATGAATACCGAACTGACACTGAATGCCCTGCAGTCCATGAATGCCCAGGAATATGAAGAA
14 | ATCCGTGCTGCGGGAAGCGATATGCGCCGTAATCTCACTCACGAGGTGATGCGTGAAGTG
15 | GACGCACCGGCTAACTGGATGATGAACGGAGAGTATGGCAGCGAGTTCGGGGGCTTTTTC
16 | CCCGTCCAGGTTCGTTTCACGCCAGCCCACGAACGTTTCCACCTGGCATTATGTTCGCCG
17 | GGAGACGTCTCTCAGCTCTGGATGCTGGTTCTGGTGAATGGTGGTGGACAGCCTTTCGCC
18 | GTCGTTCAGGTGCAACATATCTTCACGCCTGCCGCGATCAGTCACACGCTGGCGCTTGCC
19 | GCGACACTGGATGCGCAGGGATACAGTGTTAACGACATCATCCATATCCTGATGGCAGAA
20 | GGAGGTCAGGCATGA
21 | AAAAAAAAAAAAAAAAAAAA
22 | ATGAAAATCTTTATTGATGATGGTTCTACCAACATTAAACTTGCCTGGTTGGAGGATGGT
23 | GACGTGAAAACGTTAATCAGCCCTAACAGCTTTAAACCGGAATGGTCTTTTAGTTTACTG
24 | GATGATGCTGCTCCGGCTAATTACGAGATCGACGGCGAGAAGTTTTCATTTGATCCATTA
25 | AGTGCTGATGCTGTCGTAACGACTGAAACACGCTATCAGTACAGTGATGTGAATGTTGTG
26 | GCCATTCAGCATGCGCTACAGCAGACCGGCCTGAAAGCGCAGCCTGTTGATGTCATCGTC
27 | ACATTGCCGATCTCTGAATACCTTGACGCCAACAATCAGAAAAATAAGCAAAACATTGAA
28 | AGAAAGAAAAAAAATGTGATGCGTGAAGTACGGGTGCAGGGGAGTGATGCATTTGTTATT
29 | CGCAGTGTTTCCGTTCTTCCTGAAAGTATTCCCGCTGGTTTCAGTGTTCTTGCGGGGCTT
30 | GAGGATGATGAATCCCTTTTGATCGTAGATCTCGGTGGTACAACTCTTGATGTGTCGCAT
31 | GTTCGTAGCAAAATGACAGGGATTACAAAAACCTGGTGTGATCCGAATATCGGCGTGTCC
32 | CTGATTACATCCGGGGTTAAGGAACAGATGGCTGTACATGCTAATACAAGAGTGAGCTCA
33 | TTCCAGGCTGACAATATCATTGTGCACCGTAATGAACCTGACTACCTTTCCCGTCGCATT
34 | TATAATGCTGAACAGCGTGAGTCTATCATTAATGTTATCAATGAACGGCAGAAGTTGCTT
35 | ATTAAACGAGTTAATGATGTCATCAGCCGTTTCACCGACTATACACATGTAATGTGTGTT
36 | GGTGGTGGGGCTGAAATTGTGGCCGAGGCTGTGAAGAACCTGACTAAGGTTCCTGATGAG
37 | CGCTTTTATCTGAGCTCATCCCCGCAGTTTGATTTAGTCATGGGAATGATAAAAATGAAA
38 | GGTGGTGTGACTAATGAGTGA
39 | AAAAAAAAAAAAAAAAAAAA
40 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/input/fastas/reverse.fna:
--------------------------------------------------------------------------------
1 | >reverse
2 | TTTTTTTTTTTTTTTTTTTT
3 | TCACTCATTAGTCACACCACCTTTCATTTTTATCATTCCCATGACTAAATCAAACTGCGG
4 | GGATGAGCTCAGATAAAAGCGCTCATCAGGAACCTTAGTCAGGTTCTTCACAGCCTCGGC
5 | CACAATTTCAGCCCCACCACCAACACACATTACATGTGTATAGTCGGTGAAACGGCTGAT
6 | GACATCATTAACTCGTTTAATAAGCAACTTCTGCCGTTCATTGATAACATTAATGATAGA
7 | CTCACGCTGTTCAGCATTATAAATGCGACGGGAAAGGTAGTCAGGTTCATTACGGTGCAC
8 | AATGATATTGTCAGCCTGGAATGAGCTCACTCTTGTATTAGCATGTACAGCCATCTGTTC
9 | CTTAACCCCGGATGTAATCAGGGACACGCCGATATTCGGATCACACCAGGTTTTTGTAAT
10 | CCCTGTCATTTTGCTACGAACATGCGACACATCAAGAGTTGTACCACCGAGATCTACGAT
11 | CAAAAGGGATTCATCATCCTCAAGCCCCGCAAGAACACTGAAACCAGCGGGAATACTTTC
12 | AGGAAGAACGGAAACACTGCGAATAACAAATGCATCACTCCCCTGCACCCGTACTTCACG
13 | CATCACATTTTTTTTCTTTCTTTCAATGTTTTGCTTATTTTTCTGATTGTTGGCGTCAAG
14 | GTATTCAGAGATCGGCAATGTGACGATGACATCAACAGGCTGCGCTTTCAGGCCGGTCTG
15 | CTGTAGCGCATGCTGAATGGCCACAACATTCACATCACTGTACTGATAGCGTGTTTCAGT
16 | CGTTACGACAGCATCAGCACTTAATGGATCAAATGAAAACTTCTCGCCGTCGATCTCGTA
17 | ATTAGCCGGAGCAGCATCATCCAGTAAACTAAAAGACCATTCCGGTTTAAAGCTGTTAGG
18 | GCTGATTAACGTTTTCACGTCACCATCCTCCAACCAGGCAAGTTTAATGTTGGTAGAACC
19 | ATCATCAATAAAGATTTTCAT
20 | TTTTTTTTTTTTTTTTTTTT
21 | TCATGCCTGACCTCCTTCTGCCATCAGGATATGGATGATGTCGTTAACACTGTATCCCTG
22 | CGCATCCAGTGTCGCGGCAAGCGCCAGCGTGTGACTGATCGCGGCAGGCGTGAAGATATG
23 | TTGCACCTGAACGACGGCGAAAGGCTGTCCACCACCATTCACCAGAACCAGCATCCAGAG
24 | CTGAGAGACGTCTCCCGGCGAACATAATGCCAGGTGGAAACGTTCGTGGGCTGGCGTGAA
25 | ACGAACCTGGACGGGGAAAAAGCCCCCGAACTCGCTGCCATACTCTCCGTTCATCATCCA
26 | GTTAGCCGGTGCGTCCACTTCACGCATCACCTCGTGAGTGAGATTACGGCGCATATCGCT
27 | TCCCGCAGCACGGATTTCTTCATATTCCTGGGCATTCATGGACTGCAGGGCATTCAGTGT
28 | CAGTTCGGTATTCAT
29 | TTTTTTTTTTTTTTTTTTTT
30 | TCAGGGTCTCCAGTCTGTACCCTTATTCCAGCGATCCTGCCAGTGTTCAAGATATTGTGC
31 | GGCTACATCCGGCATATTCTTGAGCACAACGACATTCTCTGAATTCTTGCGTGCAGCAGC
32 | ACGAGAGAAGTTATAGGAGCCAGTTTCAACCGTGTTTCCGTCAACAATGATGACTTTGTC
33 | GTGATGGATGGGGAAGGCATCTACAGTCCGGAGAGGAATGTCCAGCAGGTTGATATATTT
34 | CATCGCTTCCTGACTTGCCCGGTTCGTATTCCCCTTGTCATCAACAACAATACGGACGTC
35 | CACTCCGCGTTTTTTCGCTTTTGCCAGCGCATGCATTACATCCGGGTCGGTGAAGGAATA
36 | TGCCATCATCCTGATGGAGCTTTCCGCACTGTTGATTGTGTCAAGCACCAGAGCGGATGC
37 | GCTTCCTTCAGGAGAAAAGCCGACCTTCACGGATGGCGTGTCGATCATTGCAAACGATGG
38 | TGTCGTGAACAGTAACGGGCATGCCAGTAGCGATACCCGGAGCAGAGTAACGATAGTTTT
39 | TTTACCTGACAT
40 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/input/skip.unimog:
--------------------------------------------------------------------------------
1 | >reverse
2 | -2 -3 -1 )
3 | >reference
4 | 1 3 2 )
5 | >3_dup
6 | 1 3 2 2 )
7 | >2_dup_3_dup
8 | 1 3 3 2 2 )
9 | >3_dup_w_inverse
10 | 1 -2 -3 2 )
11 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/input/test_1.txt:
--------------------------------------------------------------------------------
1 | tests/unimog_tests/test_cases/toy_tests/input/fastas/reference.fna
2 | tests/unimog_tests/test_cases/toy_tests/input/fastas/reverse.fna
3 | tests/unimog_tests/test_cases/toy_tests/input/fastas/3_dup.fna
4 | tests/unimog_tests/test_cases/toy_tests/input/fastas/2_dup_3_dup.fna
5 | tests/unimog_tests/test_cases/toy_tests/input/fastas/3_dup_w_inverse.fna
6 | tests/unimog_tests/test_cases/toy_tests/input/fastas/outlier.fna
7 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/input/test_2.txt:
--------------------------------------------------------------------------------
1 | tests/unimog_tests/test_cases/toy_tests/input/fastas/reference.fna
2 | tests/unimog_tests/test_cases/toy_tests/input/fastas/reverse.fna
3 | tests/unimog_tests/test_cases/toy_tests/input/fastas/3_dup.fna
4 | tests/unimog_tests/test_cases/toy_tests/input/fastas/outlier.fna
5 | tests/unimog_tests/test_cases/toy_tests/input/fastas/2_dup_3_dup.fna
6 | tests/unimog_tests/test_cases/toy_tests/input/fastas/3_dup_w_inverse.fna
7 | tests/unimog_tests/test_cases/toy_tests/input/fastas/reference_2.fna
8 | tests/unimog_tests/test_cases/toy_tests/input/fastas/del_rearrange.fna
9 | tests/unimog_tests/test_cases/toy_tests/input/fastas/inversion.fna
10 | tests/unimog_tests/test_cases/toy_tests/input/fastas/dup_and_inverse.fna
11 | tests/unimog_tests/test_cases/toy_tests/input/fastas/inverse_block.fna
12 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/align/all_plasmids_distances.tsv:
--------------------------------------------------------------------------------
1 | plasmid_1 plasmid_2 distance
2 | reference reverse 0
3 | reference 3_dup 1
4 | reference 2_dup_3_dup 2
5 | reference 3_dup_w_inverse 2
6 | reverse 3_dup 1
7 | reverse 2_dup_3_dup 2
8 | reverse 3_dup_w_inverse 2
9 | 3_dup 2_dup_3_dup 1
10 | 3_dup 3_dup_w_inverse 1
11 | 2_dup_3_dup 3_dup_w_inverse 2
12 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/align/batches/batch_0.txt:
--------------------------------------------------------------------------------
1 | ['reference', 'reverse']
2 | ['reference', '3_dup']
3 | ['reference', '2_dup_3_dup']
4 | ['reference', '3_dup_w_inverse']
5 | ['reference', 'outlier']
6 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/align/batches/batch_1.txt:
--------------------------------------------------------------------------------
1 | ['reverse', '3_dup']
2 | ['reverse', '2_dup_3_dup']
3 | ['reverse', '3_dup_w_inverse']
4 | ['reverse', 'outlier']
5 | ['3_dup', '2_dup_3_dup']
6 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/align/batches/batch_2.txt:
--------------------------------------------------------------------------------
1 | ['3_dup', '3_dup_w_inverse']
2 | ['3_dup', 'outlier']
3 | ['2_dup_3_dup', '3_dup_w_inverse']
4 | ['2_dup_3_dup', 'outlier']
5 | ['3_dup_w_inverse', 'outlier']
6 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/align/batches/batching_info.txt:
--------------------------------------------------------------------------------
1 | 5
2 | 3
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/align/containment/all_pairs_containment_distance.tsv:
--------------------------------------------------------------------------------
1 | plasmid_1 plasmid_2 distance
2 | reference reverse 0.0
3 | reference 3_dup 0.0
4 | reference 2_dup_3_dup 0.0
5 | reference 3_dup_w_inverse 0.004930966469428033
6 | reference outlier 1.0
7 | reverse 3_dup 0.0
8 | reverse 2_dup_3_dup 0.0
9 | reverse 3_dup_w_inverse 0.004930966469428033
10 | reverse outlier 1.0
11 | 3_dup 2_dup_3_dup 0.0
12 | 3_dup 3_dup_w_inverse 0.0
13 | 3_dup outlier 1.0
14 | 2_dup_3_dup 3_dup_w_inverse 0.0
15 | 2_dup_3_dup outlier 1.0
16 | 3_dup_w_inverse outlier 1.0
17 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/align/containment/containment_communities/objects/communities.tsv:
--------------------------------------------------------------------------------
1 | plasmid community
2 | reference community_0
3 | reverse community_0
4 | 3_dup community_0
5 | 2_dup_3_dup community_0
6 | 3_dup_w_inverse community_0
7 | outlier community_1
8 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/align/containment/containment_communities/objects/communities.txt:
--------------------------------------------------------------------------------
1 | reference reverse 3_dup 2_dup_3_dup 3_dup_w_inverse
2 | outlier
3 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/align/dcj_thresh_4_graph/objects/hub_plasmids.csv:
--------------------------------------------------------------------------------
1 | hub_plasmids
2 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/align/dcj_thresh_4_graph/objects/typing.tsv:
--------------------------------------------------------------------------------
1 | plasmid type
2 | reference community_0_subcommunity_0
3 | reverse community_0_subcommunity_0
4 | 3_dup community_0_subcommunity_0
5 | 2_dup_3_dup community_0_subcommunity_0
6 | 3_dup_w_inverse community_0_subcommunity_0
7 | outlier community_1_subcommunity_0
8 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/align/unimogs/batch_0_align.unimog:
--------------------------------------------------------------------------------
1 | >reference~reverse:reference
2 | 1 )
3 | >reference~reverse:reverse
4 | -1 )
5 | >reference~3_dup:reference
6 | 1 )
7 | >reference~3_dup:3_dup
8 | 1 2 )
9 | >reference~2_dup_3_dup:reference
10 | 1 2 3 )
11 | >reference~2_dup_3_dup:2_dup_3_dup
12 | 1 2 2 3 4 )
13 | >reference~3_dup_w_inverse:reference
14 | 1 2 )
15 | >reference~3_dup_w_inverse:3_dup_w_inverse
16 | 1 -2 3 )
17 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/align/unimogs/batch_0_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 | reference~reverse reference 1 1 2029
3 | reverse -1 1 2029
4 | reference~3_dup reference 1 1 2029
5 | 3_dup 1 1 2029
6 | 3_dup 2 2029 2931
7 | reference~2_dup_3_dup reference 1 1 550
8 | reference 2 578 1005
9 | reference 3 1033 2029
10 | 2_dup_3_dup 1 1 550
11 | 2_dup_3_dup 2 578 1005
12 | 2_dup_3_dup 2 1033 1460
13 | 2_dup_3_dup 3 1488 2484
14 | 2_dup_3_dup 4 2484 3386
15 | reference~3_dup_w_inverse reference 1 1 563
16 | reference 2 563 2019
17 | 3_dup_w_inverse 1 1 563
18 | 3_dup_w_inverse -2 563 2019
19 | 3_dup_w_inverse 3 2019 2931
20 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/align/unimogs/batch_1_align.unimog:
--------------------------------------------------------------------------------
1 | >reverse~3_dup:reverse
2 | 1 )
3 | >reverse~3_dup:3_dup
4 | -1 2 )
5 | >reverse~2_dup_3_dup:reverse
6 | 1 2 3 )
7 | >reverse~2_dup_3_dup:2_dup_3_dup
8 | -3 -2 -2 -1 4 )
9 | >reverse~3_dup_w_inverse:reverse
10 | 1 2 )
11 | >reverse~3_dup_w_inverse:3_dup_w_inverse
12 | -2 1 3 )
13 | >3_dup~2_dup_3_dup:3_dup
14 | 1 2 3 )
15 | >3_dup~2_dup_3_dup:2_dup_3_dup
16 | 1 2 2 3 )
17 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/align/unimogs/batch_1_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 | reverse~3_dup reverse 1 1 2029
3 | 3_dup -1 1 2029
4 | 3_dup 2 2029 2931
5 | reverse~2_dup_3_dup reverse 1 1 997
6 | reverse 2 1025 1452
7 | reverse 3 1480 2029
8 | 2_dup_3_dup -3 1 550
9 | 2_dup_3_dup -2 578 1005
10 | 2_dup_3_dup -2 1033 1460
11 | 2_dup_3_dup -1 1488 2484
12 | 2_dup_3_dup 4 2484 3386
13 | reverse~3_dup_w_inverse reverse 1 11 1467
14 | reverse 2 1467 2029
15 | 3_dup_w_inverse -2 1 563
16 | 3_dup_w_inverse 1 563 2019
17 | 3_dup_w_inverse 3 2019 2931
18 | 3_dup~2_dup_3_dup 3_dup 1 1 550
19 | 3_dup 2 578 1005
20 | 3_dup 3 1033 2931
21 | 2_dup_3_dup 1 1 550
22 | 2_dup_3_dup 2 578 1005
23 | 2_dup_3_dup 2 1033 1460
24 | 2_dup_3_dup 3 1488 3386
25 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/align/unimogs/batch_2_align.unimog:
--------------------------------------------------------------------------------
1 | >3_dup~3_dup_w_inverse:3_dup
2 | 1 2 3 )
3 | >3_dup~3_dup_w_inverse:3_dup_w_inverse
4 | 1 -2 3 )
5 | >2_dup_3_dup~3_dup_w_inverse:2_dup_3_dup
6 | 1 4 2 3 )
7 | >2_dup_3_dup~3_dup_w_inverse:3_dup_w_inverse
8 | 1 -2 3 )
9 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/align/unimogs/batch_2_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 | 3_dup~3_dup_w_inverse 3_dup 1 1 563
3 | 3_dup 2 563 2019
4 | 3_dup 3 2019 2931
5 | 3_dup_w_inverse 1 1 563
6 | 3_dup_w_inverse -2 563 2019
7 | 3_dup_w_inverse 3 2019 2931
8 | 2_dup_3_dup~3_dup_w_inverse 2_dup_3_dup 1 1 563
9 | 2_dup_3_dup 4 563 1018
10 | 2_dup_3_dup 2 1018 2474
11 | 2_dup_3_dup 3 2474 3386
12 | 3_dup_w_inverse 1 1 563
13 | 3_dup_w_inverse -2 563 2019
14 | 3_dup_w_inverse 3 2019 2931
15 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/all_plasmids_distances.tsv:
--------------------------------------------------------------------------------
1 | plasmid_1 plasmid_2 distance
2 | reference reverse 0
3 | reference 3_dup 1
4 | reference 2_dup_3_dup 1
5 | reference 3_dup_w_inverse 2
6 | reverse 3_dup 1
7 | reverse 2_dup_3_dup 1
8 | reverse 3_dup_w_inverse 2
9 | 3_dup 2_dup_3_dup 1
10 | 3_dup 3_dup_w_inverse 1
11 | 2_dup_3_dup 3_dup_w_inverse 2
12 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/batches/.snakemake_timestamp:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/batches/.snakemake_timestamp
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/batches/batch_0.txt:
--------------------------------------------------------------------------------
1 | ['reference', 'reverse']
2 | ['reference', '3_dup']
3 | ['reference', '2_dup_3_dup']
4 | ['reference', '3_dup_w_inverse']
5 | ['reference', 'outlier']
6 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/batches/batch_1.txt:
--------------------------------------------------------------------------------
1 | ['reverse', '3_dup']
2 | ['reverse', '2_dup_3_dup']
3 | ['reverse', '3_dup_w_inverse']
4 | ['reverse', 'outlier']
5 | ['3_dup', '2_dup_3_dup']
6 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/batches/batch_2.txt:
--------------------------------------------------------------------------------
1 | ['3_dup', '3_dup_w_inverse']
2 | ['3_dup', 'outlier']
3 | ['2_dup_3_dup', '3_dup_w_inverse']
4 | ['2_dup_3_dup', 'outlier']
5 | ['3_dup_w_inverse', 'outlier']
6 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/batches/batching_info.txt:
--------------------------------------------------------------------------------
1 | 5
2 | 3
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/all_pairs_containment_distance.tsv:
--------------------------------------------------------------------------------
1 | plasmid_1 plasmid_2 distance
2 | reference reverse 0.0
3 | reference 3_dup 0.0
4 | reference 2_dup_3_dup 0.0
5 | reference 3_dup_w_inverse 0.004930966469428033
6 | reference outlier 1.0
7 | reverse 3_dup 0.0
8 | reverse 2_dup_3_dup 0.0
9 | reverse 3_dup_w_inverse 0.004930966469428033
10 | reverse outlier 1.0
11 | 3_dup 2_dup_3_dup 0.0
12 | 3_dup 3_dup_w_inverse 0.0
13 | 3_dup outlier 1.0
14 | 2_dup_3_dup 3_dup_w_inverse 0.0
15 | 2_dup_3_dup outlier 1.0
16 | 3_dup_w_inverse outlier 1.0
17 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/.snakemake_timestamp:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/.snakemake_timestamp
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/objects/communities.pkl:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/objects/communities.pkl
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/objects/communities.tsv:
--------------------------------------------------------------------------------
1 | plasmid community
2 | reference community_0
3 | reverse community_0
4 | 3_dup community_0
5 | 2_dup_3_dup community_0
6 | 3_dup_w_inverse community_0
7 | outlier community_1
8 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/objects/communities.txt:
--------------------------------------------------------------------------------
1 | reference reverse 3_dup 2_dup_3_dup 3_dup_w_inverse
2 | outlier
3 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/objects/plasmid_graph.pkl:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/objects/plasmid_graph.pkl
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/visualisations/communities/index.html:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
5 | Communities visualisation
6 |
7 |
8 |
9 |
10 | Communities visualisation
11 |
12 | View community_0 (5 nodes, 10 edges)
13 | View community_1 (1 nodes, 0 edges)
14 |
15 |
16 |
17 |
18 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/visualisations/communities/libs/resources/images/busy.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/visualisations/communities/libs/resources/images/busy.gif
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_444444_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_444444_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_555555_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_555555_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_777620_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_777620_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_777777_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_777777_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_cc0000_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_cc0000_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_ffffff_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/visualisations/communities/libs/resources/images/ui-icons_ffffff_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/visualisations/single_graph/libs/resources/images/busy.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/visualisations/single_graph/libs/resources/images/busy.gif
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_444444_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_444444_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_555555_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_555555_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_777620_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_777620_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_777777_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_777777_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_cc0000_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_cc0000_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_ffffff_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/containment/containment_communities/visualisations/single_graph/libs/resources/images/ui-icons_ffffff_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/.snakemake_timestamp:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/.snakemake_timestamp
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/objects/communities.pkl:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/objects/communities.pkl
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/objects/hub_plasmids.csv:
--------------------------------------------------------------------------------
1 | hub_plasmids
2 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/objects/subcommunities.pkl:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/objects/subcommunities.pkl
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/objects/typing.tsv:
--------------------------------------------------------------------------------
1 | plasmid type
2 | reference community_0_subcommunity_0
3 | reverse community_0_subcommunity_0
4 | 3_dup community_0_subcommunity_0
5 | 2_dup_3_dup community_0_subcommunity_0
6 | 3_dup_w_inverse community_0_subcommunity_0
7 | outlier community_1_subcommunity_0
8 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/visualisations/communities/index.html:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
5 | Communities visualisation
6 |
7 |
8 |
9 |
10 | Communities visualisation
11 |
12 | View community_0 (5 nodes, 10 edges)
13 | View community_1 (1 nodes, 0 edges)
14 |
15 |
16 |
17 |
18 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/busy.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/busy.gif
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_444444_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_444444_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_555555_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_555555_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_777620_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_777620_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_777777_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_777777_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_cc0000_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_cc0000_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_ffffff_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/visualisations/communities/libs/resources/images/ui-icons_ffffff_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/visualisations/subcommunities/index.html:
--------------------------------------------------------------------------------
1 |
2 |
3 |
4 |
5 | subcommunity visualisation
6 |
7 |
8 |
9 |
10 | subcommunity visualisation
11 |
12 | View community_0_subcommunity_0 (5 nodes, 10 edges)
13 | View community_1_subcommunity_0 (1 nodes, 0 edges)
14 |
15 |
16 |
17 |
18 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/busy.gif:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/busy.gif
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_444444_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_444444_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_555555_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_555555_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_777620_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_777620_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_777777_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_777777_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_cc0000_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_cc0000_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_ffffff_256x240.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_1/truth/skip/dcj_thresh_4_graph/visualisations/subcommunities/libs/resources/images/ui-icons_ffffff_256x240.png
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/all_plasmids_distances.tsv:
--------------------------------------------------------------------------------
1 | plasmid_1 plasmid_2 distance
2 | reverse reference 0
3 | 3_dup reference 1
4 | 3_dup reverse 1
5 | 2_dup_3_dup reference 2
6 | 2_dup_3_dup reverse 2
7 | 2_dup_3_dup 3_dup 1
8 | 3_dup_w_inverse reference 2
9 | 3_dup_w_inverse reverse 2
10 | 3_dup_w_inverse 3_dup 1
11 | 3_dup_w_inverse 2_dup_3_dup 2
12 | del_rearrange reference_2 3
13 | inversion reference_2 1
14 | inversion del_rearrange 3
15 | dup_and_inverse reference_2 2
16 | dup_and_inverse del_rearrange 3
17 | dup_and_inverse inversion 1
18 | inverse_block reference_2 1
19 | inverse_block del_rearrange 3
20 | inverse_block inversion 0
21 | inverse_block dup_and_inverse 1
22 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/batches/.snakemake_timestamp:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/batches/.snakemake_timestamp
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/batches/batch_0.txt:
--------------------------------------------------------------------------------
1 | ['reverse', 'reference']
2 | ['3_dup', 'reference']
3 | ['3_dup', 'reverse']
4 | ['outlier', 'reference']
5 | ['outlier', 'reverse']
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/batches/batch_1.txt:
--------------------------------------------------------------------------------
1 | ['outlier', '3_dup']
2 | ['2_dup_3_dup', 'reference']
3 | ['2_dup_3_dup', 'reverse']
4 | ['2_dup_3_dup', '3_dup']
5 | ['2_dup_3_dup', 'outlier']
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/batches/batch_10.txt:
--------------------------------------------------------------------------------
1 | ['inverse_block', '3_dup_w_inverse']
2 | ['inverse_block', 'reference_2']
3 | ['inverse_block', 'del_rearrange']
4 | ['inverse_block', 'inversion']
5 | ['inverse_block', 'dup_and_inverse']
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/batches/batch_2.txt:
--------------------------------------------------------------------------------
1 | ['3_dup_w_inverse', 'reference']
2 | ['3_dup_w_inverse', 'reverse']
3 | ['3_dup_w_inverse', '3_dup']
4 | ['3_dup_w_inverse', 'outlier']
5 | ['3_dup_w_inverse', '2_dup_3_dup']
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/batches/batch_3.txt:
--------------------------------------------------------------------------------
1 | ['reference_2', 'reference']
2 | ['reference_2', 'reverse']
3 | ['reference_2', '3_dup']
4 | ['reference_2', 'outlier']
5 | ['reference_2', '2_dup_3_dup']
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/batches/batch_4.txt:
--------------------------------------------------------------------------------
1 | ['reference_2', '3_dup_w_inverse']
2 | ['del_rearrange', 'reference']
3 | ['del_rearrange', 'reverse']
4 | ['del_rearrange', '3_dup']
5 | ['del_rearrange', 'outlier']
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/batches/batch_5.txt:
--------------------------------------------------------------------------------
1 | ['del_rearrange', '2_dup_3_dup']
2 | ['del_rearrange', '3_dup_w_inverse']
3 | ['del_rearrange', 'reference_2']
4 | ['inversion', 'reference']
5 | ['inversion', 'reverse']
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/batches/batch_6.txt:
--------------------------------------------------------------------------------
1 | ['inversion', '3_dup']
2 | ['inversion', 'outlier']
3 | ['inversion', '2_dup_3_dup']
4 | ['inversion', '3_dup_w_inverse']
5 | ['inversion', 'reference_2']
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/batches/batch_7.txt:
--------------------------------------------------------------------------------
1 | ['inversion', 'del_rearrange']
2 | ['dup_and_inverse', 'reference']
3 | ['dup_and_inverse', 'reverse']
4 | ['dup_and_inverse', '3_dup']
5 | ['dup_and_inverse', 'outlier']
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/batches/batch_8.txt:
--------------------------------------------------------------------------------
1 | ['dup_and_inverse', '2_dup_3_dup']
2 | ['dup_and_inverse', '3_dup_w_inverse']
3 | ['dup_and_inverse', 'reference_2']
4 | ['dup_and_inverse', 'del_rearrange']
5 | ['dup_and_inverse', 'inversion']
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/batches/batch_9.txt:
--------------------------------------------------------------------------------
1 | ['inverse_block', 'reference']
2 | ['inverse_block', 'reverse']
3 | ['inverse_block', '3_dup']
4 | ['inverse_block', 'outlier']
5 | ['inverse_block', '2_dup_3_dup']
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/batches/batching_info.txt:
--------------------------------------------------------------------------------
1 | 5
2 | 11
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/containment/all_pairs_containment_distance.tsv:
--------------------------------------------------------------------------------
1 | plasmid_1 plasmid_2 distance
2 | reverse reference 0.0
3 | 3_dup reference 0.0
4 | 3_dup reverse 0.0
5 | outlier reference 1.0
6 | outlier reverse 1.0
7 | outlier 3_dup 1.0
8 | 2_dup_3_dup reference 0.0
9 | 2_dup_3_dup reverse 0.0
10 | 2_dup_3_dup 3_dup 0.0
11 | 2_dup_3_dup outlier 1.0
12 | 3_dup_w_inverse reference 0.004930966469428033
13 | 3_dup_w_inverse reverse 0.004930966469428033
14 | 3_dup_w_inverse 3_dup 0.0
15 | 3_dup_w_inverse outlier 1.0
16 | 3_dup_w_inverse 2_dup_3_dup 0.0
17 | reference_2 reference 0.21055226824457596
18 | reference_2 reverse 0.21055226824457596
19 | reference_2 3_dup 0.45221843003412965
20 | reference_2 outlier 1.0
21 | reference_2 2_dup_3_dup 0.5258493353028064
22 | reference_2 3_dup_w_inverse 0.4621160409556314
23 | del_rearrange reference 0.717948717948718
24 | del_rearrange reverse 0.717948717948718
25 | del_rearrange 3_dup 0.8047781569965871
26 | del_rearrange outlier 1.0
27 | del_rearrange 2_dup_3_dup 0.819330385344283
28 | del_rearrange 3_dup_w_inverse 0.8081911262798634
29 | del_rearrange reference_2 0.0
30 | inversion reference 0.21055226824457596
31 | inversion reverse 0.21055226824457596
32 | inversion 3_dup 0.45358361774744027
33 | inversion outlier 1.0
34 | inversion 2_dup_3_dup 0.5270310192023634
35 | inversion 3_dup_w_inverse 0.4621160409556314
36 | inversion reference_2 0.002399808015358773
37 | inversion del_rearrange 0.006317119393556503
38 | dup_and_inverse reference 0.21055226824457596
39 | dup_and_inverse reverse 0.21055226824457596
40 | dup_and_inverse 3_dup 0.45358361774744027
41 | dup_and_inverse outlier 1.0
42 | dup_and_inverse 2_dup_3_dup 0.5270310192023634
43 | dup_and_inverse 3_dup_w_inverse 0.4621160409556314
44 | dup_and_inverse reference_2 0.004799616030717546
45 | dup_and_inverse del_rearrange 0.006317119393556503
46 | dup_and_inverse inversion 0.0
47 | inverse_block reference 0.21055226824457596
48 | inverse_block reverse 0.21055226824457596
49 | inverse_block 3_dup 0.45358361774744027
50 | inverse_block outlier 1.0
51 | inverse_block 2_dup_3_dup 0.5270310192023634
52 | inverse_block 3_dup_w_inverse 0.4621160409556314
53 | inverse_block reference_2 0.0
54 | inverse_block del_rearrange 0.006317119393556503
55 | inverse_block inversion 0.002399808015358773
56 | inverse_block dup_and_inverse 0.0
57 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/containment/containment_communities/objects/communities.tsv:
--------------------------------------------------------------------------------
1 | plasmid community
2 | 2_dup_3_dup community_0
3 | reverse community_0
4 | 3_dup_w_inverse community_0
5 | reference community_0
6 | 3_dup community_0
7 | inversion community_1
8 | del_rearrange community_1
9 | inverse_block community_1
10 | reference_2 community_1
11 | dup_and_inverse community_1
12 | outlier community_2
13 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/containment/containment_communities/objects/communities.txt:
--------------------------------------------------------------------------------
1 | 2_dup_3_dup reverse 3_dup_w_inverse reference 3_dup
2 | inversion del_rearrange inverse_block reference_2 dup_and_inverse
3 | outlier
4 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/dcj_thresh_4_graph/objects/hub_plasmids.csv:
--------------------------------------------------------------------------------
1 | hub_plasmids
2 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/dcj_thresh_4_graph/objects/typing.tsv:
--------------------------------------------------------------------------------
1 | plasmid type
2 | 2_dup_3_dup community_0_subcommunity_0
3 | reverse community_0_subcommunity_0
4 | 3_dup_w_inverse community_0_subcommunity_0
5 | reference community_0_subcommunity_0
6 | 3_dup community_0_subcommunity_0
7 | inversion community_1_subcommunity_0
8 | del_rearrange community_1_subcommunity_0
9 | inverse_block community_1_subcommunity_0
10 | reference_2 community_1_subcommunity_0
11 | dup_and_inverse community_1_subcommunity_0
12 | outlier community_2_subcommunity_0
13 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/unimogs/batch_0_align.unimog:
--------------------------------------------------------------------------------
1 | >reverse~reference:reverse
2 | 1 )
3 | >reverse~reference:reference
4 | -1 )
5 | >3_dup~reference:3_dup
6 | 1 2 )
7 | >3_dup~reference:reference
8 | 1 )
9 | >3_dup~reverse:3_dup
10 | 1 2 )
11 | >3_dup~reverse:reverse
12 | -1 )
13 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/unimogs/batch_0_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 | reverse~reference reverse 1 1 2029
3 | reference -1 1 2029
4 | 3_dup~reference 3_dup 1 1 2029
5 | 3_dup 2 2029 2931
6 | reference 1 1 2029
7 | 3_dup~reverse 3_dup 1 1 2029
8 | 3_dup 2 2029 2931
9 | reverse -1 1 2029
10 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/unimogs/batch_10_align.unimog:
--------------------------------------------------------------------------------
1 | >inverse_block~reference_2:inverse_block
2 | 1 2 )
3 | >inverse_block~reference_2:reference_2
4 | 1 -2 )
5 | >inverse_block~del_rearrange:inverse_block
6 | 1 4 2 3 )
7 | >inverse_block~del_rearrange:del_rearrange
8 | -3 1 -2 )
9 | >inverse_block~inversion:inverse_block
10 | 1 2 )
11 | >inverse_block~inversion:inversion
12 | -1 -2 )
13 | >inverse_block~dup_and_inverse:inverse_block
14 | 1 2 )
15 | >inverse_block~dup_and_inverse:dup_and_inverse
16 | -1 3 -2 )
17 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/unimogs/batch_10_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 | inverse_block~reference_2 inverse_block 1 1 1554
3 | inverse_block 2 1574 4148
4 | reference_2 1 1 1554
5 | reference_2 -2 1574 4148
6 | inverse_block~del_rearrange inverse_block 1 1 550
7 | inverse_block 4 550 1574
8 | inverse_block 2 1574 1784
9 | inverse_block 3 1807 4148
10 | del_rearrange -3 1 2342
11 | del_rearrange 1 2365 2914
12 | del_rearrange -2 2937 3147
13 | inverse_block~inversion inverse_block 1 1 1574
14 | inverse_block 2 1574 4158
15 | inversion -1 1 1574
16 | inversion -2 1584 4168
17 | inverse_block~dup_and_inverse inverse_block 1 1 1574
18 | inverse_block 2 1574 4168
19 | dup_and_inverse -1 1 1574
20 | dup_and_inverse 3 1574 3938
21 | dup_and_inverse -2 3938 6532
22 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/unimogs/batch_1_align.unimog:
--------------------------------------------------------------------------------
1 | >2_dup_3_dup~reference:2_dup_3_dup
2 | 1 2 2 3 4 )
3 | >2_dup_3_dup~reference:reference
4 | 1 2 3 )
5 | >2_dup_3_dup~reverse:2_dup_3_dup
6 | 1 2 2 3 4 )
7 | >2_dup_3_dup~reverse:reverse
8 | -3 -2 -1 )
9 | >2_dup_3_dup~3_dup:2_dup_3_dup
10 | 1 2 2 3 )
11 | >2_dup_3_dup~3_dup:3_dup
12 | 1 2 3 )
13 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/unimogs/batch_1_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 | 2_dup_3_dup~reference 2_dup_3_dup 1 1 550
3 | 2_dup_3_dup 2 578 1005
4 | 2_dup_3_dup 2 1033 1460
5 | 2_dup_3_dup 3 1488 2484
6 | 2_dup_3_dup 4 2484 3386
7 | reference 1 1 550
8 | reference 2 578 1005
9 | reference 3 1033 2029
10 | 2_dup_3_dup~reverse 2_dup_3_dup 1 1 550
11 | 2_dup_3_dup 2 578 1005
12 | 2_dup_3_dup 2 1033 1460
13 | 2_dup_3_dup 3 1488 2484
14 | 2_dup_3_dup 4 2484 3386
15 | reverse -3 1 997
16 | reverse -2 1025 1452
17 | reverse -1 1480 2029
18 | 2_dup_3_dup~3_dup 2_dup_3_dup 1 1 550
19 | 2_dup_3_dup 2 578 1005
20 | 2_dup_3_dup 2 1033 1460
21 | 2_dup_3_dup 3 1488 3386
22 | 3_dup 1 1 550
23 | 3_dup 2 578 1005
24 | 3_dup 3 1033 2931
25 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/unimogs/batch_2_align.unimog:
--------------------------------------------------------------------------------
1 | >3_dup_w_inverse~reference:3_dup_w_inverse
2 | 1 2 3 )
3 | >3_dup_w_inverse~reference:reference
4 | 1 -2 )
5 | >3_dup_w_inverse~reverse:3_dup_w_inverse
6 | 1 2 3 )
7 | >3_dup_w_inverse~reverse:reverse
8 | 2 -1 )
9 | >3_dup_w_inverse~3_dup:3_dup_w_inverse
10 | 1 2 3 )
11 | >3_dup_w_inverse~3_dup:3_dup
12 | 1 -2 3 )
13 | >3_dup_w_inverse~2_dup_3_dup:3_dup_w_inverse
14 | 1 2 3 )
15 | >3_dup_w_inverse~2_dup_3_dup:2_dup_3_dup
16 | 1 4 -2 3 )
17 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/unimogs/batch_2_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 | 3_dup_w_inverse~reference 3_dup_w_inverse 1 1 563
3 | 3_dup_w_inverse 2 563 2019
4 | 3_dup_w_inverse 3 2019 2931
5 | reference 1 1 563
6 | reference -2 563 2019
7 | 3_dup_w_inverse~reverse 3_dup_w_inverse 1 1 563
8 | 3_dup_w_inverse 2 563 2019
9 | 3_dup_w_inverse 3 2019 2931
10 | reverse 2 11 1467
11 | reverse -1 1467 2029
12 | 3_dup_w_inverse~3_dup 3_dup_w_inverse 1 1 563
13 | 3_dup_w_inverse 2 563 2019
14 | 3_dup_w_inverse 3 2019 2931
15 | 3_dup 1 1 563
16 | 3_dup -2 563 2019
17 | 3_dup 3 2019 2931
18 | 3_dup_w_inverse~2_dup_3_dup 3_dup_w_inverse 1 1 563
19 | 3_dup_w_inverse 2 563 2019
20 | 3_dup_w_inverse 3 2019 2931
21 | 2_dup_3_dup 1 1 563
22 | 2_dup_3_dup 4 563 1018
23 | 2_dup_3_dup -2 1018 2474
24 | 2_dup_3_dup 3 2474 3386
25 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/unimogs/batch_3_align.unimog:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/unimogs/batch_3_align.unimog
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/unimogs/batch_3_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/unimogs/batch_4_align.unimog:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/unimogs/batch_4_align.unimog
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/unimogs/batch_4_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/unimogs/batch_5_align.unimog:
--------------------------------------------------------------------------------
1 | >del_rearrange~reference_2:del_rearrange
2 | 1 2 3 )
3 | >del_rearrange~reference_2:reference_2
4 | 2 4 1 3 )
5 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/unimogs/batch_5_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 | del_rearrange~reference_2 del_rearrange 1 1 2342
3 | del_rearrange 2 2365 2914
4 | del_rearrange 3 2937 3167
5 | reference_2 2 1 550
6 | reference_2 4 550 1574
7 | reference_2 1 1574 3915
8 | reference_2 3 3938 4168
9 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/unimogs/batch_6_align.unimog:
--------------------------------------------------------------------------------
1 | >inversion~reference_2:inversion
2 | 1 2 )
3 | >inversion~reference_2:reference_2
4 | -1 2 )
5 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/unimogs/batch_6_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 | inversion~reference_2 inversion 1 11 1574
3 | inversion 2 1594 4168
4 | reference_2 -1 1 1564
5 | reference_2 2 1574 4148
6 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/unimogs/batch_7_align.unimog:
--------------------------------------------------------------------------------
1 | >inversion~del_rearrange:inversion
2 | 4 1 2 3 )
3 | >inversion~del_rearrange:del_rearrange
4 | 2 -1 3 )
5 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/unimogs/batch_7_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 | inversion~del_rearrange inversion 4 1 1025
3 | inversion 1 1025 1574
4 | inversion 2 1594 3935
5 | inversion 3 3958 4168
6 | del_rearrange 2 1 2342
7 | del_rearrange -1 2365 2914
8 | del_rearrange 3 2937 3147
9 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/unimogs/batch_8_align.unimog:
--------------------------------------------------------------------------------
1 | >dup_and_inverse~reference_2:dup_and_inverse
2 | 1 3 2 )
3 | >dup_and_inverse~reference_2:reference_2
4 | -1 2 )
5 | >dup_and_inverse~del_rearrange:dup_and_inverse
6 | 4 1 2 5 3 )
7 | >dup_and_inverse~del_rearrange:del_rearrange
8 | 2 -1 3 )
9 | >dup_and_inverse~inversion:dup_and_inverse
10 | 1 2 2 3 )
11 | >dup_and_inverse~inversion:inversion
12 | 1 2 3 )
13 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/unimogs/batch_8_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 | dup_and_inverse~reference_2 dup_and_inverse 1 24 1574
3 | dup_and_inverse 3 1574 3958
4 | dup_and_inverse 2 3958 6532
5 | reference_2 -1 1 1551
6 | reference_2 2 1574 4148
7 | dup_and_inverse~del_rearrange dup_and_inverse 4 1 1025
8 | dup_and_inverse 1 1025 1571
9 | dup_and_inverse 2 1594 3948
10 | dup_and_inverse 5 3948 6322
11 | dup_and_inverse 3 6322 6532
12 | del_rearrange 2 1 2355
13 | del_rearrange -1 2368 2914
14 | del_rearrange 3 2937 3147
15 | dup_and_inverse~inversion dup_and_inverse 1 1 1584
16 | dup_and_inverse 2 1594 3948
17 | dup_and_inverse 2 3958 6312
18 | dup_and_inverse 3 6322 6532
19 | inversion 1 1 1584
20 | inversion 2 1594 3948
21 | inversion 3 3958 4168
22 |
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/unimogs/batch_9_align.unimog:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/iqbal-lab-org/pling/4b07ff44660cce8d446d7f8fded9f43ce16f6e35/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/unimogs/batch_9_align.unimog
--------------------------------------------------------------------------------
/tests/unimog_tests/test_cases/toy_tests/test_2/truth/align/unimogs/batch_9_map.txt:
--------------------------------------------------------------------------------
1 | Plasmid Block_ID Start End
2 |
--------------------------------------------------------------------------------
/tests/utils.py:
--------------------------------------------------------------------------------
1 | import unittest
2 |
3 | # Instance of the TestCase to use the assertEqual method
4 | tc = unittest.TestCase()
5 |
6 |
7 | def read_file(path):
8 | """Helper method to read a file."""
9 | with open(path, 'rb') as f:
10 | return f.read()
11 |
12 |
13 | def assert_files_are_identical(path_to_first_file, path_to_second_file):
14 | first_file_content = read_file(path_to_first_file)
15 | second_file_content = read_file(path_to_second_file)
16 | tc.assertEqual(first_file_content, second_file_content)
17 |
18 | def get_num_communities(filepath):
19 | with open(filepath) as communities_fh:
20 | num = len(communities_fh.readlines())
21 | return num
22 |
23 | def get_batch_num(filepath):
24 | with open(filepath) as f:
25 | next(f)
26 | num = int(f.readline().strip())
27 | return num
28 |
29 | def assert_containment(test, test_dir, integerisation):
30 | assert_files_are_identical(f"{test_dir}/{test}/out/{integerisation}/containment/all_pairs_containment_distance.tsv",
31 | f"{test_dir}/{test}/truth/{integerisation}/containment/all_pairs_containment_distance.tsv")
32 | assert_files_are_identical(f"{test_dir}/{test}/out/{integerisation}/containment/containment_communities/objects/communities.tsv",
33 | f"{test_dir}/{test}/truth/{integerisation}/containment/containment_communities/objects/communities.tsv")
34 | assert_files_are_identical(f"{test_dir}/{test}/out/{integerisation}/containment/containment_communities/objects/communities.txt",
35 | f"{test_dir}/{test}/truth/{integerisation}/containment/containment_communities/objects/communities.txt")
36 |
37 | def assert_align_unimogs(test, test_dir, batch_num):
38 | for i in range(batch_num):
39 | assert_files_are_identical(f"{test_dir}/{test}/out/align/unimogs/batch_{i}_align.unimog",
40 | f"{test_dir}/{test}/truth/align/unimogs/batch_{i}_align.unimog")
41 | assert_files_are_identical(f"{test_dir}/{test}/out/align/unimogs/batch_{i}_map.txt",
42 | f"{test_dir}/{test}/truth/align/unimogs/batch_{i}_map.txt")
43 |
44 | def assert_end_to_end(test, dir):
45 | #containment communities
46 | assert_containment(test, dir, "align")
47 | #unimogs
48 | batch_num = get_batch_num(f"{dir}/{test}/out/align/batches/batching_info.txt")
49 | assert_align_unimogs(test, dir, batch_num)
50 | #DCJ distance matrix
51 | assert_files_are_identical(f"{dir}/{test}/out/align/all_plasmids_distances.tsv",
52 | f"{dir}/{test}/truth/align/all_plasmids_distances.tsv")
53 | #DCJ communities
54 | assert_files_are_identical(f"{dir}/{test}/out/align/dcj_thresh_4_graph/objects/typing.tsv",
55 | f"{dir}/{test}/truth/align/dcj_thresh_4_graph/objects/typing.tsv")
56 | assert_files_are_identical(f"{dir}/{test}/out/align/dcj_thresh_4_graph/objects/hub_plasmids.csv",
57 | f"{dir}/{test}/truth/align/dcj_thresh_4_graph/objects/hub_plasmids.csv")
58 |
--------------------------------------------------------------------------------