├── easy
├── 001-fizz-buzz
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 003-prime-palindrome
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 004-sum-of-primes
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 008-reverse-words
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 018-multiples-of-a-number
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 019-bit-positions
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 020-lowercase
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 021-sum-of-digits
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 022-fibonacci-series
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 023-multiplication-tables
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 024-sum-of-integers-from-file
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 025-odd-numbers
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 026-file-size
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 029-unique-elements
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 030-set-intersection
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 031-rightmost-char
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 039-happy-numbers
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 040-self-describing-numbers
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 062-n-mod-m
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 067-hex-to-decimal
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 082-armstrong-numbers
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 083-beautiful-strings
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 087-query-board
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 091-simple-sorting
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 092-penultimate-word
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 093-capitalize-words
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 096-swap-case
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 097-find-a-writer
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 099-calculate-distance
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 100-even-numbers
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 102-json-menu-ids
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 103-lowest-unique-number
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 104-word-to-digit
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 106-roman-numerals
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 107-shortest-repetition
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 111-longest-word
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 112-swap-elements
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 113-multiply-lists
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 115-mixed-content
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 116-morse-code
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 122-hidden-digits
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 124-road-trip
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 128-compressed-sequence
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 131-split-the-number
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 132-the-major-element
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 136-racing-chars
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 139-working-experience
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 140-data-recovery
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 147-lettercase-percentage-ratio
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 149-juggling-with-zeros
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 152-age-distribution
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 156-roller-coaster
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 160-nice-angles
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 163-big-digits
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 166-delta-time
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 167-read-more
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 173-without-repetitions
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 174-slang-flavor
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 178-matrix-rotation
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 180-knight-moves
│ ├── assets
│ │ └── fig-1.png
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 183-details
│ ├── assets
│ │ ├── fig-1.png
│ │ └── fig-2.png
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 186-max-range-sum
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 189-minimum-distance
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 192-compare-points
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 196-swap-numbers
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 199-string-mask
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 202-stepwise-word
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 203-strings-and-arrows
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 205-clean-up-the-words
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 208-find-the-highest-score
│ ├── assets
│ │ └── fig-1.png
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 211-chardonnay-or-cabernet
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 214-time-to-eat
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 217-one-zero-two-zeros
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 220-trick-or-treat
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 222-black-card
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 225-testing
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 227-real-fake
│ ├── assets
│ │ └── fig-1.png
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 230-football
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 232-not-so-clever
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 235-simple-or-trump
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 237-panacea-truth-or-lie
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
└── 240-mersenne-prime
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── hard
├── 006-longest-common-subsequence
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 007-prefix-expressions
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 014-string-permutations
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 028-string-searching
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 036-message-decoding
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 038-string-list
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 042-ugly-numbers
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 044-following-integer
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 047-palindromic-ranges
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 048-discount-offers
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 049-peak-traffic
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 050-string-substitution
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 051-closest-pair
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 052-text-dollar
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 053-repeated-substring
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 055-type-ahead
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 056-robot-movements
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 057-spiral-printing
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 058-levenshtein-distance
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 059-telephone-words
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 060-grid-walk
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 061-decryption
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 064-climbing-stairs
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 065-word-search
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 069-distinct-subsequences
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 072-minimum-path-sum
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 077-da-vyncy
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 079-minesweeper
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 085-find-min
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 086-poker-hands
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 088-juggle-fest
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 090-commuting-engineer
│ ├── assets
│ │ └── fig-1.png
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 095-advanced-calculator
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 105-largest-sub-matrix
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 108-computer-terminal
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 109-bay-bridges
│ ├── assets
│ │ └── fig-1.png
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 110-text-to-number
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 114-package-problem
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 118-seat-your-team-members
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 120-skyscrapers
│ ├── assets
│ │ ├── fig-1.png
│ │ └── fig-2.png
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 123-efficient-delivery
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 126-play-with-dna
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 127-code-plagiarism
│ ├── dataset
│ │ ├── 1_1
│ │ ├── 1_2
│ │ ├── 2_1
│ │ ├── 2_2
│ │ ├── 3_1
│ │ ├── 3_2
│ │ ├── 4_1
│ │ ├── 4_2
│ │ ├── 5_1
│ │ ├── 5_2
│ │ ├── 6_1
│ │ ├── 6_2
│ │ ├── 7_1
│ │ ├── 7_2
│ │ ├── 8_1
│ │ ├── 8_2
│ │ ├── 9_1
│ │ └── 9_2
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 129-routing-problem
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 134-a-bus-network
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 141-flight-370
│ ├── assets
│ │ └── malaysiaairsar2014_crowdrank.kmz
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 142-visit-to-the-headquarters
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 144-digit-statistics
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 145-running-for-president
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 151-cracking-eggs
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 154-ip-package
│ ├── assets
│ │ └── fig-1.png
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 155-ascii-decryption
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 157-the-labyrinth
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 159-where-is-wi-fi
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 162-too-unique
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 164-mars-networks
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 168-the-frequency
│ ├── assets
│ │ └── fig-1.png
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 171-dna-alignment
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 175-the-cubes
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 176-ray-of-light
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 182-longest-path
│ ├── assets
│ │ └── fig-1.png
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 185-glue-shredded-pieces
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 188-distinct-triangles
│ ├── assets
│ │ └── fig-1.png
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 191-lights-out
│ ├── assets
│ │ └── fig-1.png
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 195-crime-house
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 198-less-money-more-problems
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 201-alphabet-blocks
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 204-straight-lines
│ ├── assets
│ │ └── fig-1.png
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 207-which-way-is-faster
│ ├── assets
│ │ └── fig-1.png
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 210-brainfck
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 213-lakes-not-cakes
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 216-everything-or-nothing
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 219-the-tourist
│ ├── assets
│ │ └── fig-1.png
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 224-prisoner-or-citizen
│ ├── assets
│ │ └── fig-1.png
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 229-grinch
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 234-code-like-huffman
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
└── 239-as-quick-as-a-flash
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── manifest.json
├── moderate
├── 002-longest-lines
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 005-detecting-cycles
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 009-stack-implementation
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 010-mth-to-last-element
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 011-lowest-common-ancestor
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 012-first-non-repeated-character
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 013-remove-characters
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 015-endianness
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 016-number-of-ones
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 017-sum-of-integers
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 027-decimal-to-binary
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 032-trailing-string
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 033-double-squares
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 034-number-pairs
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 035-email-validation
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 037-pangrams
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 041-array-absurdity
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 043-jolly-jumpers
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 045-reverse-and-add
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 046-prime-numbers
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 054-cash-register
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 063-counting-primes
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 066-pascals-triangle
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 068-valid-parentheses
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 070-overlapping-rectangles
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 071-reverse-groups
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 073-decode-numbers
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 074-minimum-coins
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 075-flavius-josephus
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 076-string-rotation
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 078-sudoku
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 080-uri-comparison
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 081-sum-to-zero
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 084-balanced-smileys
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 089-pass-triangle
│ ├── assets
│ │ └── triangle.txt
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 094-simple-calculator
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 098-point-in-circle
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 101-find-a-square
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 117-a-pile-of-bricks
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 119-chain-inspection
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 121-lost-in-translation
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 125-predict-the-number
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 130-sequence-transformation
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 133-city-blocks-flyover
│ ├── assets
│ │ └── fig-1.png
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 135-word-chain
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 137-seek-for-an-intruder
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 138-car-race
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 143-the-ministry-of-truth
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 146-bats-challenge
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 148-color-code-converter
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 150-roman-and-arabic
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 153-locks
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 158-interrupted-bubble-sort
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 161-game-of-life
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 165-suggest-groups
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 169-filename-pattern
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 170-guess-the-number
│ ├── assets
│ │ └── fig-1.png
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 172-card-number-validation
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 177-justify-the-text
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 179-broken-lcd
│ ├── assets
│ │ ├── fig-1.png
│ │ ├── fig-2.png
│ │ └── fig-3.png
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 181-gronsfeld-cipher
│ ├── assets
│ │ ├── fig-1.png
│ │ └── fig-2.png
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 184-burrows-wheeler-transform
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 187-consecutive-primes
│ ├── assets
│ │ └── fig-1.png
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 190-number-operations
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 193-magic-numbers
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 194-twenty-forty-eight
│ ├── assets
│ │ └── fig-1.png
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 197-column-names
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 200-sort-matrix-columns
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 206-lucky-tickets
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 209-black-or-white
│ ├── assets
│ │ └── fig-1.png
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 212-robo-and-robitta
│ ├── assets
│ │ └── fig-1.png
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 215-double-trouble
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 218-builders-team
│ ├── assets
│ │ └── fig-1.png
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 221-organizational-hierarchy
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 223-alternative-reality
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 226-try-to-solve-it
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 228-to-pi-or-not-to-pi
│ ├── assets
│ │ └── fig-1.png
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 231-meet-cocktail-sort
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 233-meet-comb-sort
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
├── 236-beat-or-bit
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
└── 238-code-combinations
│ ├── input.txt
│ ├── meta.yaml
│ ├── readme.md
│ └── readme.pdf
└── readme.md
/easy/001-fizz-buzz/input.txt:
--------------------------------------------------------------------------------
1 | 3 5 10
2 | 2 7 15
3 |
--------------------------------------------------------------------------------
/easy/001-fizz-buzz/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 1
2 | name: Fizz Buzz
3 | category: Easy
4 | summary: A simple game involving divisibility tests.
5 | url: https://www.codeeval.com/browse/1/
6 |
--------------------------------------------------------------------------------
/easy/001-fizz-buzz/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/001-fizz-buzz/readme.pdf
--------------------------------------------------------------------------------
/easy/003-prime-palindrome/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 3
2 | name: Prime Palindrome
3 | category: Easy
4 | summary: Biggest prime palindrome < 1000.
5 | url: "https://www.codeeval.com/browse/3/"
6 |
--------------------------------------------------------------------------------
/easy/003-prime-palindrome/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/003-prime-palindrome/readme.pdf
--------------------------------------------------------------------------------
/easy/004-sum-of-primes/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 4
2 | name: Sum of Primes
3 | category: Easy
4 | summary: Sum of first 1000 primes.
5 | url: "https://www.codeeval.com/browse/4/"
6 |
--------------------------------------------------------------------------------
/easy/004-sum-of-primes/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/004-sum-of-primes/readme.pdf
--------------------------------------------------------------------------------
/easy/008-reverse-words/input.txt:
--------------------------------------------------------------------------------
1 | Hello World
2 | Hello CodeEval
3 |
--------------------------------------------------------------------------------
/easy/008-reverse-words/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 8
2 | name: Reverse Words
3 | category: Easy
4 | summary: Reversing an input sequence of words.
5 | url: https://www.codeeval.com/browse/8/
6 |
--------------------------------------------------------------------------------
/easy/008-reverse-words/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/008-reverse-words/readme.pdf
--------------------------------------------------------------------------------
/easy/018-multiples-of-a-number/input.txt:
--------------------------------------------------------------------------------
1 | 13,8
2 | 17,16
3 |
--------------------------------------------------------------------------------
/easy/018-multiples-of-a-number/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 18
2 | name: Multiples of a Number
3 | category: Easy
4 | summary: Multiples of a number greater than another number.
5 | url: "https://www.codeeval.com/browse/18/"
6 |
--------------------------------------------------------------------------------
/easy/018-multiples-of-a-number/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/018-multiples-of-a-number/readme.pdf
--------------------------------------------------------------------------------
/easy/019-bit-positions/input.txt:
--------------------------------------------------------------------------------
1 | 86,2,3
2 | 125,1,2
3 |
--------------------------------------------------------------------------------
/easy/019-bit-positions/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 19
2 | name: Bit Positions
3 | category: Easy
4 | summary: "Bits in position x,y are same or different."
5 | url: "https://www.codeeval.com/browse/19/"
6 |
--------------------------------------------------------------------------------
/easy/019-bit-positions/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/019-bit-positions/readme.pdf
--------------------------------------------------------------------------------
/easy/020-lowercase/input.txt:
--------------------------------------------------------------------------------
1 | HELLO CODEEVAL
2 | This is some text
3 |
--------------------------------------------------------------------------------
/easy/020-lowercase/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 20
2 | name: Lowercase
3 | category: Easy
4 | summary: Lowercase text.
5 | url: https://www.codeeval.com/browse/20/
6 |
--------------------------------------------------------------------------------
/easy/020-lowercase/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/020-lowercase/readme.pdf
--------------------------------------------------------------------------------
/easy/021-sum-of-digits/input.txt:
--------------------------------------------------------------------------------
1 | 23
2 | 496
3 |
--------------------------------------------------------------------------------
/easy/021-sum-of-digits/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 21
2 | name: Sum of Digits
3 | category: Easy
4 | summary: Sum of digits comprising a number.
5 | url: https://www.codeeval.com/browse/21/
6 |
--------------------------------------------------------------------------------
/easy/021-sum-of-digits/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/021-sum-of-digits/readme.pdf
--------------------------------------------------------------------------------
/easy/022-fibonacci-series/input.txt:
--------------------------------------------------------------------------------
1 | 5
2 | 12
3 |
--------------------------------------------------------------------------------
/easy/022-fibonacci-series/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 22
2 | name: Fibonacci Series
3 | category: Easy
4 | summary: Print out the nth fibonacci number.
5 | url: "https://www.codeeval.com/browse/22/"
6 |
--------------------------------------------------------------------------------
/easy/022-fibonacci-series/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/022-fibonacci-series/readme.pdf
--------------------------------------------------------------------------------
/easy/023-multiplication-tables/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 23
2 | name: Multiplication Tables
3 | category: Easy
4 | summary: "Print out the grade school multiplication table upto 12*12."
5 | url: "https://www.codeeval.com/browse/23/"
6 |
--------------------------------------------------------------------------------
/easy/023-multiplication-tables/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/023-multiplication-tables/readme.pdf
--------------------------------------------------------------------------------
/easy/024-sum-of-integers-from-file/input.txt:
--------------------------------------------------------------------------------
1 | 5
2 | 12
3 |
--------------------------------------------------------------------------------
/easy/024-sum-of-integers-from-file/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 24
2 | name: Sum of Integers From File
3 | category: Easy
4 | summary: Print the sum of integers read from a file.
5 | url: https://www.codeeval.com/browse/24/
6 |
--------------------------------------------------------------------------------
/easy/024-sum-of-integers-from-file/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/024-sum-of-integers-from-file/readme.pdf
--------------------------------------------------------------------------------
/easy/025-odd-numbers/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 25
2 | name: Odd Numbers
3 | category: Easy
4 | summary: Print the odd numbers from 1 to 99.
5 | url: https://www.codeeval.com/browse/25/
6 |
--------------------------------------------------------------------------------
/easy/025-odd-numbers/readme.md:
--------------------------------------------------------------------------------
1 |
Odd Numbers
2 |
3 | Challenge Description:
4 |
5 |
6 | Print the odd numbers from 1 to 99.
7 |
8 |
9 | Input sample:
10 |
11 | There is no input for this program.
12 |
13 |
14 | Output sample:
15 |
16 |
17 | Print the odd numbers from 1 to 99, one number per line.
18 |
19 |
--------------------------------------------------------------------------------
/easy/025-odd-numbers/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/025-odd-numbers/readme.pdf
--------------------------------------------------------------------------------
/easy/026-file-size/input.txt:
--------------------------------------------------------------------------------
1 | 012345678901234567890123456789012345678901234567890123
2 |
--------------------------------------------------------------------------------
/easy/026-file-size/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 26
2 | name: File Size
3 | category: Easy
4 | summary: Print the file size in bytes.
5 | url: https://www.codeeval.com/browse/26/
6 |
--------------------------------------------------------------------------------
/easy/026-file-size/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/026-file-size/readme.pdf
--------------------------------------------------------------------------------
/easy/029-unique-elements/input.txt:
--------------------------------------------------------------------------------
1 | 1,1,1,2,2,3,3,4,4
2 | 2,3,4,5,5
3 |
--------------------------------------------------------------------------------
/easy/029-unique-elements/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 29
2 | name: Unique Elements
3 | category: Easy
4 | summary: Extract unique list from a sorted list of numbers.
5 | url: "https://www.codeeval.com/browse/29/"
6 |
--------------------------------------------------------------------------------
/easy/029-unique-elements/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/029-unique-elements/readme.pdf
--------------------------------------------------------------------------------
/easy/030-set-intersection/input.txt:
--------------------------------------------------------------------------------
1 | 1,2,3,4;4,5,6
2 | 20,21,22;45,46,47
3 | 7,8,9;8,9,10,11,12
4 |
--------------------------------------------------------------------------------
/easy/030-set-intersection/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 30
2 | name: Set Intersection
3 | category: Easy
4 | summary: Print the intersection of two sets of numbers.
5 | url: "https://www.codeeval.com/browse/30/"
6 |
--------------------------------------------------------------------------------
/easy/030-set-intersection/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/030-set-intersection/readme.pdf
--------------------------------------------------------------------------------
/easy/031-rightmost-char/input.txt:
--------------------------------------------------------------------------------
1 | Hello World,r
2 | Hello CodeEval,E
3 |
--------------------------------------------------------------------------------
/easy/031-rightmost-char/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 31
2 | name: Rightmost Char
3 | category: Easy
4 | summary: Print the position of the rightmost occurrence of a char.
5 | url: "https://www.codeeval.com/browse/31/"
6 |
--------------------------------------------------------------------------------
/easy/031-rightmost-char/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/031-rightmost-char/readme.pdf
--------------------------------------------------------------------------------
/easy/039-happy-numbers/input.txt:
--------------------------------------------------------------------------------
1 | 1
2 | 7
3 | 22
4 |
--------------------------------------------------------------------------------
/easy/039-happy-numbers/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 39
2 | name: Happy Numbers
3 | category: Easy
4 | summary: Determine if a number is a happy number or not.
5 | url: "https://www.codeeval.com/browse/39/"
6 |
--------------------------------------------------------------------------------
/easy/039-happy-numbers/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/039-happy-numbers/readme.pdf
--------------------------------------------------------------------------------
/easy/040-self-describing-numbers/input.txt:
--------------------------------------------------------------------------------
1 | 2020
2 | 22
3 | 1210
4 |
--------------------------------------------------------------------------------
/easy/040-self-describing-numbers/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 40
2 | name: Self Describing Numbers
3 | category: Easy
4 | summary: Determine if a number is a self-describing number or not.
5 | url: "https://www.codeeval.com/browse/40/"
6 |
--------------------------------------------------------------------------------
/easy/040-self-describing-numbers/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/040-self-describing-numbers/readme.pdf
--------------------------------------------------------------------------------
/easy/062-n-mod-m/input.txt:
--------------------------------------------------------------------------------
1 | 20,6
2 | 2,3
3 |
--------------------------------------------------------------------------------
/easy/062-n-mod-m/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 62
2 | name: N Mod M
3 | category: Easy
4 | summary: Determine the modulus (without the modulus operator).
5 | url: "https://www.codeeval.com/browse/62/"
6 |
--------------------------------------------------------------------------------
/easy/062-n-mod-m/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/062-n-mod-m/readme.pdf
--------------------------------------------------------------------------------
/easy/067-hex-to-decimal/input.txt:
--------------------------------------------------------------------------------
1 | 9f
2 | 11
3 |
--------------------------------------------------------------------------------
/easy/067-hex-to-decimal/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 67
2 | name: Hex to Decimal
3 | category: Easy
4 | summary: Convert a hex number to it's decimal equivalent.
5 | url: https://www.codeeval.com/browse/67/
6 |
--------------------------------------------------------------------------------
/easy/067-hex-to-decimal/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/067-hex-to-decimal/readme.pdf
--------------------------------------------------------------------------------
/easy/082-armstrong-numbers/input.txt:
--------------------------------------------------------------------------------
1 | 6
2 | 153
3 | 351
4 |
--------------------------------------------------------------------------------
/easy/082-armstrong-numbers/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 82
2 | name: Armstrong Numbers
3 | category: Easy
4 | summary: Determine if a number is an armstrong number.
5 | url: "https://www.codeeval.com/browse/82/"
6 |
--------------------------------------------------------------------------------
/easy/082-armstrong-numbers/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/082-armstrong-numbers/readme.pdf
--------------------------------------------------------------------------------
/easy/083-beautiful-strings/input.txt:
--------------------------------------------------------------------------------
1 | ABbCcc
2 | Good luck in the Facebook Hacker Cup this year!
3 | Ignore punctuation, please :)
4 | Sometimes test cases are hard to make up.
5 | So I just go consult Professor Dalves
6 |
--------------------------------------------------------------------------------
/easy/083-beautiful-strings/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 83
2 | name: Beautiful Strings
3 | category: Easy
4 | summary: Facebook Hacker Cup 2013 problem.
5 | url: "https://www.codeeval.com/browse/83/"
6 |
--------------------------------------------------------------------------------
/easy/083-beautiful-strings/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/083-beautiful-strings/readme.pdf
--------------------------------------------------------------------------------
/easy/087-query-board/input.txt:
--------------------------------------------------------------------------------
1 | SetCol 32 20
2 | SetRow 15 7
3 | SetRow 16 31
4 | QueryCol 32
5 | SetCol 2 14
6 | QueryRow 10
7 | SetCol 14 0
8 | QueryRow 15
9 | SetRow 10 1
10 | QueryCol 2
11 |
--------------------------------------------------------------------------------
/easy/087-query-board/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 87
2 | name: Query Board
3 | category: Easy
4 | summary: Set and get values from a matrix using tiny DSL.
5 | url: "https://www.codeeval.com/browse/87/"
6 |
--------------------------------------------------------------------------------
/easy/087-query-board/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/087-query-board/readme.pdf
--------------------------------------------------------------------------------
/easy/091-simple-sorting/input.txt:
--------------------------------------------------------------------------------
1 | 70.920 -38.797 14.354 99.323 90.374 7.581
2 | -37.507 -3.263 40.079 27.999 65.213 -55.552
3 |
--------------------------------------------------------------------------------
/easy/091-simple-sorting/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 91
2 | name: Simple Sorting
3 | category: Easy
4 | summary: Sort several numbers.
5 | url: "https://www.codeeval.com/browse/91/"
6 |
--------------------------------------------------------------------------------
/easy/091-simple-sorting/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/091-simple-sorting/readme.pdf
--------------------------------------------------------------------------------
/easy/092-penultimate-word/input.txt:
--------------------------------------------------------------------------------
1 | some line with text
2 | another line
3 |
--------------------------------------------------------------------------------
/easy/092-penultimate-word/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 92
2 | name: Penultimate Word
3 | category: Easy
4 | summary: Find the next-to-last word.
5 | url: "https://www.codeeval.com/browse/92/"
6 |
--------------------------------------------------------------------------------
/easy/092-penultimate-word/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/092-penultimate-word/readme.pdf
--------------------------------------------------------------------------------
/easy/093-capitalize-words/input.txt:
--------------------------------------------------------------------------------
1 | Hello world
2 | javaScript language
3 | a letter
4 | 1st thing
5 |
--------------------------------------------------------------------------------
/easy/093-capitalize-words/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 93
2 | name: Capitalize Words
3 | category: Easy
4 | summary: Capitalize words in a sentence.
5 | url: "https://www.codeeval.com/browse/93/"
6 |
--------------------------------------------------------------------------------
/easy/093-capitalize-words/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/093-capitalize-words/readme.pdf
--------------------------------------------------------------------------------
/easy/096-swap-case/input.txt:
--------------------------------------------------------------------------------
1 | Hello world!
2 | JavaScript language 1.8
3 | A letter
4 |
--------------------------------------------------------------------------------
/easy/096-swap-case/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 96
2 | name: Swap Case
3 | category: Easy
4 | summary: Swap case in a string.
5 | url: https://www.codeeval.com/browse/96/
6 |
--------------------------------------------------------------------------------
/easy/096-swap-case/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/096-swap-case/readme.pdf
--------------------------------------------------------------------------------
/easy/097-find-a-writer/input.txt:
--------------------------------------------------------------------------------
1 | osSE5Gu0Vi8WRq93UvkYZCjaOKeNJfTyH6tzDQbxFm4M1ndXIPh27wBA rLclpg| 3 35 27 62 51 27 46 57 26 10 46 63 57 45 15 43 53
2 | 3Kucdq9bfCEgZGF2nwx8UpzQJyHiOm0hoaYP6ST1WM7Nks5XjrR4IltBeDLV vA| 2 26 33 55 34 50 33 61 44 28 46 32 28 30 3 50 34 61 40 7 1 31
3 |
--------------------------------------------------------------------------------
/easy/097-find-a-writer/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 97
2 | name: Find a Writer
3 | category: Easy
4 | summary: Find a famous writer in a string.
5 | url: "https://www.codeeval.com/browse/97/"
6 |
--------------------------------------------------------------------------------
/easy/097-find-a-writer/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/097-find-a-writer/readme.pdf
--------------------------------------------------------------------------------
/easy/099-calculate-distance/input.txt:
--------------------------------------------------------------------------------
1 | (25, 4) (1, -6)
2 | (47, 43) (-25, -11)
3 |
--------------------------------------------------------------------------------
/easy/099-calculate-distance/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 99
2 | name: Calculate Distance
3 | category: Easy
4 | summary: Calculate a distance between two points.
5 | url: "https://www.codeeval.com/browse/99/"
6 |
--------------------------------------------------------------------------------
/easy/099-calculate-distance/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/099-calculate-distance/readme.pdf
--------------------------------------------------------------------------------
/easy/100-even-numbers/input.txt:
--------------------------------------------------------------------------------
1 | 701
2 | 4123
3 | 2936
4 |
--------------------------------------------------------------------------------
/easy/100-even-numbers/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 100
2 | name: Even Numbers
3 | category: Easy
4 | summary: Determine if a number is even or not.
5 | url: https://www.codeeval.com/browse/100/
6 |
--------------------------------------------------------------------------------
/easy/100-even-numbers/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/100-even-numbers/readme.pdf
--------------------------------------------------------------------------------
/easy/102-json-menu-ids/input.txt:
--------------------------------------------------------------------------------
1 | {"menu": {"header": "menu", "items": [{"id": 27}, {"id": 0, "label": "Label 0"}, null, {"id": 93}, {"id": 85}, {"id": 54}, null, {"id": 46, "label": "Label 46"}]}}
2 | {"menu": {"header": "menu", "items": [{"id": 81}]}}
3 | {"menu": {"header": "menu", "items": [{"id": 70, "label": "Label 70"}, {"id": 85, "label": "Label 85"}, {"id": 93, "label": "Label 93"}, {"id": 2}]}}
4 |
--------------------------------------------------------------------------------
/easy/102-json-menu-ids/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 102
2 | name: JSON Menu IDs
3 | category: Easy
4 | summary: Calculate IDs in JSON menu.
5 | url: "https://www.codeeval.com/browse/102/"
6 |
--------------------------------------------------------------------------------
/easy/102-json-menu-ids/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/102-json-menu-ids/readme.pdf
--------------------------------------------------------------------------------
/easy/103-lowest-unique-number/input.txt:
--------------------------------------------------------------------------------
1 | 3 3 9 1 6 5 8 1 5 3
2 | 9 2 9 9 1 8 8 8 2 1 1
3 |
--------------------------------------------------------------------------------
/easy/103-lowest-unique-number/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 103
2 | name: Lowest Unique Number
3 | category: Easy
4 | summary: Find the lowest unique number in a set.
5 | url: "https://www.codeeval.com/browse/103/"
6 |
--------------------------------------------------------------------------------
/easy/103-lowest-unique-number/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/103-lowest-unique-number/readme.pdf
--------------------------------------------------------------------------------
/easy/104-word-to-digit/input.txt:
--------------------------------------------------------------------------------
1 | zero;two;five;seven;eight;four
2 | three;seven;eight;nine;two
3 |
--------------------------------------------------------------------------------
/easy/104-word-to-digit/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 104
2 | name: Word to Digit
3 | category: Easy
4 | summary: Substitute words to digits.
5 | url: https://www.codeeval.com/browse/104/
6 |
--------------------------------------------------------------------------------
/easy/104-word-to-digit/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/104-word-to-digit/readme.pdf
--------------------------------------------------------------------------------
/easy/106-roman-numerals/input.txt:
--------------------------------------------------------------------------------
1 | 159
2 | 296
3 | 3992
4 |
--------------------------------------------------------------------------------
/easy/106-roman-numerals/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 106
2 | name: Roman Numerals
3 | category: Easy
4 | summary: Convert a cardinal number to a Roman numeral.
5 | url: "https://www.codeeval.com/browse/106/"
6 |
--------------------------------------------------------------------------------
/easy/106-roman-numerals/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/106-roman-numerals/readme.pdf
--------------------------------------------------------------------------------
/easy/107-shortest-repetition/input.txt:
--------------------------------------------------------------------------------
1 | abcabcabcabc
2 | bcbcbcbcbcbcbcbcbcbcbcbcbcbc
3 | dddddddddddddddddddd
4 | adcdefg
5 |
--------------------------------------------------------------------------------
/easy/107-shortest-repetition/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 107
2 | name: Shortest Repetition
3 | category: Easy
4 | summary: Find the shortest repetition in a string.
5 | url: "https://www.codeeval.com/browse/107/"
6 |
--------------------------------------------------------------------------------
/easy/107-shortest-repetition/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/107-shortest-repetition/readme.pdf
--------------------------------------------------------------------------------
/easy/111-longest-word/input.txt:
--------------------------------------------------------------------------------
1 | some line with text
2 | another line
3 |
--------------------------------------------------------------------------------
/easy/111-longest-word/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 111
2 | name: Longest Word
3 | category: Easy
4 | summary: Get the longest word in a sentence.
5 | url: "https://www.codeeval.com/browse/111/"
6 |
--------------------------------------------------------------------------------
/easy/111-longest-word/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/111-longest-word/readme.pdf
--------------------------------------------------------------------------------
/easy/112-swap-elements/input.txt:
--------------------------------------------------------------------------------
1 | 1 2 3 4 5 6 7 8 9 : 0-8
2 | 1 2 3 4 5 6 7 8 9 10 : 0-1, 1-3
3 |
--------------------------------------------------------------------------------
/easy/112-swap-elements/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 112
2 | name: Swap Elements
3 | category: Easy
4 | summary: Swap elements in a list.
5 | url: "https://www.codeeval.com/browse/112/"
6 |
--------------------------------------------------------------------------------
/easy/112-swap-elements/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/112-swap-elements/readme.pdf
--------------------------------------------------------------------------------
/easy/113-multiply-lists/input.txt:
--------------------------------------------------------------------------------
1 | 9 0 6 | 15 14 9
2 | 5 | 8
3 | 13 4 15 1 15 5 | 1 4 15 14 8 2
4 |
--------------------------------------------------------------------------------
/easy/113-multiply-lists/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 113
2 | name: Multiply Lists
3 | category: Easy
4 | summary: Multiply elements in 2 lists.
5 | url: "https://www.codeeval.com/browse/113/"
6 |
--------------------------------------------------------------------------------
/easy/113-multiply-lists/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/113-multiply-lists/readme.pdf
--------------------------------------------------------------------------------
/easy/115-mixed-content/input.txt:
--------------------------------------------------------------------------------
1 | 8,33,21,0,16,50,37,0,melon,7,apricot,peach,pineapple,17,21
2 | 24,13,14,43,41
3 |
--------------------------------------------------------------------------------
/easy/115-mixed-content/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 115
2 | name: Mixed Content
3 | category: Easy
4 | summary: Separate words with digits.
5 | url: "https://www.codeeval.com/browse/115/"
6 |
--------------------------------------------------------------------------------
/easy/115-mixed-content/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/115-mixed-content/readme.pdf
--------------------------------------------------------------------------------
/easy/116-morse-code/input.txt:
--------------------------------------------------------------------------------
1 | .- ...- ..--- .-- .... .. . -.-. -..- ....- .....
2 | -... .... ...--
3 |
--------------------------------------------------------------------------------
/easy/116-morse-code/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 116
2 | name: Morse Code
3 | category: Easy
4 | summary: Decode Morse code.
5 | url: "https://www.codeeval.com/browse/116/"
6 |
--------------------------------------------------------------------------------
/easy/116-morse-code/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/116-morse-code/readme.pdf
--------------------------------------------------------------------------------
/easy/122-hidden-digits/input.txt:
--------------------------------------------------------------------------------
1 | abcdefghik
2 | Xa,}A#5N}{xOBwYBHIlH,#W
3 | (ABW>'yy^'M{X-K}q,
4 | 6240488
5 |
--------------------------------------------------------------------------------
/easy/122-hidden-digits/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 122
2 | name: Hidden Digits
3 | category: Easy
4 | summary: Try to look behind the scenes.
5 | url: "https://www.codeeval.com/browse/122/"
6 |
--------------------------------------------------------------------------------
/easy/122-hidden-digits/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/122-hidden-digits/readme.pdf
--------------------------------------------------------------------------------
/easy/124-road-trip/input.txt:
--------------------------------------------------------------------------------
1 | Rkbs,5453; Wdqiz,1245; Rwds,3890; Ujma,5589; Tbzmo,1303;
2 | Vgdfz,70; Mgknxpi,3958; Nsptghk,2626; Wuzp,2559; Jcdwi,3761;
3 | Yvnzjwk,5363; Pkabj,5999; Xznvb,3584; Jfksvx,1240; Inwm,5720;
4 | Ramytdb,2683; Voclqmb,5236;
5 |
--------------------------------------------------------------------------------
/easy/124-road-trip/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 124
2 | name: Road Trip
3 | category: Easy
4 | summary: Do not be left without petrol.
5 | url: "https://www.codeeval.com/browse/124/"
6 |
--------------------------------------------------------------------------------
/easy/124-road-trip/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/124-road-trip/readme.pdf
--------------------------------------------------------------------------------
/easy/128-compressed-sequence/input.txt:
--------------------------------------------------------------------------------
1 | 40 40 40 40 29 29 29 29 29 29 29 29 57 57 92 92 92 92 92 86 86 86 86 86 86 86 86 86 86
2 | 73 73 73 73 41 41 41 41 41 41 41 41 41 41
3 | 1 1 3 3 3 2 2 2 2 14 14 14 11 11 11 2
4 | 7
5 |
--------------------------------------------------------------------------------
/easy/128-compressed-sequence/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 128
2 | name: Compressed Sequence
3 | category: Easy
4 | summary: Write a program that compresses a sequence of numbers.
5 | url: "https://www.codeeval.com/browse/128/"
6 |
--------------------------------------------------------------------------------
/easy/128-compressed-sequence/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/128-compressed-sequence/readme.pdf
--------------------------------------------------------------------------------
/easy/131-split-the-number/input.txt:
--------------------------------------------------------------------------------
1 | 3413289830 a-bcdefghij
2 | 776 a+bc
3 | 12345 a+bcde
4 | 1232 ab+cd
5 | 90602 a+bcde
6 |
--------------------------------------------------------------------------------
/easy/131-split-the-number/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 131
2 | name: Split the Number
3 | category: Easy
4 | summary: Evaluate the number according to the pattern.
5 | url: "https://www.codeeval.com/browse/131/"
6 |
--------------------------------------------------------------------------------
/easy/131-split-the-number/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/131-split-the-number/readme.pdf
--------------------------------------------------------------------------------
/easy/132-the-major-element/input.txt:
--------------------------------------------------------------------------------
1 | 92,19,19,76,19,21,19,85,19,19,19,94,19,19,22,67,83,19,19,54,59,1,19,19
2 | 92,11,30,92,1,11,92,38,92,92,43,92,92,51,92,36,97,92,92,92,43,22,84,92,92
3 | 4,79,89,98,48,42,39,79,55,70,21,39,98,16,96,2,10,24,14,47,0,50,95,20,95,48,50,12,42
4 |
--------------------------------------------------------------------------------
/easy/132-the-major-element/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 132
2 | name: The Major Element
3 | category: Easy
4 | summary: Find the major element in a sequence.
5 | url: "https://www.codeeval.com/browse/132/"
6 |
--------------------------------------------------------------------------------
/easy/132-the-major-element/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/132-the-major-element/readme.pdf
--------------------------------------------------------------------------------
/easy/136-racing-chars/input.txt:
--------------------------------------------------------------------------------
1 | #########_##
2 | ########C_##
3 | #######_####
4 | ######_#C###
5 | #######_C###
6 | #######_####
7 | ######C#_###
8 | ######C_####
9 | #######_####
10 | #######_####
11 |
--------------------------------------------------------------------------------
/easy/136-racing-chars/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 136
2 | name: Racing Chars
3 | category: Easy
4 | summary: Explore a race track avoiding crashes.
5 | url: "https://www.codeeval.com/browse/136/"
6 |
--------------------------------------------------------------------------------
/easy/136-racing-chars/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/136-racing-chars/readme.pdf
--------------------------------------------------------------------------------
/easy/139-working-experience/input.txt:
--------------------------------------------------------------------------------
1 | Feb 2004-Dec 2009; Sep 2004-Jul 2008
2 | Aug 2013-Mar 2014; Apr 2013-Aug 2013; Jun 2014-Aug 2015; Apr 2003-Nov 2004; Apr 2014-Jan 2015
3 | Mar 2003-Jul 2003; Nov 2003-Jan 2004; Apr 1999-Nov 1999
4 | Apr 1992-Dec 1993; Feb 1996-Sep 1997; Jan 2002-Jun 2002; Sep 2003-Apr 2004; Feb 2010-Nov 2011
5 | Feb 2004-May 2004; Jun 2004-Jul 2004
6 |
--------------------------------------------------------------------------------
/easy/139-working-experience/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 139
2 | name: Working Experience
3 | category: Easy
4 | summary: Retrieve an actual value.
5 | url: "https://www.codeeval.com/browse/139/"
6 |
--------------------------------------------------------------------------------
/easy/139-working-experience/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/139-working-experience/readme.pdf
--------------------------------------------------------------------------------
/easy/140-data-recovery/input.txt:
--------------------------------------------------------------------------------
1 | 2000 and was not However, implemented 1998 it until;9 8 3 4 1 5 7 2
2 | programming first The language;3 2 1
3 | programs Manchester The written ran Mark 1952 1 in Autocode from;6 2 1 7 5 3 11 4 8 9
4 |
--------------------------------------------------------------------------------
/easy/140-data-recovery/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 140
2 | name: Data Recovery
3 | category: Easy
4 | summary: Reconstruct a sentence using hints.
5 | url: "https://www.codeeval.com/browse/140/"
6 |
--------------------------------------------------------------------------------
/easy/140-data-recovery/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/140-data-recovery/readme.pdf
--------------------------------------------------------------------------------
/easy/147-lettercase-percentage-ratio/input.txt:
--------------------------------------------------------------------------------
1 | thisTHIS
2 | AAbbCCDDEE
3 | N
4 | UkJ
5 |
--------------------------------------------------------------------------------
/easy/147-lettercase-percentage-ratio/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 147
2 | name: Lettercase Percentage Ratio
3 | category: Easy
4 | summary: Find the percentage ratio.
5 | url: "https://www.codeeval.com/browse/147/"
6 |
--------------------------------------------------------------------------------
/easy/147-lettercase-percentage-ratio/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/147-lettercase-percentage-ratio/readme.pdf
--------------------------------------------------------------------------------
/easy/149-juggling-with-zeros/input.txt:
--------------------------------------------------------------------------------
1 | 00 0 0 00 00 0
2 | 00 0
3 | 00 0 0 000 00 0000000 0 000
4 | 0 000000000 00 00
5 |
--------------------------------------------------------------------------------
/easy/149-juggling-with-zeros/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 149
2 | name: Juggling With Zeros
3 | category: Easy
4 | summary: Convert a zero-based number into integer.
5 | url: "https://www.codeeval.com/browse/149/"
6 |
--------------------------------------------------------------------------------
/easy/149-juggling-with-zeros/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/149-juggling-with-zeros/readme.pdf
--------------------------------------------------------------------------------
/easy/152-age-distribution/input.txt:
--------------------------------------------------------------------------------
1 | 0
2 | 19
3 |
--------------------------------------------------------------------------------
/easy/152-age-distribution/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 152
2 | name: Age Distribution
3 | category: Easy
4 | summary: Print out where the person is.
5 | url: https://www.codeeval.com/browse/152/
6 |
--------------------------------------------------------------------------------
/easy/152-age-distribution/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/152-age-distribution/readme.pdf
--------------------------------------------------------------------------------
/easy/156-roller-coaster/input.txt:
--------------------------------------------------------------------------------
1 | To be, or not to be: that is the question.
2 | Whether 'tis nobler in the mind to suffer.
3 | The slings and arrows of outrageous fortune.
4 | Or to take arms against a sea of troubles.
5 | And by opposing end them, to die: to sleep.
6 |
--------------------------------------------------------------------------------
/easy/156-roller-coaster/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 156
2 | name: Roller Coaster
3 | category: Easy
4 | summary: Turn the text into RoLlErCoAsTeR case.
5 | url: "https://www.codeeval.com/browse/156/"
6 |
--------------------------------------------------------------------------------
/easy/156-roller-coaster/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/156-roller-coaster/readme.pdf
--------------------------------------------------------------------------------
/easy/160-nice-angles/input.txt:
--------------------------------------------------------------------------------
1 | 330.39991833
2 | 0.001
3 | 14.64530319
4 | 0.25
5 | 254.16991217
6 |
--------------------------------------------------------------------------------
/easy/160-nice-angles/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 160
2 | name: Nice Angles
3 | category: Easy
4 | summary: Convert angle values to sexagesimal format.
5 | url: "https://www.codeeval.com/browse/160/"
6 |
--------------------------------------------------------------------------------
/easy/160-nice-angles/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/160-nice-angles/readme.pdf
--------------------------------------------------------------------------------
/easy/163-big-digits/input.txt:
--------------------------------------------------------------------------------
1 | 3.1415926
2 | 1.41421356
3 | 01-01-1970
4 | 2.7182818284
5 | 4 8 15 16 23 42
6 |
--------------------------------------------------------------------------------
/easy/163-big-digits/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 163
2 | name: Big Digits
3 | category: Easy
4 | summary: Print out magnified digits using pseudographics.
5 | url: "https://www.codeeval.com/browse/163/"
6 |
--------------------------------------------------------------------------------
/easy/163-big-digits/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/163-big-digits/readme.pdf
--------------------------------------------------------------------------------
/easy/166-delta-time/input.txt:
--------------------------------------------------------------------------------
1 | 14:01:57 12:47:11
2 | 13:09:42 22:16:15
3 | 08:08:06 08:38:28
4 | 23:35:07 02:49:59
5 | 14:31:45 14:46:56
6 |
--------------------------------------------------------------------------------
/easy/166-delta-time/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 166
2 | name: Delta Time
3 | category: Easy
4 | summary: Find the time difference.
5 | url: "https://www.codeeval.com/browse/166/"
6 |
--------------------------------------------------------------------------------
/easy/166-delta-time/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/166-delta-time/readme.pdf
--------------------------------------------------------------------------------
/easy/167-read-more/input.txt:
--------------------------------------------------------------------------------
1 | Tom exhibited.
2 | Amy Lawrence was proud and glad, and she tried to make Tom see it in her face - but he wouldn't look.
3 | Tom was tugging at a button-hole and looking sheepish.
4 | Two thousand verses is a great many - very, very great many.
5 | Tom's mouth watered for the apple, but he stuck to his work.
6 |
--------------------------------------------------------------------------------
/easy/167-read-more/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 167
2 | name: Read More
3 | category: Easy
4 | summary: Limit the length of the text.
5 | url: "https://www.codeeval.com/browse/167/"
6 |
--------------------------------------------------------------------------------
/easy/167-read-more/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/167-read-more/readme.pdf
--------------------------------------------------------------------------------
/easy/173-without-repetitions/input.txt:
--------------------------------------------------------------------------------
1 | But as he spake he drew the good sword from its scabbard, and smote a heathen knight, Jusssstin of thee Iron Valley.
2 | No matttter whom you choose, she deccccclared, I will abide by your decision.
3 | Wwwhat is your will?
4 | At his magic speech the ground oppened and he began the path of descent.
5 | I should fly away and you would never see me again.
6 |
--------------------------------------------------------------------------------
/easy/173-without-repetitions/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 173
2 | name: Without Repetitions
3 | category: Easy
4 | summary: Delete characters that are consistently repeated.
5 | url: "https://www.codeeval.com/browse/173/"
6 |
--------------------------------------------------------------------------------
/easy/173-without-repetitions/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/173-without-repetitions/readme.pdf
--------------------------------------------------------------------------------
/easy/174-slang-flavor/input.txt:
--------------------------------------------------------------------------------
1 | Lorem ipsum dolor sit amet. Mea et habeo doming praesent. Te inani utroque recteque has, sea ne fugit verterem!
2 | Usu ei scripta phaedrum, an sed salutatus definiebas? Qui ut recteque gloriatur reformidans. Qui solum aeque sapientem cu.
3 | Eu nam nusquam quaestio principes.
4 |
--------------------------------------------------------------------------------
/easy/174-slang-flavor/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 174
2 | name: Slang Flavor
3 | category: Easy
4 | summary: Add some slang to the text.
5 | url: https://www.codeeval.com/browse/174/
6 |
--------------------------------------------------------------------------------
/easy/174-slang-flavor/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/174-slang-flavor/readme.pdf
--------------------------------------------------------------------------------
/easy/178-matrix-rotation/input.txt:
--------------------------------------------------------------------------------
1 | a b c d
2 | a b c d e f g h i j k l m n o p
3 | a b c d e f g h i
4 |
--------------------------------------------------------------------------------
/easy/178-matrix-rotation/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 178
2 | name: Matrix Rotation
3 | category: Easy
4 | summary: Rotate a 2D matrix 90 degrees clockwise.
5 | url: https://www.codeeval.com/browse/178/
6 |
--------------------------------------------------------------------------------
/easy/178-matrix-rotation/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/178-matrix-rotation/readme.pdf
--------------------------------------------------------------------------------
/easy/180-knight-moves/assets/fig-1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/180-knight-moves/assets/fig-1.png
--------------------------------------------------------------------------------
/easy/180-knight-moves/input.txt:
--------------------------------------------------------------------------------
1 | g2
2 | a1
3 | d6
4 | e5
5 | b1
6 |
--------------------------------------------------------------------------------
/easy/180-knight-moves/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 180
2 | name: Knight Moves
3 | category: Easy
4 | summary: Find positions for the next move of the knight.
5 | url: https://www.codeeval.com/browse/180/
6 |
--------------------------------------------------------------------------------
/easy/180-knight-moves/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/180-knight-moves/readme.pdf
--------------------------------------------------------------------------------
/easy/183-details/assets/fig-1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/183-details/assets/fig-1.png
--------------------------------------------------------------------------------
/easy/183-details/assets/fig-2.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/183-details/assets/fig-2.png
--------------------------------------------------------------------------------
/easy/183-details/input.txt:
--------------------------------------------------------------------------------
1 | XX.YY,XXX.Y,X..YY,XX..Y
2 | XX...YY,X....YY,XX..YYY,X..YYYY
3 | XXYY,X..Y,XX.Y
4 |
--------------------------------------------------------------------------------
/easy/183-details/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 183
2 | name: Details
3 | category: Easy
4 | summary: Determine how many cells will be shifted detail.
5 | url: https://www.codeeval.com/browse/183/
6 |
--------------------------------------------------------------------------------
/easy/183-details/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/183-details/readme.pdf
--------------------------------------------------------------------------------
/easy/186-max-range-sum/input.txt:
--------------------------------------------------------------------------------
1 | 5;7 -3 -10 4 2 8 -2 4 -5 -2
2 | 6;-4 3 -10 5 3 -7 -3 7 -6 3
3 | 3;-7 0 -45 34 -24 7
4 |
--------------------------------------------------------------------------------
/easy/186-max-range-sum/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 186
2 | name: Max Range Sum
3 | category: Easy
4 | summary: Determine max sum at the range.
5 | url: "https://www.codeeval.com/browse/186/"
6 |
--------------------------------------------------------------------------------
/easy/186-max-range-sum/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/186-max-range-sum/readme.pdf
--------------------------------------------------------------------------------
/easy/189-minimum-distance/input.txt:
--------------------------------------------------------------------------------
1 | 4 3 3 5 7
2 | 3 20 30 40
3 |
--------------------------------------------------------------------------------
/easy/189-minimum-distance/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 189
2 | name: Minimum Distance
3 | category: Easy
4 | summary: Find a point with the smallest sum of distances to every given point.
5 | url: "https://www.codeeval.com/browse/189/"
6 |
--------------------------------------------------------------------------------
/easy/189-minimum-distance/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/189-minimum-distance/readme.pdf
--------------------------------------------------------------------------------
/easy/192-compare-points/input.txt:
--------------------------------------------------------------------------------
1 | 0 0 1 5
2 | 12 13 12 13
3 | 0 1 0 5
4 |
--------------------------------------------------------------------------------
/easy/192-compare-points/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 192
2 | name: Compare Points
3 | category: Easy
4 | summary: "Given two (x, y) points A and B, determine which cardinal direction B is from A."
5 | url: "https://www.codeeval.com/browse/192/"
6 |
--------------------------------------------------------------------------------
/easy/192-compare-points/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/192-compare-points/readme.pdf
--------------------------------------------------------------------------------
/easy/196-swap-numbers/input.txt:
--------------------------------------------------------------------------------
1 | 4Always0 5look8 4on9 7the2 4bright8 9side7 3of8 5life5
2 | 5Nobody5 7expects3 5the4 6Spanish4 9inquisition0
3 |
--------------------------------------------------------------------------------
/easy/196-swap-numbers/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 196
2 | name: Swap Numbers
3 | category: Easy
4 | summary: Swap numbers surrounding a word.
5 | url: "https://www.codeeval.com/browse/196/"
6 |
--------------------------------------------------------------------------------
/easy/196-swap-numbers/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/196-swap-numbers/readme.pdf
--------------------------------------------------------------------------------
/easy/199-string-mask/input.txt:
--------------------------------------------------------------------------------
1 | hello 11001
2 | world 10000
3 | cba 111
4 |
--------------------------------------------------------------------------------
/easy/199-string-mask/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 199
2 | name: String Mask
3 | category: Easy
4 | summary: Change case letters by mask.
5 | url: "https://www.codeeval.com/browse/199/"
6 |
--------------------------------------------------------------------------------
/easy/199-string-mask/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/199-string-mask/readme.pdf
--------------------------------------------------------------------------------
/easy/202-stepwise-word/input.txt:
--------------------------------------------------------------------------------
1 | cat dog hello
2 | stop football play
3 | music is my life
4 |
--------------------------------------------------------------------------------
/easy/202-stepwise-word/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 202
2 | name: Stepwise Word
3 | category: Easy
4 | summary: Print the longest word in a stepwise manner.
5 | url: "https://www.codeeval.com/browse/202/"
6 |
--------------------------------------------------------------------------------
/easy/202-stepwise-word/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/202-stepwise-word/readme.pdf
--------------------------------------------------------------------------------
/easy/203-strings-and-arrows/input.txt:
--------------------------------------------------------------------------------
1 | <--<<--<<
2 | <<>>--><--<<--<<>>>--><
3 | <-->>
4 |
--------------------------------------------------------------------------------
/easy/203-strings-and-arrows/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 203
2 | name: Strings and Arrows
3 | category: Easy
4 | summary: Print the number of arrows in a string.
5 | url: "https://www.codeeval.com/browse/203/"
6 |
--------------------------------------------------------------------------------
/easy/203-strings-and-arrows/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/203-strings-and-arrows/readme.pdf
--------------------------------------------------------------------------------
/easy/205-clean-up-the-words/input.txt:
--------------------------------------------------------------------------------
1 | (--9Hello----World...--)
2 | Can 0$9 ---you~
3 | 13What213are;11you-123+138doing7
4 |
--------------------------------------------------------------------------------
/easy/205-clean-up-the-words/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 205
2 | name: Clean Up the Words
3 | category: Easy
4 | summary: Print the words separated by spaces.
5 | url: "https://www.codeeval.com/browse/205/"
6 |
--------------------------------------------------------------------------------
/easy/205-clean-up-the-words/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/205-clean-up-the-words/readme.pdf
--------------------------------------------------------------------------------
/easy/208-find-the-highest-score/assets/fig-1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/208-find-the-highest-score/assets/fig-1.png
--------------------------------------------------------------------------------
/easy/208-find-the-highest-score/input.txt:
--------------------------------------------------------------------------------
1 | 72 64 150 | 100 18 33 | 13 250 -6
2 | 10 25 -30 44 | 5 16 70 8 | 13 1 31 12
3 | 100 6 300 20 10 | 5 200 6 9 500 | 1 10 3 400 143
4 |
--------------------------------------------------------------------------------
/easy/208-find-the-highest-score/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 208
2 | name: Find the Highest Score
3 | category: Easy
4 | summary: Find the highest rate in the table.
5 | url: "https://www.codeeval.com/browse/208/"
6 |
--------------------------------------------------------------------------------
/easy/208-find-the-highest-score/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/208-find-the-highest-score/readme.pdf
--------------------------------------------------------------------------------
/easy/211-chardonnay-or-cabernet/input.txt:
--------------------------------------------------------------------------------
1 | Cabernet Merlot Noir | ot
2 | Chardonnay Sauvignon | ann
3 | Shiraz Grenache | o
4 |
--------------------------------------------------------------------------------
/easy/211-chardonnay-or-cabernet/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 211
2 | name: Chardonnay or Cabernet
3 | category: Easy
4 | summary: Guess a wine name.
5 | url: "https://www.codeeval.com/browse/211/"
6 |
--------------------------------------------------------------------------------
/easy/211-chardonnay-or-cabernet/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/211-chardonnay-or-cabernet/readme.pdf
--------------------------------------------------------------------------------
/easy/214-time-to-eat/input.txt:
--------------------------------------------------------------------------------
1 | 02:26:31 14:44:45 09:53:27
2 | 05:33:44 21:25:41
3 |
--------------------------------------------------------------------------------
/easy/214-time-to-eat/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 214
2 | name: Time to Eat
3 | category: Easy
4 | summary: Sort timestamps in the right order.
5 | url: "https://www.codeeval.com/browse/214/"
6 |
--------------------------------------------------------------------------------
/easy/214-time-to-eat/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/214-time-to-eat/readme.pdf
--------------------------------------------------------------------------------
/easy/217-one-zero-two-zeros/input.txt:
--------------------------------------------------------------------------------
1 | 1 8
2 | 2 4
3 |
--------------------------------------------------------------------------------
/easy/217-one-zero-two-zeros/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 217
2 | name: "One Zero, Two Zeros..."
3 | category: Easy
4 | summary: Count zeros in a binary system.
5 | url: "https://www.codeeval.com/browse/217/"
6 |
--------------------------------------------------------------------------------
/easy/217-one-zero-two-zeros/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/217-one-zero-two-zeros/readme.pdf
--------------------------------------------------------------------------------
/easy/220-trick-or-treat/input.txt:
--------------------------------------------------------------------------------
1 | Vampires: 1, Zombies: 1, Witches: 1, Houses: 1
2 | Vampires: 3, Zombies: 2, Witches: 1, Houses: 10
3 |
--------------------------------------------------------------------------------
/easy/220-trick-or-treat/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 220
2 | name: Trick or Treat
3 | category: Easy
4 | summary: Count all candies.
5 | url: "https://www.codeeval.com/browse/220/"
6 |
--------------------------------------------------------------------------------
/easy/220-trick-or-treat/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/220-trick-or-treat/readme.pdf
--------------------------------------------------------------------------------
/easy/222-black-card/input.txt:
--------------------------------------------------------------------------------
1 | John Sara Tom Susan | 3
2 | John Tom Mary | 5
3 |
--------------------------------------------------------------------------------
/easy/222-black-card/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 222
2 | name: Black Card
3 | category: Easy
4 | summary: Find the winner.
5 | url: "https://www.codeeval.com/browse/222/"
6 |
--------------------------------------------------------------------------------
/easy/222-black-card/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/222-black-card/readme.pdf
--------------------------------------------------------------------------------
/easy/225-testing/input.txt:
--------------------------------------------------------------------------------
1 | Heelo Codevval | Hello Codeeval
2 | hELLO cODEEVAL | Hello Codeeval
3 | Hello Codeeval | Hello Codeeval
4 |
--------------------------------------------------------------------------------
/easy/225-testing/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 225
2 | name: Testing
3 | category: Easy
4 | summary: Wanna try to be a tester?
5 | url: "https://www.codeeval.com/browse/225/"
6 |
--------------------------------------------------------------------------------
/easy/225-testing/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/225-testing/readme.pdf
--------------------------------------------------------------------------------
/easy/227-real-fake/assets/fig-1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/227-real-fake/assets/fig-1.png
--------------------------------------------------------------------------------
/easy/227-real-fake/input.txt:
--------------------------------------------------------------------------------
1 | 9999 9999 9999 9999
2 | 9999 9999 9999 9993
3 |
--------------------------------------------------------------------------------
/easy/227-real-fake/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 227
2 | name: Real Fake
3 | category: Easy
4 | summary: Check credit card numbers.
5 | url: "https://www.codeeval.com/browse/227/"
6 |
--------------------------------------------------------------------------------
/easy/227-real-fake/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/227-real-fake/readme.pdf
--------------------------------------------------------------------------------
/easy/230-football/input.txt:
--------------------------------------------------------------------------------
1 | 1 2 3 4 | 3 1 | 4 1
2 | 19 11 | 19 21 23 | 31 39 29
3 |
--------------------------------------------------------------------------------
/easy/230-football/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 230
2 | name: Football
3 | category: Easy
4 | summary: Find countries that are football fans.
5 | url: "https://www.codeeval.com/browse/230/"
6 |
--------------------------------------------------------------------------------
/easy/230-football/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/230-football/readme.pdf
--------------------------------------------------------------------------------
/easy/232-not-so-clever/input.txt:
--------------------------------------------------------------------------------
1 | 4 3 2 1 | 1
2 | 5 4 3 2 1 | 2
3 |
--------------------------------------------------------------------------------
/easy/232-not-so-clever/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 232
2 | name: Not So Clever
3 | category: Easy
4 | summary: Simplicity is not always good.
5 | url: "https://www.codeeval.com/browse/232/"
6 |
--------------------------------------------------------------------------------
/easy/232-not-so-clever/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/232-not-so-clever/readme.pdf
--------------------------------------------------------------------------------
/easy/235-simple-or-trump/input.txt:
--------------------------------------------------------------------------------
1 | AD 2H | H
2 | KD KH | C
3 | JH 10S | C
4 |
--------------------------------------------------------------------------------
/easy/235-simple-or-trump/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 235
2 | name: Simple or Trump
3 | category: Easy
4 | summary: Check which card is higher.
5 | url: "https://www.codeeval.com/browse/235/"
6 |
--------------------------------------------------------------------------------
/easy/235-simple-or-trump/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/235-simple-or-trump/readme.pdf
--------------------------------------------------------------------------------
/easy/237-panacea-truth-or-lie/input.txt:
--------------------------------------------------------------------------------
1 | 64 6e 78 | 100101100 11110
2 | 5e 7d 59 | 1101100 10010101 1100111
3 | 93 75 | 1000111 1011010 1100010
4 |
--------------------------------------------------------------------------------
/easy/237-panacea-truth-or-lie/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 237
2 | name: Panacea - Truth or Lie
3 | category: Easy
4 | summary: Check whether the virus was stopped by antivirus.
5 | url: "https://www.codeeval.com/browse/237/"
6 |
--------------------------------------------------------------------------------
/easy/237-panacea-truth-or-lie/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/237-panacea-truth-or-lie/readme.pdf
--------------------------------------------------------------------------------
/easy/240-mersenne-prime/input.txt:
--------------------------------------------------------------------------------
1 | 4
2 | 308
3 |
--------------------------------------------------------------------------------
/easy/240-mersenne-prime/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 240
2 | name: Mersenne Prime
3 | category: Easy
4 | summary: Find all Mersenne numbers smaller than n.
5 | url: "https://www.codeeval.com/browse/240/"
6 |
--------------------------------------------------------------------------------
/easy/240-mersenne-prime/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/easy/240-mersenne-prime/readme.pdf
--------------------------------------------------------------------------------
/hard/006-longest-common-subsequence/input.txt:
--------------------------------------------------------------------------------
1 | XMJYAUZ;MZJAWXU
2 |
--------------------------------------------------------------------------------
/hard/006-longest-common-subsequence/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 6
2 | name: Longest Common Subsequence
3 | category: Hard
4 | summary: LCS between two strings.
5 | url: "https://www.codeeval.com/browse/6/"
6 |
--------------------------------------------------------------------------------
/hard/006-longest-common-subsequence/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/006-longest-common-subsequence/readme.pdf
--------------------------------------------------------------------------------
/hard/007-prefix-expressions/input.txt:
--------------------------------------------------------------------------------
1 | * + 2 3 4
2 |
--------------------------------------------------------------------------------
/hard/007-prefix-expressions/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 7
2 | name: Prefix Expressions
3 | category: Hard
4 | summary: Evaluating a prefix expression.
5 | url: https://www.codeeval.com/browse/7/
6 |
--------------------------------------------------------------------------------
/hard/007-prefix-expressions/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/007-prefix-expressions/readme.pdf
--------------------------------------------------------------------------------
/hard/014-string-permutations/input.txt:
--------------------------------------------------------------------------------
1 | hat
2 | abc
3 | Zu6
4 |
--------------------------------------------------------------------------------
/hard/014-string-permutations/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 14
2 | name: String Permutations
3 | category: Hard
4 | summary: Print out all permutations of a string.
5 | url: "https://www.codeeval.com/browse/14/"
6 |
--------------------------------------------------------------------------------
/hard/014-string-permutations/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/014-string-permutations/readme.pdf
--------------------------------------------------------------------------------
/hard/028-string-searching/input.txt:
--------------------------------------------------------------------------------
1 | Hello,ell
2 | This is good, is
3 | CodeEval,C*Eval
4 | Old,Young
5 |
--------------------------------------------------------------------------------
/hard/028-string-searching/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 28
2 | name: String Searching
3 | category: Hard
4 | summary: Determine if substring match exists.
5 | url: "https://www.codeeval.com/browse/28/"
6 |
--------------------------------------------------------------------------------
/hard/028-string-searching/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/028-string-searching/readme.pdf
--------------------------------------------------------------------------------
/hard/036-message-decoding/input.txt:
--------------------------------------------------------------------------------
1 | $#**\0100000101101100011100101000
2 |
--------------------------------------------------------------------------------
/hard/036-message-decoding/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 36
2 | name: Message Decoding
3 | category: Hard
4 | summary: Decode an encoded message.
5 | url: "https://www.codeeval.com/browse/36/"
6 |
--------------------------------------------------------------------------------
/hard/036-message-decoding/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/036-message-decoding/readme.pdf
--------------------------------------------------------------------------------
/hard/038-string-list/input.txt:
--------------------------------------------------------------------------------
1 | 1,aa
2 | 2,ab
3 | 3,pop
4 |
--------------------------------------------------------------------------------
/hard/038-string-list/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 38
2 | name: String List
3 | category: Hard
4 | summary: Create a new string from constituent alphabets.
5 | url: "https://www.codeeval.com/browse/38/"
6 |
--------------------------------------------------------------------------------
/hard/038-string-list/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/038-string-list/readme.pdf
--------------------------------------------------------------------------------
/hard/042-ugly-numbers/input.txt:
--------------------------------------------------------------------------------
1 | 1
2 | 9
3 | 011
4 | 12345
5 |
--------------------------------------------------------------------------------
/hard/042-ugly-numbers/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 42
2 | name: Ugly Numbers
3 | category: Hard
4 | summary: Count the number of expressions that can be created from a number.
5 | url: "https://www.codeeval.com/browse/42/"
6 |
--------------------------------------------------------------------------------
/hard/042-ugly-numbers/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/042-ugly-numbers/readme.pdf
--------------------------------------------------------------------------------
/hard/044-following-integer/input.txt:
--------------------------------------------------------------------------------
1 | 115
2 | 842
3 | 8000
4 |
--------------------------------------------------------------------------------
/hard/044-following-integer/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 44
2 | name: Following Integer
3 | category: Hard
4 | summary: Determine the next number in a sequence.
5 | url: "https://www.codeeval.com/browse/44/"
6 |
--------------------------------------------------------------------------------
/hard/044-following-integer/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/044-following-integer/readme.pdf
--------------------------------------------------------------------------------
/hard/047-palindromic-ranges/input.txt:
--------------------------------------------------------------------------------
1 | 1 2
2 | 1 7
3 | 87 88
4 |
--------------------------------------------------------------------------------
/hard/047-palindromic-ranges/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 47
2 | name: Palindromic Ranges
3 | category: Hard
4 | summary: Find out a range of palindromic numbers.
5 | url: "https://www.codeeval.com/browse/47/"
6 |
--------------------------------------------------------------------------------
/hard/047-palindromic-ranges/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/047-palindromic-ranges/readme.pdf
--------------------------------------------------------------------------------
/hard/048-discount-offers/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 48
2 | name: Discount Offers
3 | category: Hard
4 | summary: Determine optimal pairing of customers with products.
5 | url: "https://www.codeeval.com/browse/48/"
6 |
--------------------------------------------------------------------------------
/hard/048-discount-offers/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/048-discount-offers/readme.pdf
--------------------------------------------------------------------------------
/hard/049-peak-traffic/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 49
2 | name: Peak Traffic
3 | category: Hard
4 | summary: Finding out which friends you interact with most.
5 | url: "https://www.codeeval.com/browse/49/"
6 |
--------------------------------------------------------------------------------
/hard/049-peak-traffic/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/049-peak-traffic/readme.pdf
--------------------------------------------------------------------------------
/hard/050-string-substitution/input.txt:
--------------------------------------------------------------------------------
1 | 10011011001;0110,1001,1001,0,10,11
2 |
--------------------------------------------------------------------------------
/hard/050-string-substitution/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 50
2 | name: String Substitution
3 | category: Hard
4 | summary: Create a new string by replacing substrings within it.
5 | url: "https://www.codeeval.com/browse/50/"
6 |
--------------------------------------------------------------------------------
/hard/050-string-substitution/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/050-string-substitution/readme.pdf
--------------------------------------------------------------------------------
/hard/051-closest-pair/input.txt:
--------------------------------------------------------------------------------
1 | 5
2 | 0 2
3 | 6 67
4 | 43 71
5 | 39 107
6 | 189 140
7 | 0
8 |
--------------------------------------------------------------------------------
/hard/051-closest-pair/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 51
2 | name: Closest Pair
3 | category: Hard
4 | summary: "Given a set of points in a two dimensional space, you will have to find the distance between the closest two points."
5 | url: "https://www.codeeval.com/browse/51/"
6 |
--------------------------------------------------------------------------------
/hard/051-closest-pair/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/051-closest-pair/readme.pdf
--------------------------------------------------------------------------------
/hard/052-text-dollar/input.txt:
--------------------------------------------------------------------------------
1 | 3
2 | 10
3 | 21
4 | 466
5 | 1234
6 |
--------------------------------------------------------------------------------
/hard/052-text-dollar/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 52
2 | name: Text Dollar
3 | category: Hard
4 | summary: Print out the text dollar amount of a given quantity.
5 | url: https://www.codeeval.com/browse/52/
6 |
--------------------------------------------------------------------------------
/hard/052-text-dollar/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/052-text-dollar/readme.pdf
--------------------------------------------------------------------------------
/hard/053-repeated-substring/input.txt:
--------------------------------------------------------------------------------
1 | banana
2 | am so uniqe
3 |
--------------------------------------------------------------------------------
/hard/053-repeated-substring/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 53
2 | name: Repeated Substring
3 | category: Hard
4 | summary: Find the longest repeated substring in a given text.
5 | url: "https://www.codeeval.com/browse/53/"
6 |
--------------------------------------------------------------------------------
/hard/053-repeated-substring/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/053-repeated-substring/readme.pdf
--------------------------------------------------------------------------------
/hard/055-type-ahead/input.txt:
--------------------------------------------------------------------------------
1 | 2,the
2 |
--------------------------------------------------------------------------------
/hard/055-type-ahead/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 55
2 | name: Type Ahead
3 | category: Hard
4 | summary: Building a type ahead feature.
5 | url: "https://www.codeeval.com/browse/55/"
6 |
--------------------------------------------------------------------------------
/hard/055-type-ahead/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/055-type-ahead/readme.pdf
--------------------------------------------------------------------------------
/hard/056-robot-movements/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 56
2 | name: Robot Movements
3 | category: Hard
4 | summary: Number of ways a robot can reach its destination.
5 | url: "https://www.codeeval.com/browse/56/"
6 |
--------------------------------------------------------------------------------
/hard/056-robot-movements/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/056-robot-movements/readme.pdf
--------------------------------------------------------------------------------
/hard/057-spiral-printing/input.txt:
--------------------------------------------------------------------------------
1 | 3;3;1 2 3 4 5 6 7 8 9
2 |
--------------------------------------------------------------------------------
/hard/057-spiral-printing/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 57
2 | name: Spiral Printing
3 | category: Hard
4 | summary: Print out a 2D array in spiral order.
5 | url: "https://www.codeeval.com/browse/57/"
6 |
--------------------------------------------------------------------------------
/hard/057-spiral-printing/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/057-spiral-printing/readme.pdf
--------------------------------------------------------------------------------
/hard/058-levenshtein-distance/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 58
2 | name: Levenshtein Distance
3 | category: Hard
4 | summary: Find out how big the social network of a word is.
5 | url: "https://www.codeeval.com/browse/58/"
6 |
--------------------------------------------------------------------------------
/hard/058-levenshtein-distance/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/058-levenshtein-distance/readme.pdf
--------------------------------------------------------------------------------
/hard/059-telephone-words/input.txt:
--------------------------------------------------------------------------------
1 | 4155230
2 |
--------------------------------------------------------------------------------
/hard/059-telephone-words/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 59
2 | name: Telephone Words
3 | category: Hard
4 | summary: Print out the words corresponding to a telephone number.
5 | url: "https://www.codeeval.com/browse/59/"
6 |
--------------------------------------------------------------------------------
/hard/059-telephone-words/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/059-telephone-words/readme.pdf
--------------------------------------------------------------------------------
/hard/060-grid-walk/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 60
2 | name: Grid Walk
3 | category: Hard
4 | summary: The number of grid points that can be accessed.
5 | url: "https://www.codeeval.com/browse/60/"
6 |
--------------------------------------------------------------------------------
/hard/060-grid-walk/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/060-grid-walk/readme.pdf
--------------------------------------------------------------------------------
/hard/061-decryption/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 61
2 | name: Decryption
3 | category: Hard
4 | summary: Determine the plain text message from an encrypted string.
5 | url: "https://www.codeeval.com/browse/61/"
6 |
--------------------------------------------------------------------------------
/hard/061-decryption/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/061-decryption/readme.pdf
--------------------------------------------------------------------------------
/hard/064-climbing-stairs/input.txt:
--------------------------------------------------------------------------------
1 | 10
2 | 20
3 |
--------------------------------------------------------------------------------
/hard/064-climbing-stairs/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 64
2 | name: Climbing Stairs
3 | category: Hard
4 | summary: Count the number of ways to climb to the top of a staircase.
5 | url: "https://www.codeeval.com/browse/64/"
6 |
--------------------------------------------------------------------------------
/hard/064-climbing-stairs/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/064-climbing-stairs/readme.pdf
--------------------------------------------------------------------------------
/hard/065-word-search/input.txt:
--------------------------------------------------------------------------------
1 | ASADB
2 | ABCCED
3 | ABCF
4 |
--------------------------------------------------------------------------------
/hard/065-word-search/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 65
2 | name: Word Search
3 | category: Hard
4 | summary: Find if a word exists in a grid.
5 | url: "https://www.codeeval.com/browse/65/"
6 |
--------------------------------------------------------------------------------
/hard/065-word-search/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/065-word-search/readme.pdf
--------------------------------------------------------------------------------
/hard/069-distinct-subsequences/input.txt:
--------------------------------------------------------------------------------
1 | babgbag,bag
2 | rabbbit,rabbit
3 |
--------------------------------------------------------------------------------
/hard/069-distinct-subsequences/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 69
2 | name: Distinct Subsequences
3 | category: Hard
4 | summary: Determine the number of distinct subsequnces within a string.
5 | url: "https://www.codeeval.com/browse/69/"
6 |
--------------------------------------------------------------------------------
/hard/069-distinct-subsequences/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/069-distinct-subsequences/readme.pdf
--------------------------------------------------------------------------------
/hard/072-minimum-path-sum/input.txt:
--------------------------------------------------------------------------------
1 | 2
2 | 4,6
3 | 2,8
4 | 3
5 | 1,2,3
6 | 4,5,6
7 | 7,8,9
8 |
--------------------------------------------------------------------------------
/hard/072-minimum-path-sum/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 72
2 | name: Minimum Path Sum
3 | category: Hard
4 | summary: Calculate the minimum sum of a path through a matrix.
5 | url: https://www.codeeval.com/browse/72/
6 |
--------------------------------------------------------------------------------
/hard/072-minimum-path-sum/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/072-minimum-path-sum/readme.pdf
--------------------------------------------------------------------------------
/hard/077-da-vyncy/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 77
2 | name: Da Vyncy
3 | category: Hard
4 | summary: Recreate a document from a set of fragments.
5 | url: "https://www.codeeval.com/browse/77/"
6 |
--------------------------------------------------------------------------------
/hard/077-da-vyncy/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/077-da-vyncy/readme.pdf
--------------------------------------------------------------------------------
/hard/079-minesweeper/input.txt:
--------------------------------------------------------------------------------
1 | 3,5;**.........*...
2 | 4,4;*........*......
3 |
--------------------------------------------------------------------------------
/hard/079-minesweeper/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 79
2 | name: Minesweeper
3 | category: Hard
4 | summary: "Find the mines within a M*N matrix."
5 | url: "https://www.codeeval.com/browse/79/"
6 |
--------------------------------------------------------------------------------
/hard/079-minesweeper/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/079-minesweeper/readme.pdf
--------------------------------------------------------------------------------
/hard/085-find-min/input.txt:
--------------------------------------------------------------------------------
1 | 78,51,3,5,5,51230
2 | 186,75,68,16,539,312
3 | 137,135,48,17,461,512
4 | 98,22,6,30,524,100
5 | 46,18,7,11,9,46
6 |
--------------------------------------------------------------------------------
/hard/085-find-min/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 85
2 | name: Find Min
3 | category: Hard
4 | summary: Facebook Hacker Cup 2013 problem.
5 | url: "https://www.codeeval.com/browse/85/"
6 |
--------------------------------------------------------------------------------
/hard/085-find-min/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/085-find-min/readme.pdf
--------------------------------------------------------------------------------
/hard/086-poker-hands/input.txt:
--------------------------------------------------------------------------------
1 | 6D 7H AH 7S QC 6H 2D TD JD AS
2 | JH 5D 7H TC JS JD JC TS 5S 7S
3 | 2H 8C AD TH 6H QD KD 9H 6S 6C
4 | JS JH 4H 2C 9H QH KC 9D 4D 3S
5 | TC 7H KH 4H JC 7D 9S 3H QS 7S
6 |
--------------------------------------------------------------------------------
/hard/086-poker-hands/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 86
2 | name: Poker Hands
3 | category: Hard
4 | summary: Compare two poker hands.
5 | url: "https://www.codeeval.com/browse/86/"
6 |
--------------------------------------------------------------------------------
/hard/086-poker-hands/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/086-poker-hands/readme.pdf
--------------------------------------------------------------------------------
/hard/088-juggle-fest/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 88
2 | name: Juggle Fest
3 | category: Hard
4 | summary: A challenge from Yodle.
5 | url: "https://www.codeeval.com/browse/88/"
6 |
--------------------------------------------------------------------------------
/hard/088-juggle-fest/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/088-juggle-fest/readme.pdf
--------------------------------------------------------------------------------
/hard/090-commuting-engineer/assets/fig-1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/090-commuting-engineer/assets/fig-1.png
--------------------------------------------------------------------------------
/hard/090-commuting-engineer/input.txt:
--------------------------------------------------------------------------------
1 | 1 | CodeEval 1355 Market St, SF (37.7768016, -122.4169151)
2 | 2 | Yelp 706 Mission St, SF (37.7860105, -122.4025377)
3 | 3 | Square 110 5th St, SF (37.7821494, -122.4058960)
4 | 4 | Airbnb 99 Rhode Island St, SF (37.7689269, -122.4029053)
5 | 5 | Dropbox 185 Berry St, SF (37.7768800, -122.3911496)
6 | 6 | Zynga 699 8th St, SF (37.7706628, -122.4040139)
7 |
--------------------------------------------------------------------------------
/hard/090-commuting-engineer/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 90
2 | name: Commuting Engineer
3 | category: Hard
4 | summary: Travelling Salesman Problem.
5 | url: "https://www.codeeval.com/browse/90/"
6 |
--------------------------------------------------------------------------------
/hard/090-commuting-engineer/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/090-commuting-engineer/readme.pdf
--------------------------------------------------------------------------------
/hard/095-advanced-calculator/input.txt:
--------------------------------------------------------------------------------
1 | 250*14.3
2 | 3^6 / 117
3 | (2.16 - 48.34)^-1
4 | (59 - 15 + 3*6)/21
5 | lg(10) + ln(e)
6 | 15*5 mod 2
7 |
--------------------------------------------------------------------------------
/hard/095-advanced-calculator/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 95
2 | name: Advanced Calculator
3 | category: Hard
4 | summary: Create an advanced calculator.
5 | url: "https://www.codeeval.com/browse/95/"
6 |
--------------------------------------------------------------------------------
/hard/095-advanced-calculator/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/095-advanced-calculator/readme.pdf
--------------------------------------------------------------------------------
/hard/105-largest-sub-matrix/input.txt:
--------------------------------------------------------------------------------
1 | -1 -4 -5 -4
2 | -5 8 -1 3
3 | -2 1 3 2
4 | 1 5 6 -9
5 |
--------------------------------------------------------------------------------
/hard/105-largest-sub-matrix/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 105
2 | name: Largest Sub-Matrix
3 | category: Hard
4 | summary: Determine the largest sub-matrix in a matrix.
5 | url: "https://www.codeeval.com/browse/105/"
6 |
--------------------------------------------------------------------------------
/hard/105-largest-sub-matrix/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/105-largest-sub-matrix/readme.pdf
--------------------------------------------------------------------------------
/hard/108-computer-terminal/input.txt:
--------------------------------------------------------------------------------
1 | ^h^c
2 | ^04^^
3 | ^13/ \^d^b / \
4 | ^u^d^d^l^l^l^l^l^l^l^l^l
5 | ^r^r^l^l^d^l^l^d/^b \
6 | ^d^r^r^66/^b \
7 | ^b^d \ /
8 | ^d^l^lv^d^b===========^i^94O123456
9 | 789^94A=======^u^u^u^u^u^u^l^l\^o^b^r/
10 |
--------------------------------------------------------------------------------
/hard/108-computer-terminal/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 108
2 | name: Computer Terminal
3 | category: Hard
4 | summary: Print text to terminal with control sequences.
5 | url: https://www.codeeval.com/browse/108/
6 |
--------------------------------------------------------------------------------
/hard/108-computer-terminal/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/108-computer-terminal/readme.pdf
--------------------------------------------------------------------------------
/hard/109-bay-bridges/assets/fig-1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/109-bay-bridges/assets/fig-1.png
--------------------------------------------------------------------------------
/hard/109-bay-bridges/input.txt:
--------------------------------------------------------------------------------
1 | 1: ([37.788353, -122.387695], [37.829853, -122.294312])
2 | 2: ([37.429615, -122.087631], [37.487391, -122.018967])
3 | 3: ([37.474858, -122.131577], [37.529332, -122.056046])
4 | 4: ([37.532599,-122.218094], [37.615863,-122.097244])
5 | 5: ([37.516262,-122.198181], [37.653383,-122.151489])
6 | 6: ([37.504824,-122.181702], [37.633266,-122.121964])
7 |
--------------------------------------------------------------------------------
/hard/109-bay-bridges/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 109
2 | name: Bay Bridges
3 | category: Hard
4 | summary: Build Bridges Over San Francisco Bay.
5 | url: "https://www.codeeval.com/browse/109/"
6 |
--------------------------------------------------------------------------------
/hard/109-bay-bridges/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/109-bay-bridges/readme.pdf
--------------------------------------------------------------------------------
/hard/110-text-to-number/input.txt:
--------------------------------------------------------------------------------
1 | fifteen
2 | negative six hundred thirty eight
3 | zero
4 | two million one hundred seven
5 |
--------------------------------------------------------------------------------
/hard/110-text-to-number/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 110
2 | name: Text to Number
3 | category: Hard
4 | summary: Convert English text representation of a number to a decimal number.
5 | url: https://www.codeeval.com/browse/110/
6 |
--------------------------------------------------------------------------------
/hard/110-text-to-number/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/110-text-to-number/readme.pdf
--------------------------------------------------------------------------------
/hard/114-package-problem/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 114
2 | name: Package Problem
3 | category: Hard
4 | summary: Put as many things into a package as possible.
5 | url: "https://www.codeeval.com/browse/114/"
6 |
--------------------------------------------------------------------------------
/hard/114-package-problem/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/114-package-problem/readme.pdf
--------------------------------------------------------------------------------
/hard/118-seat-your-team-members/input.txt:
--------------------------------------------------------------------------------
1 | 4; 1:[1, 3, 2], 2:[1], 3:[4, 3], 4:[4, 3]
2 | 3; 1:[1, 3, 2], 2:[1], 3:[1]
3 |
--------------------------------------------------------------------------------
/hard/118-seat-your-team-members/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 118
2 | name: Seat Your Team Members
3 | category: Hard
4 | summary: Place the employees in a new office.
5 | url: "https://www.codeeval.com/browse/118/"
6 |
--------------------------------------------------------------------------------
/hard/118-seat-your-team-members/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/118-seat-your-team-members/readme.pdf
--------------------------------------------------------------------------------
/hard/120-skyscrapers/assets/fig-1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/120-skyscrapers/assets/fig-1.png
--------------------------------------------------------------------------------
/hard/120-skyscrapers/assets/fig-2.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/120-skyscrapers/assets/fig-2.png
--------------------------------------------------------------------------------
/hard/120-skyscrapers/input.txt:
--------------------------------------------------------------------------------
1 | (1,2,3);(2,4,6);(4,5,5);(7,3,11);(9,2,14);(13,7,15);(14,3,17)
2 | (2,22,3);(6,12,10);(15,6,21)
3 | (1,2,6);(9,23,22);(22,6,24);(8,14,19);(23,12,30)
4 |
--------------------------------------------------------------------------------
/hard/120-skyscrapers/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 120
2 | name: Skyscrapers
3 | category: Hard
4 | summary: Outline skyscrapers in a city.
5 | url: "https://www.codeeval.com/browse/120/"
6 |
--------------------------------------------------------------------------------
/hard/120-skyscrapers/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/120-skyscrapers/readme.pdf
--------------------------------------------------------------------------------
/hard/123-efficient-delivery/input.txt:
--------------------------------------------------------------------------------
1 | (2,5), 12
2 | (6,9,20), 44
3 | (197,8170), 155862
4 | (2,4,8), 8
5 |
--------------------------------------------------------------------------------
/hard/123-efficient-delivery/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 123
2 | name: Efficient Delivery
3 | category: Hard
4 | summary: Load your tankers with oil.
5 | url: "https://www.codeeval.com/browse/123/"
6 |
--------------------------------------------------------------------------------
/hard/123-efficient-delivery/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/123-efficient-delivery/readme.pdf
--------------------------------------------------------------------------------
/hard/126-play-with-dna/input.txt:
--------------------------------------------------------------------------------
1 | CCC 1 CGCCCGAATCCAG
2 | GCGAG 2 CCACGGCCTATGTATTTGCAAGGATCTGGGCCAGCTAAATCAGCACCCCTGGAACGGCAAGGTTCATTTTGTTGCGCGCATAG
3 | CGGCGCC 1 ACCCCCGCAGCCATATGTCCCCAGCTATTTAATGAGGGCCCCGAACACGGGGAGTCTTACACGATCTGCCCTGGAATCGC
4 |
--------------------------------------------------------------------------------
/hard/126-play-with-dna/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 126
2 | name: Play With DNA
3 | category: Hard
4 | summary: Write an algorithm that a finds DNA segment in a given DNA string.
5 | url: "https://www.codeeval.com/browse/126/"
6 |
--------------------------------------------------------------------------------
/hard/126-play-with-dna/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/126-play-with-dna/readme.pdf
--------------------------------------------------------------------------------
/hard/127-code-plagiarism/dataset/7_2:
--------------------------------------------------------------------------------
1 | <<< Go Two approaches to the one problem
2 |
3 | package main
4 |
5 | import "os"
6 |
7 | func main() {
8 | os.Stdout.WriteString("Hello, World!")
9 | }
10 |
11 | =====
12 |
13 | package main
14 |
15 | import "fmt"
16 |
17 | func main() {
18 | fmt.Println("Hello, World!")
19 | }
20 |
21 |
--------------------------------------------------------------------------------
/hard/127-code-plagiarism/dataset/9_1:
--------------------------------------------------------------------------------
1 | <<< Python "Hello World"
2 |
3 | import sys
4 | sys.stdout.write("Hello World")
5 |
6 | =====
7 |
8 | if __name__ == "__main__":
9 | greetings = "Hello, World!"
10 | print greetings
--------------------------------------------------------------------------------
/hard/127-code-plagiarism/dataset/9_2:
--------------------------------------------------------------------------------
1 | <<< Go "Hello World"
2 |
3 | package main
4 |
5 | import "os"
6 |
7 | func main() {
8 | os.Stdout.WriteString("Hello, World!")
9 | }
10 |
11 | =====
12 |
13 | package main
14 |
15 | import "fmt"
16 |
17 | func main() {
18 | var s string
19 | s += "Hello, World!"
20 | fmt.Println(s)
21 | }
--------------------------------------------------------------------------------
/hard/127-code-plagiarism/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 127
2 | name: Code Plagiarism
3 | category: Hard
4 | summary: Compare source code of two programs.
5 | url: "https://www.codeeval.com/browse/127/"
6 |
--------------------------------------------------------------------------------
/hard/127-code-plagiarism/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/127-code-plagiarism/readme.pdf
--------------------------------------------------------------------------------
/hard/129-routing-problem/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 129
2 | name: Routing Problem
3 | category: Hard
4 | summary: Find all the shortest paths for the package between two specified hosts.
5 | url: "https://www.codeeval.com/browse/129/"
6 |
--------------------------------------------------------------------------------
/hard/129-routing-problem/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/129-routing-problem/readme.pdf
--------------------------------------------------------------------------------
/hard/134-a-bus-network/input.txt:
--------------------------------------------------------------------------------
1 | (2,4); R1=[1,2,3,11,12,4]; R2=[5,6,4]; R3=[1,6,7]; R4=[5,6,4]; R5=[8,6,3]
2 | (1,7); R1=[1,2,3,4]; R2=[5,6,4]; R3=[9,6,7]; R4=[12,1,2,3,11,16,15,14,10,13,7]
3 | (3,299); R1=[1,2,3,4]; R2=[6,7,19,12,4]; R3=[11,14,16,6]; R4=[24,299,42,6]
4 | (3,4); R1=[1,2,3]; R2=[6,7,19,12,4]; R3=[11,14,16,6]
5 |
--------------------------------------------------------------------------------
/hard/134-a-bus-network/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 134
2 | name: A Bus Network
3 | category: Hard
4 | summary: Try to save more time.
5 | url: "https://www.codeeval.com/browse/134/"
6 |
--------------------------------------------------------------------------------
/hard/134-a-bus-network/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/134-a-bus-network/readme.pdf
--------------------------------------------------------------------------------
/hard/141-flight-370/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 141
2 | name: Flight 370
3 | category: Hard
4 | summary: Follow the current search results.
5 | url: "https://www.codeeval.com/browse/141/"
6 |
--------------------------------------------------------------------------------
/hard/141-flight-370/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/141-flight-370/readme.pdf
--------------------------------------------------------------------------------
/hard/142-visit-to-the-headquarters/input.txt:
--------------------------------------------------------------------------------
1 | A 09:00:00 0203 5 0210 10 0305 5 0604 10 0605 10 0901 10 0908 10
2 | B 09:00:25 0205 10 0404 5 0501 5 0602 5 0703 5 0807 5
3 | C 09:00:45 0109 10 0110 5 0207 5 0208 10 0401 10 0510 5
4 | D 09:01:15 0310 5 0404 5 0503 10 0603 5 0604 5 0704 10 0708 5 0910 5 1005 10
5 |
--------------------------------------------------------------------------------
/hard/142-visit-to-the-headquarters/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 142
2 | name: Visit to the Headquarters
3 | category: Hard
4 | summary: Organize the queues.
5 | url: "https://www.codeeval.com/browse/142/"
6 |
--------------------------------------------------------------------------------
/hard/142-visit-to-the-headquarters/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/142-visit-to-the-headquarters/readme.pdf
--------------------------------------------------------------------------------
/hard/144-digit-statistics/input.txt:
--------------------------------------------------------------------------------
1 | 2 5
2 |
--------------------------------------------------------------------------------
/hard/144-digit-statistics/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 144
2 | name: Digit Statistics
3 | category: Hard
4 | summary: Find statistics in sequence.
5 | url: https://www.codeeval.com/browse/144/
6 |
--------------------------------------------------------------------------------
/hard/144-digit-statistics/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/144-digit-statistics/readme.pdf
--------------------------------------------------------------------------------
/hard/145-running-for-president/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 145
2 | name: Running for President
3 | category: Hard
4 | summary: Build your strategy to win the Presidency of the United States.
5 | url: "https://www.codeeval.com/browse/145/"
6 |
--------------------------------------------------------------------------------
/hard/145-running-for-president/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/145-running-for-president/readme.pdf
--------------------------------------------------------------------------------
/hard/151-cracking-eggs/input.txt:
--------------------------------------------------------------------------------
1 | 2 100
2 |
--------------------------------------------------------------------------------
/hard/151-cracking-eggs/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 151
2 | name: Cracking Eggs
3 | category: Hard
4 | summary: Determine the number of drops.
5 | url: "https://www.codeeval.com/browse/151/"
6 |
--------------------------------------------------------------------------------
/hard/151-cracking-eggs/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/151-cracking-eggs/readme.pdf
--------------------------------------------------------------------------------
/hard/154-ip-package/assets/fig-1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/154-ip-package/assets/fig-1.png
--------------------------------------------------------------------------------
/hard/154-ip-package/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 154
2 | name: IP Package
3 | category: Hard
4 | summary: Calculate IP checksum.
5 | url: "https://www.codeeval.com/browse/154/"
6 |
--------------------------------------------------------------------------------
/hard/154-ip-package/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/154-ip-package/readme.pdf
--------------------------------------------------------------------------------
/hard/155-ascii-decryption/input.txt:
--------------------------------------------------------------------------------
1 | 5 | s | 92 112 109 40 118 109 109 108 123 40 119 110 40 124 112 109 40 117 105 118 129 40 119 125 124 127 109 113 111 112 40 124 112 109 40 118 109 109 108 123 40 119 110 40 124 112 109 40 110 109 127 54 40 53 40 91 120 119 107 115
2 |
--------------------------------------------------------------------------------
/hard/155-ascii-decryption/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 155
2 | name: ASCII Decryption
3 | category: Hard
4 | summary: Decrypt a message.
5 | url: https://www.codeeval.com/browse/155/
6 |
--------------------------------------------------------------------------------
/hard/155-ascii-decryption/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/155-ascii-decryption/readme.pdf
--------------------------------------------------------------------------------
/hard/157-the-labyrinth/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 157
2 | name: The Labyrinth
3 | category: Hard
4 | summary: Find the shortest way to exit.
5 | url: "https://www.codeeval.com/browse/157/"
6 |
--------------------------------------------------------------------------------
/hard/157-the-labyrinth/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/157-the-labyrinth/readme.pdf
--------------------------------------------------------------------------------
/hard/159-where-is-wi-fi/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 159
2 | name: Where Is Wi-Fi
3 | category: Hard
4 | summary: Find out in which buildings there are hotspots.
5 | url: "https://www.codeeval.com/browse/159/"
6 |
--------------------------------------------------------------------------------
/hard/159-where-is-wi-fi/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/159-where-is-wi-fi/readme.pdf
--------------------------------------------------------------------------------
/hard/162-too-unique/input.txt:
--------------------------------------------------------------------------------
1 | rzqicaiiaege
2 | ccwnulljybtu
3 | jxtxupauwuah
4 | oqikzgqrzpdq
5 | vblalwdjbdwn
6 | ahjeencuclbo
7 |
--------------------------------------------------------------------------------
/hard/162-too-unique/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 162
2 | name: Too Unique
3 | category: Hard
4 | summary: Find and mark the biggest submatrices of unique elements.
5 | url: "https://www.codeeval.com/browse/162/"
6 |
--------------------------------------------------------------------------------
/hard/162-too-unique/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/162-too-unique/readme.pdf
--------------------------------------------------------------------------------
/hard/164-mars-networks/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 164
2 | name: Mars Networks
3 | category: Hard
4 | summary: Find the minimum length of the optical fiber cable which connects probes to a network.
5 | url: "https://www.codeeval.com/browse/164/"
6 |
--------------------------------------------------------------------------------
/hard/164-mars-networks/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/164-mars-networks/readme.pdf
--------------------------------------------------------------------------------
/hard/168-the-frequency/assets/fig-1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/168-the-frequency/assets/fig-1.png
--------------------------------------------------------------------------------
/hard/168-the-frequency/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 168
2 | name: The Frequency
3 | category: Hard
4 | summary: Find the signals frequency.
5 | url: "https://www.codeeval.com/browse/168/"
6 |
--------------------------------------------------------------------------------
/hard/168-the-frequency/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/168-the-frequency/readme.pdf
--------------------------------------------------------------------------------
/hard/171-dna-alignment/input.txt:
--------------------------------------------------------------------------------
1 | GAAAAAAT | GAAT
2 | GCATGCT | GATTACA
3 |
--------------------------------------------------------------------------------
/hard/171-dna-alignment/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 171
2 | name: DNA Alignment
3 | category: Hard
4 | summary: Find the highest score of DNA sequences alignment.
5 | url: "https://www.codeeval.com/browse/171/"
6 |
--------------------------------------------------------------------------------
/hard/171-dna-alignment/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/171-dna-alignment/readme.pdf
--------------------------------------------------------------------------------
/hard/175-the-cubes/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 175
2 | name: The Cubes
3 | category: Hard
4 | summary: Find the length of the shortest way in the multilevel labyrinth.
5 | url: "https://www.codeeval.com/browse/175/"
6 |
--------------------------------------------------------------------------------
/hard/175-the-cubes/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/175-the-cubes/readme.pdf
--------------------------------------------------------------------------------
/hard/176-ray-of-light/input.txt:
--------------------------------------------------------------------------------
1 | ########### ## o o ## o o ## o *o ## o o ## * * *o ## ## ####/######
2 | ########### ## * ## * ## * ## * ## ** ## ** ## ####/######
3 | ########### ## * o ## o #/ o ## o * ## ## ## ###########
4 |
--------------------------------------------------------------------------------
/hard/176-ray-of-light/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 176
2 | name: Ray of Light
3 | category: Hard
4 | summary: Trace the path of light distribution.
5 | url: "https://www.codeeval.com/browse/176/"
6 |
--------------------------------------------------------------------------------
/hard/176-ray-of-light/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/176-ray-of-light/readme.pdf
--------------------------------------------------------------------------------
/hard/182-longest-path/assets/fig-1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/182-longest-path/assets/fig-1.png
--------------------------------------------------------------------------------
/hard/182-longest-path/input.txt:
--------------------------------------------------------------------------------
1 | qttiwkajeerhdgpikkeaaabwl
2 | vavprkykiloeizzt
3 | skwajgaaxqpfcxmadpwaraksnkbgcaukbgli
4 | kaja
5 | bjzanjikh
6 |
--------------------------------------------------------------------------------
/hard/182-longest-path/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 182
2 | name: Longest Path
3 | category: Hard
4 | summary: Find the longest path of unique elements.
5 | url: "https://www.codeeval.com/browse/182/"
6 |
--------------------------------------------------------------------------------
/hard/182-longest-path/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/182-longest-path/readme.pdf
--------------------------------------------------------------------------------
/hard/185-glue-shredded-pieces/input.txt:
--------------------------------------------------------------------------------
1 | |deEva|lan t|to ha|evil |ankin|il-ev|o hac| to h|vil p|an to|The e|CodeE| evil|plan |hack |Eval |ack C|l ran|king.|l-evi|evil-|-evil|l pla|il pl| hack|al ra|vil-e|odeEv|he ev|n to |ck Co|eEval|nking| rank| Code|e evi|ranki|k Cod| plan|val r|
2 |
--------------------------------------------------------------------------------
/hard/185-glue-shredded-pieces/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 185
2 | name: Glue Shredded Pieces
3 | category: Hard
4 | summary: Reconstruct the original text from overlapping pieces.
5 | url: "https://www.codeeval.com/browse/185/"
6 |
--------------------------------------------------------------------------------
/hard/185-glue-shredded-pieces/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/185-glue-shredded-pieces/readme.pdf
--------------------------------------------------------------------------------
/hard/188-distinct-triangles/assets/fig-1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/188-distinct-triangles/assets/fig-1.png
--------------------------------------------------------------------------------
/hard/188-distinct-triangles/input.txt:
--------------------------------------------------------------------------------
1 | 4 5;0 2,0 1,1 2,1 3,2 3
2 | 9 3;1 3,1 8,3 8
3 | 9 3;5 6,5 7,6 7
4 |
--------------------------------------------------------------------------------
/hard/188-distinct-triangles/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 188
2 | name: Distinct Triangles
3 | category: Hard
4 | summary: Find the number of distinct triangles formed in a graph.
5 | url: "https://www.codeeval.com/browse/188/"
6 |
--------------------------------------------------------------------------------
/hard/188-distinct-triangles/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/188-distinct-triangles/readme.pdf
--------------------------------------------------------------------------------
/hard/191-lights-out/assets/fig-1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/191-lights-out/assets/fig-1.png
--------------------------------------------------------------------------------
/hard/191-lights-out/input.txt:
--------------------------------------------------------------------------------
1 | 4 10 ...OOOOOOO|.OO.O.O...|.OO..OO.OO|...O....O.
2 | 3 3 ..O|OOO|OOO
3 | 5 7 .O.O...|..O.O..|.O.O..O|.O..OOO|OO.OOOO
4 |
--------------------------------------------------------------------------------
/hard/191-lights-out/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 191
2 | name: Lights Out
3 | category: Hard
4 | summary: Switch all the lights off with minimum number of moves.
5 | url: "https://www.codeeval.com/browse/191/"
6 |
--------------------------------------------------------------------------------
/hard/191-lights-out/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/191-lights-out/readme.pdf
--------------------------------------------------------------------------------
/hard/195-crime-house/input.txt:
--------------------------------------------------------------------------------
1 | 3; E 5|L 0|E 5
2 | 2; L 1|L 1
3 | 4; L 1|E 0|E 0|L 1
4 | 7; L 2|E 0|E 1|E 2|E 0|E 3|L 4
5 | 13; L 4|L 1|L 2|E 0|L 1|E 0|L 2|E 0|L 2|E 0|E 0|L 1|L 4
6 |
--------------------------------------------------------------------------------
/hard/195-crime-house/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 195
2 | name: Crime House
3 | category: Hard
4 | summary: Count criminals in the Crime House.
5 | url: "https://www.codeeval.com/browse/195/"
6 |
--------------------------------------------------------------------------------
/hard/195-crime-house/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/195-crime-house/readme.pdf
--------------------------------------------------------------------------------
/hard/198-less-money-more-problems/input.txt:
--------------------------------------------------------------------------------
1 | 1 | 3 | 1 2
2 | 1 | 6 | 1 2 5
3 | 2 | 3 | 3
4 | 1 | 100 | 1 5 10 25 50 100
5 |
--------------------------------------------------------------------------------
/hard/198-less-money-more-problems/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 198
2 | name: "Less Money, More Problems"
3 | category: Hard
4 | summary: Help citizens by adding new coin denominations.
5 | url: "https://www.codeeval.com/browse/198/"
6 |
--------------------------------------------------------------------------------
/hard/198-less-money-more-problems/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/198-less-money-more-problems/readme.pdf
--------------------------------------------------------------------------------
/hard/201-alphabet-blocks/input.txt:
--------------------------------------------------------------------------------
1 | 4 | DOG | UPZRHR INOYLC KXDHNQ BAGMZI
2 | 6 | HAPPY | PKMFQP KTXGCV OSDMAJ SDSIMY OEPGLE JZCDHI
3 | 5 | PLAIN | BFUBZD XMQBNM IDXVCN JCOIAM OZYAYH
4 |
--------------------------------------------------------------------------------
/hard/201-alphabet-blocks/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 201
2 | name: Alphabet Blocks
3 | category: Hard
4 | summary: Forming words from alphabet blocks.
5 | url: "https://www.codeeval.com/browse/201/"
6 |
--------------------------------------------------------------------------------
/hard/201-alphabet-blocks/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/201-alphabet-blocks/readme.pdf
--------------------------------------------------------------------------------
/hard/204-straight-lines/assets/fig-1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/204-straight-lines/assets/fig-1.png
--------------------------------------------------------------------------------
/hard/204-straight-lines/input.txt:
--------------------------------------------------------------------------------
1 | 1 1 | 1 2 | 1 4 | 3 2
2 | 1 1 | 1 2 | 1 4 | 3 2 | 4 2
3 | 1 2 | 1 4 | 2 3 | 3 2 | 3 4
4 |
--------------------------------------------------------------------------------
/hard/204-straight-lines/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 204
2 | name: Straight Lines
3 | category: Hard
4 | summary: Print the number of straight lines.
5 | url: "https://www.codeeval.com/browse/204/"
6 |
--------------------------------------------------------------------------------
/hard/204-straight-lines/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/204-straight-lines/readme.pdf
--------------------------------------------------------------------------------
/hard/207-which-way-is-faster/assets/fig-1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/207-which-way-is-faster/assets/fig-1.png
--------------------------------------------------------------------------------
/hard/207-which-way-is-faster/input.txt:
--------------------------------------------------------------------------------
1 | **^F | P**P | **** | S***
2 | **^F | P*^P | **** | S***
3 |
--------------------------------------------------------------------------------
/hard/207-which-way-is-faster/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 207
2 | name: Which Way Is Faster?
3 | category: Hard
4 | summary: Find the fastest way.
5 | url: "https://www.codeeval.com/browse/207/"
6 |
--------------------------------------------------------------------------------
/hard/207-which-way-is-faster/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/207-which-way-is-faster/readme.pdf
--------------------------------------------------------------------------------
/hard/210-brainfck/input.txt:
--------------------------------------------------------------------------------
1 | +[--->++<]>+++.[->+++++++<]>.[--->+<]>----.
2 | ++++++++++[>+++++++>++++++++++>+++>+<<<<-]>++.>+.+++++++..+++.>++.<<+++++++++++++++.>.+++.------.--------.>+.
3 |
--------------------------------------------------------------------------------
/hard/210-brainfck/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 210
2 | name: "Brainf*ck"
3 | category: Hard
4 | summary: Blow your mind.
5 | url: "https://www.codeeval.com/browse/210/"
6 |
--------------------------------------------------------------------------------
/hard/210-brainfck/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/210-brainfck/readme.pdf
--------------------------------------------------------------------------------
/hard/213-lakes-not-cakes/input.txt:
--------------------------------------------------------------------------------
1 | o # o | # # # | o # o
2 | o # o | # o # | o # o
3 |
--------------------------------------------------------------------------------
/hard/213-lakes-not-cakes/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 213
2 | name: "Lakes, Not Cakes"
3 | category: Hard
4 | summary: Count all lakes.
5 | url: "https://www.codeeval.com/browse/213/"
6 |
--------------------------------------------------------------------------------
/hard/213-lakes-not-cakes/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/213-lakes-not-cakes/readme.pdf
--------------------------------------------------------------------------------
/hard/216-everything-or-nothing/input.txt:
--------------------------------------------------------------------------------
1 | user_1=>file_1=>read user_2=>file_2=>write
2 | user_1=>file_1=>grant=>read=>user_4 user_4=>file_1=>read
3 | user_4=>file_1=>read
4 |
--------------------------------------------------------------------------------
/hard/216-everything-or-nothing/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 216
2 | name: Everything or Nothing
3 | category: Hard
4 | summary: Check if a code is correct.
5 | url: "https://www.codeeval.com/browse/216/"
6 |
--------------------------------------------------------------------------------
/hard/216-everything-or-nothing/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/216-everything-or-nothing/readme.pdf
--------------------------------------------------------------------------------
/hard/219-the-tourist/assets/fig-1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/219-the-tourist/assets/fig-1.png
--------------------------------------------------------------------------------
/hard/219-the-tourist/input.txt:
--------------------------------------------------------------------------------
1 | 1 2 1 | 2 3 2 | 3 1 3
2 | 1 2 2 | 2 3 2 | 3 4 2 | 4 1 2 | 2 4 3
3 |
--------------------------------------------------------------------------------
/hard/219-the-tourist/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 219
2 | name: The Tourist
3 | category: Hard
4 | summary: Find the shortest route between cities.
5 | url: "https://www.codeeval.com/browse/219/"
6 |
--------------------------------------------------------------------------------
/hard/219-the-tourist/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/219-the-tourist/readme.pdf
--------------------------------------------------------------------------------
/hard/224-prisoner-or-citizen/assets/fig-1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/224-prisoner-or-citizen/assets/fig-1.png
--------------------------------------------------------------------------------
/hard/224-prisoner-or-citizen/input.txt:
--------------------------------------------------------------------------------
1 | 1 1, 1 4, 3 4, 3 2 | 2 3
2 | 1 1, 3 2, 1 4, 3 4 | 3 3
3 | 1 1, 1 3, 3 3, 3 1 | 1 2
4 |
--------------------------------------------------------------------------------
/hard/224-prisoner-or-citizen/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 224
2 | name: Prisoner or Citizen
3 | category: Hard
4 | summary: In jail or at large?
5 | url: "https://www.codeeval.com/browse/224/"
6 |
--------------------------------------------------------------------------------
/hard/224-prisoner-or-citizen/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/224-prisoner-or-citizen/readme.pdf
--------------------------------------------------------------------------------
/hard/229-grinch/input.txt:
--------------------------------------------------------------------------------
1 | 1 2 2, 1 3 3, 3 4 3, 2 4 6, 4 5 16, 3 5 7 | 1 5
2 | 1 2 3, 2 8 10, 1 9 4, 8 9 2 | 2 8
3 |
--------------------------------------------------------------------------------
/hard/229-grinch/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 229
2 | name: Grinch
3 | category: Hard
4 | summary: Help Grinch to find the shortest way.
5 | url: "https://www.codeeval.com/browse/229/"
6 |
--------------------------------------------------------------------------------
/hard/229-grinch/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/229-grinch/readme.pdf
--------------------------------------------------------------------------------
/hard/234-code-like-huffman/input.txt:
--------------------------------------------------------------------------------
1 | abc
2 | ilovecodeeval
3 |
--------------------------------------------------------------------------------
/hard/234-code-like-huffman/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 234
2 | name: Code Like Huffman
3 | category: Hard
4 | summary: "Learn more about Huffman's tree."
5 | url: "https://www.codeeval.com/browse/234/"
6 |
--------------------------------------------------------------------------------
/hard/234-code-like-huffman/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/234-code-like-huffman/readme.pdf
--------------------------------------------------------------------------------
/hard/239-as-quick-as-a-flash/input.txt:
--------------------------------------------------------------------------------
1 | 5 2 6 1 3 4
2 | 1 2 3 4
3 | 4 3 2 1
4 | 3 1 2 4
5 | 1 3 2 4
6 |
--------------------------------------------------------------------------------
/hard/239-as-quick-as-a-flash/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 239
2 | name: As Quick as a Flash
3 | category: Hard
4 | summary: Learn more about the quick sort algorithm.
5 | url: "https://www.codeeval.com/browse/239/"
6 |
--------------------------------------------------------------------------------
/hard/239-as-quick-as-a-flash/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/hard/239-as-quick-as-a-flash/readme.pdf
--------------------------------------------------------------------------------
/moderate/002-longest-lines/input.txt:
--------------------------------------------------------------------------------
1 | 2
2 | Hello World
3 | CodeEval
4 | Quick Fox
5 | A
6 | San Francisco
7 |
--------------------------------------------------------------------------------
/moderate/002-longest-lines/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 2
2 | name: Longest Lines
3 | category: Moderate
4 | summary: "Finding the 'N' longest lines within a file."
5 | url: "https://www.codeeval.com/browse/2/"
6 |
--------------------------------------------------------------------------------
/moderate/002-longest-lines/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/002-longest-lines/readme.pdf
--------------------------------------------------------------------------------
/moderate/005-detecting-cycles/input.txt:
--------------------------------------------------------------------------------
1 | 2 0 6 3 1 6 3 1 6 3 1
2 | 3 4 8 0 11 9 7 2 5 6 10 1 49 49 49 49
3 | 1 2 3 1 2 3 1 2 3
4 |
--------------------------------------------------------------------------------
/moderate/005-detecting-cycles/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 5
2 | name: Detecting Cycles
3 | category: Moderate
4 | summary: Detecting loops within a sequence.
5 | url: "https://www.codeeval.com/browse/5/"
6 |
--------------------------------------------------------------------------------
/moderate/005-detecting-cycles/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/005-detecting-cycles/readme.pdf
--------------------------------------------------------------------------------
/moderate/009-stack-implementation/input.txt:
--------------------------------------------------------------------------------
1 | 1 2 3 4
2 | 10 -2 3 4
3 |
--------------------------------------------------------------------------------
/moderate/009-stack-implementation/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 9
2 | name: Stack Implementation
3 | category: Moderate
4 | summary: Implement a stack interface.
5 | url: https://www.codeeval.com/browse/9/
6 |
--------------------------------------------------------------------------------
/moderate/009-stack-implementation/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/009-stack-implementation/readme.pdf
--------------------------------------------------------------------------------
/moderate/010-mth-to-last-element/input.txt:
--------------------------------------------------------------------------------
1 | a b c d 4
2 | e f g h 2
3 |
--------------------------------------------------------------------------------
/moderate/010-mth-to-last-element/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 10
2 | name: Mth to Last Element
3 | category: Moderate
4 | summary: Determine the Mth to last element of a list.
5 | url: "https://www.codeeval.com/browse/10/"
6 |
--------------------------------------------------------------------------------
/moderate/010-mth-to-last-element/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/010-mth-to-last-element/readme.pdf
--------------------------------------------------------------------------------
/moderate/011-lowest-common-ancestor/input.txt:
--------------------------------------------------------------------------------
1 | 8 52
2 | 3 29
3 |
--------------------------------------------------------------------------------
/moderate/011-lowest-common-ancestor/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 11
2 | name: Lowest Common Ancestor
3 | category: Moderate
4 | summary: Determine the lowest common ancestor within a tree.
5 | url: "https://www.codeeval.com/browse/11/"
6 |
--------------------------------------------------------------------------------
/moderate/011-lowest-common-ancestor/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/011-lowest-common-ancestor/readme.pdf
--------------------------------------------------------------------------------
/moderate/012-first-non-repeated-character/input.txt:
--------------------------------------------------------------------------------
1 | yellow
2 | tooth
3 |
--------------------------------------------------------------------------------
/moderate/012-first-non-repeated-character/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 12
2 | name: First Non-Repeated Character
3 | category: Moderate
4 | summary: Find the first non repeated character in a string.
5 | url: "https://www.codeeval.com/browse/12/"
6 |
--------------------------------------------------------------------------------
/moderate/012-first-non-repeated-character/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/012-first-non-repeated-character/readme.pdf
--------------------------------------------------------------------------------
/moderate/013-remove-characters/input.txt:
--------------------------------------------------------------------------------
1 | how are you, abc
2 | hello world, def
3 |
--------------------------------------------------------------------------------
/moderate/013-remove-characters/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 13
2 | name: Remove Characters
3 | category: Moderate
4 | summary: Delete specific characters from a string.
5 | url: https://www.codeeval.com/browse/13/
6 |
--------------------------------------------------------------------------------
/moderate/013-remove-characters/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/013-remove-characters/readme.pdf
--------------------------------------------------------------------------------
/moderate/015-endianness/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 15
2 | name: Endianness
3 | category: Moderate
4 | summary: Determine the endianness of a system.
5 | url: https://www.codeeval.com/browse/15/
6 |
--------------------------------------------------------------------------------
/moderate/015-endianness/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/015-endianness/readme.pdf
--------------------------------------------------------------------------------
/moderate/016-number-of-ones/input.txt:
--------------------------------------------------------------------------------
1 | 10
2 | 22
3 | 56
4 |
--------------------------------------------------------------------------------
/moderate/016-number-of-ones/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 16
2 | name: Number of Ones
3 | category: Moderate
4 | summary: Determine the number of one bits in an integer.
5 | url: https://www.codeeval.com/browse/16/
6 |
--------------------------------------------------------------------------------
/moderate/016-number-of-ones/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/016-number-of-ones/readme.pdf
--------------------------------------------------------------------------------
/moderate/017-sum-of-integers/input.txt:
--------------------------------------------------------------------------------
1 | -10,2,3,-2,0,5,-15
2 | 2,3,-2,-1,10
3 |
--------------------------------------------------------------------------------
/moderate/017-sum-of-integers/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 17
2 | name: Sum of Integers
3 | category: Moderate
4 | summary: Determine the largest sum of contiguous integers in an array.
5 | url: "https://www.codeeval.com/browse/17/"
6 |
--------------------------------------------------------------------------------
/moderate/017-sum-of-integers/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/017-sum-of-integers/readme.pdf
--------------------------------------------------------------------------------
/moderate/027-decimal-to-binary/input.txt:
--------------------------------------------------------------------------------
1 | 2
2 | 10
3 | 67
4 |
--------------------------------------------------------------------------------
/moderate/027-decimal-to-binary/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 27
2 | name: Decimal to Binary
3 | category: Moderate
4 | summary: Print the binary representation of a decimal number.
5 | url: https://www.codeeval.com/browse/27/
6 |
--------------------------------------------------------------------------------
/moderate/027-decimal-to-binary/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/027-decimal-to-binary/readme.pdf
--------------------------------------------------------------------------------
/moderate/032-trailing-string/input.txt:
--------------------------------------------------------------------------------
1 | Hello World,World
2 | Hello CodeEval,CodeEval
3 | San Francisco,San Jose
4 |
--------------------------------------------------------------------------------
/moderate/032-trailing-string/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 32
2 | name: Trailing String
3 | category: Moderate
4 | summary: Determine if a string 'B' occurs at the end of string 'A'.
5 | url: https://www.codeeval.com/browse/32/
6 |
--------------------------------------------------------------------------------
/moderate/032-trailing-string/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/032-trailing-string/readme.pdf
--------------------------------------------------------------------------------
/moderate/033-double-squares/input.txt:
--------------------------------------------------------------------------------
1 | 5
2 | 10
3 | 25
4 | 3
5 | 0
6 | 1
7 |
--------------------------------------------------------------------------------
/moderate/033-double-squares/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 33
2 | name: Double Squares
3 | category: Moderate
4 | summary: "FaceBook Hacker Cup 2011: Output the number of ways to write X as the sum of two squares."
5 | url: "https://www.codeeval.com/browse/33/"
6 |
--------------------------------------------------------------------------------
/moderate/033-double-squares/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/033-double-squares/readme.pdf
--------------------------------------------------------------------------------
/moderate/034-number-pairs/input.txt:
--------------------------------------------------------------------------------
1 | 1,2,3,4,6;5
2 | 2,4,5,6,9,11,15;20
3 | 1,2,3,4;50
4 |
--------------------------------------------------------------------------------
/moderate/034-number-pairs/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 34
2 | name: Number Pairs
3 | category: Moderate
4 | summary: Find pairs of numbers in a sorted array whose sum is X.
5 | url: "https://www.codeeval.com/browse/34/"
6 |
--------------------------------------------------------------------------------
/moderate/034-number-pairs/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/034-number-pairs/readme.pdf
--------------------------------------------------------------------------------
/moderate/035-email-validation/input.txt:
--------------------------------------------------------------------------------
1 | foo@bar.com
2 | this is not an email id
3 | admin#codeeval.com
4 | good123@bad.com
5 |
--------------------------------------------------------------------------------
/moderate/035-email-validation/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 35
2 | name: Email Validation
3 | category: Moderate
4 | summary: Write a regular expression to validate an email address.
5 | url: "https://www.codeeval.com/browse/35/"
6 |
--------------------------------------------------------------------------------
/moderate/035-email-validation/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/035-email-validation/readme.pdf
--------------------------------------------------------------------------------
/moderate/037-pangrams/input.txt:
--------------------------------------------------------------------------------
1 | A quick brown fox jumps over the lazy dog
2 | A slow yellow fox crawls under the proactive dog
3 |
--------------------------------------------------------------------------------
/moderate/037-pangrams/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 37
2 | name: Pangrams
3 | category: Moderate
4 | summary: Find the missing alphabets.
5 | url: "https://www.codeeval.com/browse/37/"
6 |
--------------------------------------------------------------------------------
/moderate/037-pangrams/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/037-pangrams/readme.pdf
--------------------------------------------------------------------------------
/moderate/041-array-absurdity/input.txt:
--------------------------------------------------------------------------------
1 | 5;0,1,2,3,0
2 | 20;0,1,10,3,2,4,5,7,6,8,11,9,15,12,13,4,16,18,17,14
3 |
--------------------------------------------------------------------------------
/moderate/041-array-absurdity/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 41
2 | name: Array Absurdity
3 | category: Moderate
4 | summary: Determine if an array contains a duplicated entry.
5 | url: https://www.codeeval.com/browse/41/
6 |
--------------------------------------------------------------------------------
/moderate/041-array-absurdity/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/041-array-absurdity/readme.pdf
--------------------------------------------------------------------------------
/moderate/043-jolly-jumpers/input.txt:
--------------------------------------------------------------------------------
1 | 4 1 4 2 3
2 | 3 7 7 8
3 | 9 8 9 7 10 6 12 17 24 38
4 |
--------------------------------------------------------------------------------
/moderate/043-jolly-jumpers/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 43
2 | name: Jolly Jumpers
3 | category: Moderate
4 | summary: Determine if a sequence of numbers is a Jolly Jumper.
5 | url: "https://www.codeeval.com/browse/43/"
6 |
--------------------------------------------------------------------------------
/moderate/043-jolly-jumpers/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/043-jolly-jumpers/readme.pdf
--------------------------------------------------------------------------------
/moderate/045-reverse-and-add/input.txt:
--------------------------------------------------------------------------------
1 | 195
2 |
--------------------------------------------------------------------------------
/moderate/045-reverse-and-add/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 45
2 | name: Reverse and Add
3 | category: Moderate
4 | summary: Continually add a number to its reverse to arrive at a palindrome.
5 | url: https://www.codeeval.com/browse/45/
6 |
--------------------------------------------------------------------------------
/moderate/045-reverse-and-add/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/045-reverse-and-add/readme.pdf
--------------------------------------------------------------------------------
/moderate/046-prime-numbers/input.txt:
--------------------------------------------------------------------------------
1 | 10
2 | 20
3 | 100
4 |
--------------------------------------------------------------------------------
/moderate/046-prime-numbers/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 46
2 | name: Prime Numbers
3 | category: Moderate
4 | summary: Print prime numbers less than N.
5 | url: "https://www.codeeval.com/browse/46/"
6 |
--------------------------------------------------------------------------------
/moderate/046-prime-numbers/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/046-prime-numbers/readme.pdf
--------------------------------------------------------------------------------
/moderate/054-cash-register/input.txt:
--------------------------------------------------------------------------------
1 | 15.94;16.00
2 | 17;16
3 | 35;35
4 | 45;50
5 |
--------------------------------------------------------------------------------
/moderate/054-cash-register/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 54
2 | name: Cash Register
3 | category: Moderate
4 | summary: Determine the amount of change to be returned.
5 | url: https://www.codeeval.com/browse/54/
6 |
--------------------------------------------------------------------------------
/moderate/054-cash-register/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/054-cash-register/readme.pdf
--------------------------------------------------------------------------------
/moderate/063-counting-primes/input.txt:
--------------------------------------------------------------------------------
1 | 2,10
2 | 20,30
3 |
--------------------------------------------------------------------------------
/moderate/063-counting-primes/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 63
2 | name: Counting Primes
3 | category: Moderate
4 | summary: Count the number of primes between two integers.
5 | url: "https://www.codeeval.com/browse/63/"
6 |
--------------------------------------------------------------------------------
/moderate/063-counting-primes/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/063-counting-primes/readme.pdf
--------------------------------------------------------------------------------
/moderate/066-pascals-triangle/input.txt:
--------------------------------------------------------------------------------
1 | 6
2 |
--------------------------------------------------------------------------------
/moderate/066-pascals-triangle/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 66
2 | name: Pascals Triangle
3 | category: Moderate
4 | summary: Print out pascals triangle upto a certain depth.
5 | url: "https://www.codeeval.com/browse/66/"
6 |
--------------------------------------------------------------------------------
/moderate/066-pascals-triangle/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/066-pascals-triangle/readme.pdf
--------------------------------------------------------------------------------
/moderate/068-valid-parentheses/input.txt:
--------------------------------------------------------------------------------
1 | ()
2 | ([)]
3 |
--------------------------------------------------------------------------------
/moderate/068-valid-parentheses/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 68
2 | name: Valid Parentheses
3 | category: Moderate
4 | summary: Determine if string is a well-formed parentheses.
5 | url: "https://www.codeeval.com/browse/68/"
6 |
--------------------------------------------------------------------------------
/moderate/068-valid-parentheses/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/068-valid-parentheses/readme.pdf
--------------------------------------------------------------------------------
/moderate/070-overlapping-rectangles/input.txt:
--------------------------------------------------------------------------------
1 | -3,3,-1,1,1,-1,3,-3
2 | -3,3,-1,1,-2,4,2,2
3 |
--------------------------------------------------------------------------------
/moderate/070-overlapping-rectangles/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 70
2 | name: Overlapping Rectangles
3 | category: Moderate
4 | summary: Determine if two rectangles overlap.
5 | url: "https://www.codeeval.com/browse/70/"
6 |
--------------------------------------------------------------------------------
/moderate/070-overlapping-rectangles/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/070-overlapping-rectangles/readme.pdf
--------------------------------------------------------------------------------
/moderate/071-reverse-groups/input.txt:
--------------------------------------------------------------------------------
1 | 1,2,3,4,5;2
2 | 1,2,3,4,5;3
3 |
--------------------------------------------------------------------------------
/moderate/071-reverse-groups/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 71
2 | name: Reverse Groups
3 | category: Moderate
4 | summary: Reverse elements in a list k items at a time.
5 | url: "https://www.codeeval.com/browse/71/"
6 |
--------------------------------------------------------------------------------
/moderate/071-reverse-groups/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/071-reverse-groups/readme.pdf
--------------------------------------------------------------------------------
/moderate/073-decode-numbers/input.txt:
--------------------------------------------------------------------------------
1 | 12
2 | 123
3 |
--------------------------------------------------------------------------------
/moderate/073-decode-numbers/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 73
2 | name: Decode Numbers
3 | category: Moderate
4 | summary: Count the number of ways to decode a string.
5 | url: "https://www.codeeval.com/browse/73/"
6 |
--------------------------------------------------------------------------------
/moderate/073-decode-numbers/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/073-decode-numbers/readme.pdf
--------------------------------------------------------------------------------
/moderate/074-minimum-coins/input.txt:
--------------------------------------------------------------------------------
1 | 11
2 | 20
3 |
--------------------------------------------------------------------------------
/moderate/074-minimum-coins/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 74
2 | name: Minimum Coins
3 | category: Moderate
4 | summary: Find the minimum number of coins to arrive at a total.
5 | url: "https://www.codeeval.com/browse/74/"
6 |
--------------------------------------------------------------------------------
/moderate/074-minimum-coins/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/074-minimum-coins/readme.pdf
--------------------------------------------------------------------------------
/moderate/075-flavius-josephus/input.txt:
--------------------------------------------------------------------------------
1 | 10,3
2 | 5,2
3 |
--------------------------------------------------------------------------------
/moderate/075-flavius-josephus/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 75
2 | name: Flavius Josephus
3 | category: Moderate
4 | summary: "Eliminate every i'th item from a circular list."
5 | url: "https://www.codeeval.com/browse/75/"
6 |
--------------------------------------------------------------------------------
/moderate/075-flavius-josephus/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/075-flavius-josephus/readme.pdf
--------------------------------------------------------------------------------
/moderate/076-string-rotation/input.txt:
--------------------------------------------------------------------------------
1 | Hello,lloHe
2 | Basefont,tBasefon
3 |
--------------------------------------------------------------------------------
/moderate/076-string-rotation/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 76
2 | name: String Rotation
3 | category: Moderate
4 | summary: Find if a string is the rotation of another string.
5 | url: https://www.codeeval.com/browse/76/
6 |
--------------------------------------------------------------------------------
/moderate/076-string-rotation/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/076-string-rotation/readme.pdf
--------------------------------------------------------------------------------
/moderate/078-sudoku/input.txt:
--------------------------------------------------------------------------------
1 | 4;1,4,2,3,2,3,1,4,4,2,3,1,3,1,4,2
2 | 4;2,1,3,2,3,2,1,4,1,4,2,3,2,3,4,1
3 |
--------------------------------------------------------------------------------
/moderate/078-sudoku/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 78
2 | name: Sudoku
3 | category: Moderate
4 | summary: Determine if a grid layout is a valid sudoku solution.
5 | url: "https://www.codeeval.com/browse/78/"
6 |
--------------------------------------------------------------------------------
/moderate/078-sudoku/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/078-sudoku/readme.pdf
--------------------------------------------------------------------------------
/moderate/080-uri-comparison/input.txt:
--------------------------------------------------------------------------------
1 | http://abc.com:80/~smith/home.html;http://ABC.com/%7Esmith/home.html
2 |
--------------------------------------------------------------------------------
/moderate/080-uri-comparison/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 80
2 | name: URI Comparison
3 | category: Moderate
4 | summary: Determine if two URIs match.
5 | url: "https://www.codeeval.com/browse/80/"
6 |
--------------------------------------------------------------------------------
/moderate/080-uri-comparison/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/080-uri-comparison/readme.pdf
--------------------------------------------------------------------------------
/moderate/081-sum-to-zero/input.txt:
--------------------------------------------------------------------------------
1 | 2,3,1,0,-4,-1
2 | 0,-1,3,-2
3 |
--------------------------------------------------------------------------------
/moderate/081-sum-to-zero/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 81
2 | name: Sum to Zero
3 | category: Moderate
4 | summary: Count of ways in which the sum of four numbers is zero.
5 | url: "https://www.codeeval.com/browse/81/"
6 |
--------------------------------------------------------------------------------
/moderate/081-sum-to-zero/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/081-sum-to-zero/readme.pdf
--------------------------------------------------------------------------------
/moderate/084-balanced-smileys/input.txt:
--------------------------------------------------------------------------------
1 | :((
2 | i am sick today (:()
3 | (:)
4 | hacker cup: started :):)
5 | )(
6 |
--------------------------------------------------------------------------------
/moderate/084-balanced-smileys/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 84
2 | name: Balanced Smileys
3 | category: Moderate
4 | summary: Facebook Hacker Cup 2013 problem.
5 | url: "https://www.codeeval.com/browse/84/"
6 |
--------------------------------------------------------------------------------
/moderate/084-balanced-smileys/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/084-balanced-smileys/readme.pdf
--------------------------------------------------------------------------------
/moderate/089-pass-triangle/input.txt:
--------------------------------------------------------------------------------
1 | 5
2 | 9 6
3 | 4 6 8
4 | 0 7 1 5
5 |
--------------------------------------------------------------------------------
/moderate/089-pass-triangle/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 89
2 | name: Pass Triangle
3 | category: Moderate
4 | summary: Lead the way within the triangle.
5 | url: "https://www.codeeval.com/browse/89/"
6 |
--------------------------------------------------------------------------------
/moderate/089-pass-triangle/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/089-pass-triangle/readme.pdf
--------------------------------------------------------------------------------
/moderate/094-simple-calculator/input.txt:
--------------------------------------------------------------------------------
1 | 250*14.3
2 | 3^6 / 117
3 | (2.16 - 48.34)^-1
4 | (59 - 15 + 3*6)/21
5 |
--------------------------------------------------------------------------------
/moderate/094-simple-calculator/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 94
2 | name: Simple Calculator
3 | category: Moderate
4 | summary: Create a simple calculator.
5 | url: "https://www.codeeval.com/browse/94/"
6 |
--------------------------------------------------------------------------------
/moderate/094-simple-calculator/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/094-simple-calculator/readme.pdf
--------------------------------------------------------------------------------
/moderate/098-point-in-circle/input.txt:
--------------------------------------------------------------------------------
1 | Center: (2.12, -3.48); Radius: 17.22; Point: (16.21, -5)
2 | Center: (5.05, -11); Radius: 21.2; Point: (-31, -45)
3 | Center: (-9.86, 1.95); Radius: 47.28; Point: (6.03, -6.42)
4 |
--------------------------------------------------------------------------------
/moderate/098-point-in-circle/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 98
2 | name: Point in Circle
3 | category: Moderate
4 | summary: Define whether a point is in a circle.
5 | url: https://www.codeeval.com/browse/98/
6 |
--------------------------------------------------------------------------------
/moderate/098-point-in-circle/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/098-point-in-circle/readme.pdf
--------------------------------------------------------------------------------
/moderate/101-find-a-square/input.txt:
--------------------------------------------------------------------------------
1 | (1,6), (6,7), (2,7), (9,1)
2 | (4,1), (3,4), (0,5), (1,2)
3 | (4,6), (5,5), (5,6), (4,5)
4 |
--------------------------------------------------------------------------------
/moderate/101-find-a-square/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 101
2 | name: Find a Square
3 | category: Moderate
4 | summary: Do 4 points make a square?
5 | url: "https://www.codeeval.com/browse/101/"
6 |
--------------------------------------------------------------------------------
/moderate/101-find-a-square/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/101-find-a-square/readme.pdf
--------------------------------------------------------------------------------
/moderate/117-a-pile-of-bricks/input.txt:
--------------------------------------------------------------------------------
1 | [4,3] [3,-3]|(1 [10,9,4] [9,4,2])
2 | [-1,-5] [5,-2]|(1 [4,7,8] [2,9,0]);(2 [0,7,1] [5,9,8])
3 | [-4,-5] [-5,-3]|(1 [4,8,6] [0,9,2]);(2 [8,-1,3] [0,5,4])
4 |
--------------------------------------------------------------------------------
/moderate/117-a-pile-of-bricks/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 117
2 | name: A Pile of Bricks
3 | category: Moderate
4 | summary: Close a hole in a wall.
5 | url: "https://www.codeeval.com/browse/117/"
6 |
--------------------------------------------------------------------------------
/moderate/117-a-pile-of-bricks/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/117-a-pile-of-bricks/readme.pdf
--------------------------------------------------------------------------------
/moderate/119-chain-inspection/input.txt:
--------------------------------------------------------------------------------
1 | 4-2;BEGIN-3;3-4;2-END
2 | 4-2;BEGIN-3;3-4;2-3
3 |
--------------------------------------------------------------------------------
/moderate/119-chain-inspection/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 119
2 | name: Chain Inspection
3 | category: Moderate
4 | summary: Try to pass a chain.
5 | url: "https://www.codeeval.com/browse/119/"
6 |
--------------------------------------------------------------------------------
/moderate/119-chain-inspection/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/119-chain-inspection/readme.pdf
--------------------------------------------------------------------------------
/moderate/121-lost-in-translation/input.txt:
--------------------------------------------------------------------------------
1 | rbc vjnmkf kd yxyqci na rbc zjkfoscdd ew rbc ujllmcp
2 | tc rbkso rbyr ejp mysljylc kd kxveddknmc re jsicpdrysi
3 | de kr kd eoya kw aej icfkici re zjkr
4 |
--------------------------------------------------------------------------------
/moderate/121-lost-in-translation/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 121
2 | name: Lost in Translation
3 | category: Moderate
4 | summary: Try to become a native speaker.
5 | url: https://www.codeeval.com/browse/121/
6 |
--------------------------------------------------------------------------------
/moderate/121-lost-in-translation/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/121-lost-in-translation/readme.pdf
--------------------------------------------------------------------------------
/moderate/125-predict-the-number/input.txt:
--------------------------------------------------------------------------------
1 | 0
2 | 5
3 | 101
4 | 25684
5 |
--------------------------------------------------------------------------------
/moderate/125-predict-the-number/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 125
2 | name: Predict the Number
3 | category: Moderate
4 | summary: Try to go beyond the limits.
5 | url: "https://www.codeeval.com/browse/125/"
6 |
--------------------------------------------------------------------------------
/moderate/125-predict-the-number/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/125-predict-the-number/readme.pdf
--------------------------------------------------------------------------------
/moderate/130-sequence-transformation/input.txt:
--------------------------------------------------------------------------------
1 | 1010 AAAAABBBBAAAA
2 | 00 AAAAAA
3 | 01001110 AAAABAAABBBBBBAAAAAAA
4 | 1100110 BBAABABBA
5 |
--------------------------------------------------------------------------------
/moderate/130-sequence-transformation/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 130
2 | name: Sequence Transformation
3 | category: Moderate
4 | summary: Transform a binary sequence into a string.
5 | url: "https://www.codeeval.com/browse/130/"
6 |
--------------------------------------------------------------------------------
/moderate/130-sequence-transformation/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/130-sequence-transformation/readme.pdf
--------------------------------------------------------------------------------
/moderate/133-city-blocks-flyover/assets/fig-1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/133-city-blocks-flyover/assets/fig-1.png
--------------------------------------------------------------------------------
/moderate/133-city-blocks-flyover/input.txt:
--------------------------------------------------------------------------------
1 | (0,2,4,8,10,13,14,18,22,23,24,33,40,42,44,47,49,53,55,63,66,81,87,91) (0,147,220)
2 | (0,1,2,4) (0,1,3,4,5)
3 | (0,1,3,4,6) (0,1,2,4)
4 |
--------------------------------------------------------------------------------
/moderate/133-city-blocks-flyover/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 133
2 | name: City Blocks Flyover
3 | category: Moderate
4 | summary: Chart the path of a helicopter from above to discover how many city blocks it flew over.
5 | url: "https://www.codeeval.com/browse/133/"
6 |
--------------------------------------------------------------------------------
/moderate/133-city-blocks-flyover/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/133-city-blocks-flyover/readme.pdf
--------------------------------------------------------------------------------
/moderate/135-word-chain/input.txt:
--------------------------------------------------------------------------------
1 | soup,sugar,peas,rice
2 | ljhqi,nrtxgiu,jdtphez,wosqm
3 | cjz,tojiv,sgxf,awonm,fcv
4 |
--------------------------------------------------------------------------------
/moderate/135-word-chain/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 135
2 | name: Word Chain
3 | category: Moderate
4 | summary: Find the longest chain of words.
5 | url: "https://www.codeeval.com/browse/135/"
6 |
--------------------------------------------------------------------------------
/moderate/135-word-chain/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/135-word-chain/readme.pdf
--------------------------------------------------------------------------------
/moderate/137-seek-for-an-intruder/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 137
2 | name: Seek for an Intruder
3 | category: Moderate
4 | summary: Find the IP address of an intruder.
5 | url: "https://www.codeeval.com/browse/137/"
6 |
--------------------------------------------------------------------------------
/moderate/137-seek-for-an-intruder/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/137-seek-for-an-intruder/readme.pdf
--------------------------------------------------------------------------------
/moderate/138-car-race/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 138
2 | name: Car Race
3 | category: Moderate
4 | summary: Determine the fastest car.
5 | url: "https://www.codeeval.com/browse/138/"
6 |
--------------------------------------------------------------------------------
/moderate/138-car-race/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/138-car-race/readme.pdf
--------------------------------------------------------------------------------
/moderate/143-the-ministry-of-truth/input.txt:
--------------------------------------------------------------------------------
1 | Higher meaning;Hi mean
2 | this is impossible;im possible
3 | twenty two minutes;two minutes
4 | Higher meaning;e
5 |
--------------------------------------------------------------------------------
/moderate/143-the-ministry-of-truth/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 143
2 | name: The Ministry of Truth
3 | category: Moderate
4 | summary: Your task is to help the Big Brother.
5 | url: "https://www.codeeval.com/browse/143/"
6 |
--------------------------------------------------------------------------------
/moderate/143-the-ministry-of-truth/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/143-the-ministry-of-truth/readme.pdf
--------------------------------------------------------------------------------
/moderate/146-bats-challenge/input.txt:
--------------------------------------------------------------------------------
1 | 22 2 2 9 11
2 | 33 5 0
3 | 16 3 2 6 10
4 | 835 125 1 113
5 | 47 5 0
6 |
--------------------------------------------------------------------------------
/moderate/146-bats-challenge/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 146
2 | name: Bats Challenge
3 | category: Moderate
4 | summary: Count bats on the wire.
5 | url: "https://www.codeeval.com/browse/146/"
6 |
--------------------------------------------------------------------------------
/moderate/146-bats-challenge/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/146-bats-challenge/readme.pdf
--------------------------------------------------------------------------------
/moderate/148-color-code-converter/input.txt:
--------------------------------------------------------------------------------
1 | (0.56,0.94,0.21,0.02)
2 | HSL(359,0,0)
3 | HSV(276,33,7)
4 | #cfa9c4
5 |
--------------------------------------------------------------------------------
/moderate/148-color-code-converter/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 148
2 | name: Color Code Converter
3 | category: Moderate
4 | summary: Determine and convert the color code.
5 | url: "https://www.codeeval.com/browse/148/"
6 |
--------------------------------------------------------------------------------
/moderate/148-color-code-converter/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/148-color-code-converter/readme.pdf
--------------------------------------------------------------------------------
/moderate/150-roman-and-arabic/input.txt:
--------------------------------------------------------------------------------
1 | 3M1D2C
2 | 2I3I2X9V1X
3 |
--------------------------------------------------------------------------------
/moderate/150-roman-and-arabic/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 150
2 | name: Roman and Arabic
3 | category: Moderate
4 | summary: Calculate aromatic numbers.
5 | url: "https://www.codeeval.com/browse/150/"
6 |
--------------------------------------------------------------------------------
/moderate/150-roman-and-arabic/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/150-roman-and-arabic/readme.pdf
--------------------------------------------------------------------------------
/moderate/153-locks/input.txt:
--------------------------------------------------------------------------------
1 | 3 1
2 | 100 100
3 |
--------------------------------------------------------------------------------
/moderate/153-locks/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 153
2 | name: Locks
3 | category: Moderate
4 | summary: Calculate unlocked doors.
5 | url: "https://www.codeeval.com/browse/153/"
6 |
--------------------------------------------------------------------------------
/moderate/153-locks/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/153-locks/readme.pdf
--------------------------------------------------------------------------------
/moderate/158-interrupted-bubble-sort/input.txt:
--------------------------------------------------------------------------------
1 | 36 47 78 28 20 79 87 16 8 45 72 69 81 66 60 8 3 86 90 90 | 1
2 | 40 69 52 42 24 16 66 | 2
3 | 54 46 0 34 15 48 47 53 25 18 50 5 21 76 62 48 74 1 43 74 78 29 | 6
4 | 48 51 5 61 18 | 2
5 | 59 68 55 31 73 4 1 25 26 19 60 0 | 2
6 |
--------------------------------------------------------------------------------
/moderate/158-interrupted-bubble-sort/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 158
2 | name: Interrupted Bubble Sort
3 | category: Moderate
4 | summary: Sort a list of elements. Partially.
5 | url: "https://www.codeeval.com/browse/158/"
6 |
--------------------------------------------------------------------------------
/moderate/158-interrupted-bubble-sort/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/158-interrupted-bubble-sort/readme.pdf
--------------------------------------------------------------------------------
/moderate/161-game-of-life/input.txt:
--------------------------------------------------------------------------------
1 | .........*
2 | .*.*...*..
3 | ..........
4 | ..*.*....*
5 | .*..*...*.
6 | .........*
7 | ..........
8 | .....*..*.
9 | .*....*...
10 | .....**...
11 |
--------------------------------------------------------------------------------
/moderate/161-game-of-life/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 161
2 | name: Game of Life
3 | category: Moderate
4 | summary: Implement the classical cellular automaton game.
5 | url: "https://www.codeeval.com/browse/161/"
6 |
--------------------------------------------------------------------------------
/moderate/161-game-of-life/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/161-game-of-life/readme.pdf
--------------------------------------------------------------------------------
/moderate/165-suggest-groups/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 165
2 | name: Suggest Groups
3 | category: Moderate
4 | summary: Help your friends to join groups.
5 | url: "https://www.codeeval.com/browse/165/"
6 |
--------------------------------------------------------------------------------
/moderate/165-suggest-groups/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/165-suggest-groups/readme.pdf
--------------------------------------------------------------------------------
/moderate/169-filename-pattern/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 169
2 | name: Filename Pattern
3 | category: Moderate
4 | summary: Filter a list of filenames.
5 | url: "https://www.codeeval.com/browse/169/"
6 |
--------------------------------------------------------------------------------
/moderate/169-filename-pattern/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/169-filename-pattern/readme.pdf
--------------------------------------------------------------------------------
/moderate/170-guess-the-number/assets/fig-1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/170-guess-the-number/assets/fig-1.png
--------------------------------------------------------------------------------
/moderate/170-guess-the-number/input.txt:
--------------------------------------------------------------------------------
1 | 100 Lower Lower Higher Lower Lower Lower Yay!
2 | 948 Higher Lower Yay!
3 |
--------------------------------------------------------------------------------
/moderate/170-guess-the-number/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 170
2 | name: Guess the Number
3 | category: Moderate
4 | summary: Guess the number in log2(N) steps.
5 | url: "https://www.codeeval.com/browse/170/"
6 |
--------------------------------------------------------------------------------
/moderate/170-guess-the-number/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/170-guess-the-number/readme.pdf
--------------------------------------------------------------------------------
/moderate/172-card-number-validation/input.txt:
--------------------------------------------------------------------------------
1 | 6011 5940 0319 9511
2 | 5537 0213 6797 6815
3 | 5574 8363 8022 9735
4 | 3044 8507 9391 30
5 | 6370 1675 9034 6211 774
6 |
--------------------------------------------------------------------------------
/moderate/172-card-number-validation/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 172
2 | name: Card Number Validation
3 | category: Moderate
4 | summary: Check if bank card numbers are valid.
5 | url: https://www.codeeval.com/browse/172/
6 |
--------------------------------------------------------------------------------
/moderate/172-card-number-validation/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/172-card-number-validation/readme.pdf
--------------------------------------------------------------------------------
/moderate/177-justify-the-text/input.txt:
--------------------------------------------------------------------------------
1 | Hello, World!
2 | The precise 50-digits value of Pi is 3.14159265358979323846264338327950288419716939937510.
3 | But he who would be a great man ought to regard, not himself or his interests, but what is just, whether the just act be his own or that of another. Next as to habitations. Such is the tradition.
4 |
--------------------------------------------------------------------------------
/moderate/177-justify-the-text/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 177
2 | name: Justify the Text
3 | category: Moderate
4 | summary: Align the text to the specified width.
5 | url: "https://www.codeeval.com/browse/177/"
6 |
--------------------------------------------------------------------------------
/moderate/177-justify-the-text/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/177-justify-the-text/readme.pdf
--------------------------------------------------------------------------------
/moderate/179-broken-lcd/assets/fig-1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/179-broken-lcd/assets/fig-1.png
--------------------------------------------------------------------------------
/moderate/179-broken-lcd/assets/fig-2.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/179-broken-lcd/assets/fig-2.png
--------------------------------------------------------------------------------
/moderate/179-broken-lcd/assets/fig-3.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/179-broken-lcd/assets/fig-3.png
--------------------------------------------------------------------------------
/moderate/179-broken-lcd/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 179
2 | name: Broken LCD
3 | category: Moderate
4 | summary: Determine whether a given number can be displayed on the damaged LCD.
5 | url: https://www.codeeval.com/browse/179/
6 |
--------------------------------------------------------------------------------
/moderate/179-broken-lcd/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/179-broken-lcd/readme.pdf
--------------------------------------------------------------------------------
/moderate/181-gronsfeld-cipher/assets/fig-1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/181-gronsfeld-cipher/assets/fig-1.png
--------------------------------------------------------------------------------
/moderate/181-gronsfeld-cipher/assets/fig-2.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/181-gronsfeld-cipher/assets/fig-2.png
--------------------------------------------------------------------------------
/moderate/181-gronsfeld-cipher/input.txt:
--------------------------------------------------------------------------------
1 | 31415;HYEMYDUMPS
2 | 45162;M%muxi%dncpqftiix"
3 | 14586214;Uix!&kotvx3
4 |
--------------------------------------------------------------------------------
/moderate/181-gronsfeld-cipher/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 181
2 | name: Gronsfeld Cipher
3 | category: Moderate
4 | summary: Decipher the message enciphered with the Gronsfeld cipher.
5 | url: "https://www.codeeval.com/browse/181/"
6 |
--------------------------------------------------------------------------------
/moderate/181-gronsfeld-cipher/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/181-gronsfeld-cipher/readme.pdf
--------------------------------------------------------------------------------
/moderate/184-burrows-wheeler-transform/input.txt:
--------------------------------------------------------------------------------
1 | oooooooo$ ffffffff ffffffffuuuuuuuuaaaaaaaallllllllbbBbbBBb|
2 | edarddddddddddntensr$ ehhhhhhhhhhhJ aeaaaaaaaaaaalhtf thmbfe tcwohiahoJ eeec t e |
3 | ooooio,io$Nnssshhhjo ee o nnkkkkkkii |
4 |
--------------------------------------------------------------------------------
/moderate/184-burrows-wheeler-transform/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 184
2 | name: Burrows-Wheeler Transform
3 | category: Moderate
4 | summary: Complete file decompression by inverting BWT.
5 | url: "https://www.codeeval.com/browse/184/"
6 |
--------------------------------------------------------------------------------
/moderate/184-burrows-wheeler-transform/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/184-burrows-wheeler-transform/readme.pdf
--------------------------------------------------------------------------------
/moderate/187-consecutive-primes/assets/fig-1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/187-consecutive-primes/assets/fig-1.png
--------------------------------------------------------------------------------
/moderate/187-consecutive-primes/input.txt:
--------------------------------------------------------------------------------
1 | 2
2 | 4
3 | 5
4 |
--------------------------------------------------------------------------------
/moderate/187-consecutive-primes/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 187
2 | name: Consecutive Primes
3 | category: Moderate
4 | summary: Determine how many ways the numbers can be arranged such that every consecutive pair sums to a prime.
5 | url: "https://www.codeeval.com/browse/187/"
6 |
--------------------------------------------------------------------------------
/moderate/187-consecutive-primes/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/187-consecutive-primes/readme.pdf
--------------------------------------------------------------------------------
/moderate/190-number-operations/input.txt:
--------------------------------------------------------------------------------
1 | 44 6 1 49 47
2 | 34 1 49 2 21
3 | 31 38 27 51 18
4 |
--------------------------------------------------------------------------------
/moderate/190-number-operations/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 190
2 | name: Number Operations
3 | category: Moderate
4 | summary: Determine if it is possible to produce the number 42 with five cards.
5 | url: "https://www.codeeval.com/browse/190/"
6 |
--------------------------------------------------------------------------------
/moderate/190-number-operations/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/190-number-operations/readme.pdf
--------------------------------------------------------------------------------
/moderate/193-magic-numbers/input.txt:
--------------------------------------------------------------------------------
1 | 10 100
2 | 8382 8841
3 |
--------------------------------------------------------------------------------
/moderate/193-magic-numbers/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 193
2 | name: Magic Numbers
3 | category: Moderate
4 | summary: Print out a list of all the magic numbers in a provided range.
5 | url: "https://www.codeeval.com/browse/193/"
6 |
--------------------------------------------------------------------------------
/moderate/193-magic-numbers/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/193-magic-numbers/readme.pdf
--------------------------------------------------------------------------------
/moderate/194-twenty-forty-eight/assets/fig-1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/194-twenty-forty-eight/assets/fig-1.png
--------------------------------------------------------------------------------
/moderate/194-twenty-forty-eight/input.txt:
--------------------------------------------------------------------------------
1 | RIGHT; 4; 4 0 2 0|0 0 0 8|4 0 2 4|2 4 2 2
2 | UP; 4; 2 0 2 0|0 2 0 4|2 8 0 8|0 8 0 16
3 |
--------------------------------------------------------------------------------
/moderate/194-twenty-forty-eight/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 194
2 | name: Twenty Forty Eight
3 | category: Moderate
4 | summary: Implement the 2048 game logic.
5 | url: "https://www.codeeval.com/browse/194/"
6 |
--------------------------------------------------------------------------------
/moderate/194-twenty-forty-eight/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/194-twenty-forty-eight/readme.pdf
--------------------------------------------------------------------------------
/moderate/197-column-names/input.txt:
--------------------------------------------------------------------------------
1 | 52
2 | 3702
3 |
--------------------------------------------------------------------------------
/moderate/197-column-names/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 197
2 | name: Column Names
3 | category: Moderate
4 | summary: Convert integer to excel-style column name.
5 | url: "https://www.codeeval.com/browse/197/"
6 |
--------------------------------------------------------------------------------
/moderate/197-column-names/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/197-column-names/readme.pdf
--------------------------------------------------------------------------------
/moderate/200-sort-matrix-columns/input.txt:
--------------------------------------------------------------------------------
1 | -3 29 -3 | -17 69 -17 | 44 3 8
2 | 25 39 -26 -21 | -81 -98 -91 27 | 32 -87 67 98 | -90 -79 18 9
3 | 26 -10 39 | -62 66 97 | 22 85 36
4 |
--------------------------------------------------------------------------------
/moderate/200-sort-matrix-columns/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 200
2 | name: Sort Matrix Columns
3 | category: Moderate
4 | summary: Sort matrix columns from lowest to highest numbers.
5 | url: "https://www.codeeval.com/browse/200/"
6 |
--------------------------------------------------------------------------------
/moderate/200-sort-matrix-columns/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/200-sort-matrix-columns/readme.pdf
--------------------------------------------------------------------------------
/moderate/206-lucky-tickets/input.txt:
--------------------------------------------------------------------------------
1 | 4
2 | 6
3 | 8
4 |
--------------------------------------------------------------------------------
/moderate/206-lucky-tickets/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 206
2 | name: Lucky Tickets
3 | category: Moderate
4 | summary: Count the lucky tickets.
5 | url: "https://www.codeeval.com/browse/206/"
6 |
--------------------------------------------------------------------------------
/moderate/206-lucky-tickets/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/206-lucky-tickets/readme.pdf
--------------------------------------------------------------------------------
/moderate/209-black-or-white/assets/fig-1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/209-black-or-white/assets/fig-1.png
--------------------------------------------------------------------------------
/moderate/209-black-or-white/input.txt:
--------------------------------------------------------------------------------
1 | 11 | 11
2 | 1001 | 0110 | 1001 | 0110
3 | 110 | 101 | 111
4 | 000 | 000 | 000
5 |
--------------------------------------------------------------------------------
/moderate/209-black-or-white/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 209
2 | name: Black or White
3 | category: Moderate
4 | summary: Find the smallest submatrix.
5 | url: "https://www.codeeval.com/browse/209/"
6 |
--------------------------------------------------------------------------------
/moderate/209-black-or-white/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/209-black-or-white/readme.pdf
--------------------------------------------------------------------------------
/moderate/212-robo-and-robitta/assets/fig-1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/212-robo-and-robitta/assets/fig-1.png
--------------------------------------------------------------------------------
/moderate/212-robo-and-robitta/input.txt:
--------------------------------------------------------------------------------
1 | 3x2 | 2 1
2 | 4x4 | 3 3
3 |
--------------------------------------------------------------------------------
/moderate/212-robo-and-robitta/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 212
2 | name: Robo and Robitta
3 | category: Moderate
4 | summary: Count all nuts.
5 | url: "https://www.codeeval.com/browse/212/"
6 |
--------------------------------------------------------------------------------
/moderate/212-robo-and-robitta/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/212-robo-and-robitta/readme.pdf
--------------------------------------------------------------------------------
/moderate/215-double-trouble/input.txt:
--------------------------------------------------------------------------------
1 | ABA*
2 | BAA*
3 | A*A*
4 |
--------------------------------------------------------------------------------
/moderate/215-double-trouble/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 215
2 | name: Double Trouble
3 | category: Moderate
4 | summary: Calculate the number of correct variants for messages.
5 | url: "https://www.codeeval.com/browse/215/"
6 |
--------------------------------------------------------------------------------
/moderate/215-double-trouble/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/215-double-trouble/readme.pdf
--------------------------------------------------------------------------------
/moderate/218-builders-team/assets/fig-1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/218-builders-team/assets/fig-1.png
--------------------------------------------------------------------------------
/moderate/218-builders-team/input.txt:
--------------------------------------------------------------------------------
1 | 1 2 | 6 7 | 7 2 | 1 6 | 2 3
2 | 1 2 | 6 7 | 7 2 | 1 6 | 2 3 | 7 8 | 3 8
3 | 1 2 | 1 6 | 6 7
4 |
--------------------------------------------------------------------------------
/moderate/218-builders-team/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 218
2 | name: Builders Team
3 | category: Moderate
4 | summary: Count all squares on the map.
5 | url: "https://www.codeeval.com/browse/218/"
6 |
--------------------------------------------------------------------------------
/moderate/218-builders-team/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/218-builders-team/readme.pdf
--------------------------------------------------------------------------------
/moderate/221-organizational-hierarchy/input.txt:
--------------------------------------------------------------------------------
1 | ab | ae | bc
2 | ab | bc | cd | ae | cx | xz
3 |
--------------------------------------------------------------------------------
/moderate/221-organizational-hierarchy/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 221
2 | name: Organizational Hierarchy
3 | category: Moderate
4 | summary: Recreate the hierarchy tree.
5 | url: "https://www.codeeval.com/browse/221/"
6 |
--------------------------------------------------------------------------------
/moderate/221-organizational-hierarchy/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/221-organizational-hierarchy/readme.pdf
--------------------------------------------------------------------------------
/moderate/223-alternative-reality/input.txt:
--------------------------------------------------------------------------------
1 | 100
2 | 4
3 | 17
4 |
--------------------------------------------------------------------------------
/moderate/223-alternative-reality/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 223
2 | name: Alternative Reality
3 | category: Moderate
4 | summary: Count all alternative ways.
5 | url: "https://www.codeeval.com/browse/223/"
6 |
--------------------------------------------------------------------------------
/moderate/223-alternative-reality/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/223-alternative-reality/readme.pdf
--------------------------------------------------------------------------------
/moderate/226-try-to-solve-it/input.txt:
--------------------------------------------------------------------------------
1 | mke
2 | mh
3 | lhsby
4 | pm
5 |
--------------------------------------------------------------------------------
/moderate/226-try-to-solve-it/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 226
2 | name: Try to Solve It
3 | category: Moderate
4 | summary: How good decoder are you?
5 | url: "https://www.codeeval.com/browse/226/"
6 |
--------------------------------------------------------------------------------
/moderate/226-try-to-solve-it/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/226-try-to-solve-it/readme.pdf
--------------------------------------------------------------------------------
/moderate/228-to-pi-or-not-to-pi/assets/fig-1.png:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/228-to-pi-or-not-to-pi/assets/fig-1.png
--------------------------------------------------------------------------------
/moderate/228-to-pi-or-not-to-pi/input.txt:
--------------------------------------------------------------------------------
1 | 3
2 | 1
3 | 1654
4 |
--------------------------------------------------------------------------------
/moderate/228-to-pi-or-not-to-pi/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 228
2 | name: To PI or Not to PI
3 | category: Moderate
4 | summary: Print a PI number.
5 | url: "https://www.codeeval.com/browse/228/"
6 |
--------------------------------------------------------------------------------
/moderate/228-to-pi-or-not-to-pi/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/228-to-pi-or-not-to-pi/readme.pdf
--------------------------------------------------------------------------------
/moderate/231-meet-cocktail-sort/input.txt:
--------------------------------------------------------------------------------
1 | 5 4 9 10 7 3 2 1 6 | 1
2 | 9 8 7 6 5 4 3 2 1 | 3
3 |
--------------------------------------------------------------------------------
/moderate/231-meet-cocktail-sort/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 231
2 | name: Meet Cocktail Sort
3 | category: Moderate
4 | summary: Learn more about cocktail sort algorithm.
5 | url: "https://www.codeeval.com/browse/231/"
6 |
--------------------------------------------------------------------------------
/moderate/231-meet-cocktail-sort/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/231-meet-cocktail-sort/readme.pdf
--------------------------------------------------------------------------------
/moderate/233-meet-comb-sort/input.txt:
--------------------------------------------------------------------------------
1 | 3 1 2
2 | 5 4 3 2 1
3 |
--------------------------------------------------------------------------------
/moderate/233-meet-comb-sort/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 233
2 | name: Meet Comb Sort
3 | category: Moderate
4 | summary: Learn more about the comb sort algorithm.
5 | url: "https://www.codeeval.com/browse/233/"
6 |
--------------------------------------------------------------------------------
/moderate/233-meet-comb-sort/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/233-meet-comb-sort/readme.pdf
--------------------------------------------------------------------------------
/moderate/236-beat-or-bit/input.txt:
--------------------------------------------------------------------------------
1 | 1111 | 1110
2 | 10 | 1100001 | 101
3 |
--------------------------------------------------------------------------------
/moderate/236-beat-or-bit/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 236
2 | name: Beat or Bit
3 | category: Moderate
4 | summary: Learn more about the Gray code algorithm.
5 | url: "https://www.codeeval.com/browse/236/"
6 |
--------------------------------------------------------------------------------
/moderate/236-beat-or-bit/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/236-beat-or-bit/readme.pdf
--------------------------------------------------------------------------------
/moderate/238-code-combinations/input.txt:
--------------------------------------------------------------------------------
1 | **** | *co* | *de* | ****
2 | codx | decx
3 | co | dx
4 |
--------------------------------------------------------------------------------
/moderate/238-code-combinations/meta.yaml:
--------------------------------------------------------------------------------
1 | problemId: 238
2 | name: Code Combinations
3 | category: Moderate
4 | summary: Check whether you can make words from the given letters.
5 | url: "https://www.codeeval.com/browse/238/"
6 |
--------------------------------------------------------------------------------
/moderate/238-code-combinations/readme.pdf:
--------------------------------------------------------------------------------
https://raw.githubusercontent.com/rdtsc/codeeval-problem-statements/c60b2886e57468e1fafcbee59073313f5bbed60a/moderate/238-code-combinations/readme.pdf
--------------------------------------------------------------------------------